Experimental Results

This section presents the comprehensive experimental results from our engineering of Kluyveromyces marxianus for A2 β-casein production. Our findings demonstrate successful genetic integration, metabolic characterization, and protein expression analysis, providing critical insights into the potential of microbial dairy protein synthesis.

Key Experimental Findings

Genetic Engineering Success

Successful integration of A2 β-casein and RuBisCO genes into K. marxianus genome with high transformation efficiency

Metabolic Impact

RuBisCO-positive strains showed enhanced stationary phase stability and altered carbon utilization dynamics

Growth Characteristics

Engineered strains exhibited distinct growth patterns under both aerobic and anaerobic conditions

Protein Expression

Successful gene integration confirmed, though protein detection requires optimization of extraction methods

Plasmid & Primer Verification

Plasmid Preservation & Transformation Efficiency

Transformation Success Metrics

Transformation Results:

Competent cells: E. coli DH5α showed high transformation efficiency (>10⁸ CFU/μg DNA)
Plasmid stability: Recombinant plasmids maintained integrity through multiple generations
Colony selection: Single colonies appeared after 12-16 hours on selective media
Storage viability: Glycerol stocks maintained at -80°C showed 100% viability after 3 months

Primer Validation

All Rainbow primers (Rainbow1, Rainbow5, Rainbow12, Rainbow13, Rainbow14, Rainbow34) demonstrated high specificity and efficiency in PCR amplification. M13-F and M13-R primers served as reliable controls for vector backbone verification.

Primer Sequences & Applications

Primer Name	Sequence (5'→3')	Application	Target
Rainbow1 / KI-PLac4-3'End-F	CCGCGGGGATCGACTCATAAAATAG	Cassette assembly	Lac4 promoter region
Rainbow5 / KI-PGapDH-F	AGTATGGTAACGACCGTACAGGCAA	Cassette assembly	GapDH promoter
Rainbow12 / ScTTGap_Sc-PADHI-R	GGAATCCCGATGTATGGGTTTGGTT GCCAGAAAAAGGAAGTCCATATTG TACACTGGCGGAAAAAATTCTTTGTAAAA	Terminator assembly	ADH1 terminator
Rainbow13 / Sc-PADHI-F	GTGTACAATATGGACTTCCTCTTTTC	Promoter assembly	ADH1 promoter
Rainbow14 / KI-PLac4-5'End-R	GAATTTAGGAATTTTAAACTTG	Integration verification	Lac4 integration site
Rainbow34 / KITTLac4_KI-PGapDH	GGACTCCAGCTTTTCCATTTGCCTTC GCGCTTGCCTGTACGGTCGTTACCA TACTTATACAACATCGAAGAAGAGTC T	Homologous recombination	Lac4-GapDH junction

Gel Electrophoresis Verification

K. marxianus 301 Strain Verification

RuBisCO Gene Integration Confirmation

PCR Amplification Results:

Target genes: kit5 and kit6 containing RuBisCO Form I and Form II genes
Amplification: Clear bands at expected sizes confirmed successful integration
Strain designation: KM 301 confirmed to contain both Form I and Form II RuBisCO
Location: Genes integrated in kit2, kit5, and kit6 positions

A2B Gene Ligation into Kit1

Restriction Digest Confirmation

Restriction Analysis:

Enzymes: NotI and XhoI restriction sites engineered into A2B fragment
Digestion conditions: 37°C for 1 hour, followed by 65°C for 20 min inactivation
Result: Successful release of ~760 bp A2B insert from Kit1 vector
Sequencing: Sanger sequencing confirmed correct A2B sequence (see Supplementary Document)

Reaction Composition: 22 μL nuclease-free water, 5 μL NEBuffer 3.1, 1 μL NotI, 2 μL XhoI, 5 μL A2B PCR product (45 ng/μL).

Gel Extraction & Purification Efficiency

DNA Fragment Recovery

Cassette 1 Recovery:

Size: ~1000 bp
Yield: ~150 ng/μL
Purity: A260/A280 = 1.8-2.0
Quality: Bright, well-defined bands

Figure 1: PCR verification results of transformants using genomic DNA extracted with the InstaGene Matrix. A distinct band appeared at approximately 3000 bp, indicating that the cassette 1 fragment was successfully integrated into the host genome.

Cassette 3 Recovery:

Size: ~3000 bp
Yield: ~150 ng/μL
Purity: A260/A280 = 1.8-2.0
Quality: High PCR amplification efficiency

The obtained DNA fragments exhibited high purity and sufficient concentration, making them ideal templates for subsequent PGASO assembly and yeast transformation. The intensity of the bright bands indicated adequate DNA yield for electroporation, which improved transformation success rates.

Gene Integration in Yeast Transformants

Transformation Efficiency & Colony Selection

Electroporation Success Rates

Transformation Outcomes:

Total transformants: 32 colonies isolated across different construct combinations
Selection: Hygromycin B (60 μg/mL) effective for positive selection
Recovery: 12-hour cultivation in YPD sufficient for colony PCR analysis
Efficiency: ~80% of colonies showed successful gene integration

Strain Designations

807 Series:

807t1–t8: Bos taurus A2B + RuBisCO genes
807m1–m8: Bos grunniens A2B + RuBisCO genes

812 Series:

812t1–t8: Bos taurus A2B only
812m1–m8: Bos grunniens A2B only

Figure 2: 807 series transformants (A2B + RuBisCO)

Figure 3: 812 series transformants (A2B only)

PCR Verification of Gene Integration

Genomic Integration Confirmation

Verification Results:

Cassette I integration: Distinct band at ~3000 bp confirmed successful integration
Transformation efficiency: Except for sample m2, all transformants showed clear amplification
Strong signals: m1, m4, m5, m8, t3, and t4 showed particularly high transformation efficiency
Group comparison: t group generally showed higher transformation efficiency than m group

Figure 4: PCR verification showing ~3000 bp Cassette I integration

Figure 5: Colony PCR of HygB-resistant transformants

Figure 6: Target fragment amplification (~800 bp)

Selected Strains for Protein Production

Based on PCR verification, six transformants were selected for downstream protein expression experiments: 807t2, 807t6, 807m5, 807m6, 812t1, and 812m7. These strains showed the strongest and most consistent integration signals.

Growth & Physiological Measurements

Open Culture (Aerobic) Growth Analysis

Long-term Growth Characteristics

Key Observations:

Growth patterns: RuBisCO-negative strains (KM 4G5, 812t1, 812m7) exhibited slower growth under aerobic conditions
Stationary phase: After 108 hours, RuBisCO-negative groups showed more rapid OD decline
Phenotypic changes: 812t1 and 812m7 cultures showed gradual defoaming and marked OD decline over time
Metabolic burden: Casein gene expression imposed higher metabolic load, reducing basic metabolic efficiency

Strains carrying the RuBisCO gene appeared to utilize carbon sources more efficiently, maintaining better growth and stability during stationary phase. This suggests that RuBisCO expression may contribute to metabolic flexibility under nutrient-limited conditions.

Closed Culture (Anaerobic) Growth Analysis

Oxygen-Limited Growth Dynamics

Anaerobic Performance:

Oxygen depletion: Sealed bottles reached ~1% of initial oxygen by incubation end
Sampling frequency: Every 4 hours for 24 hours provided high-resolution growth data
Replication: All measurements conducted in triplicate (n=3)
GC integration: Simultaneous headspace gas analysis enabled metabolic correlation

Metabolic Burden Assessment

Heterologous Expression Impact

Resource Allocation Effects:

Casein expression cost: Strains with casein gene but lacking RuBisCO showed more pronounced growth decline
Control comparison: KM 4G5 (no casein gene) exhibited similar but less severe growth attenuation
Nutrient depletion: Accelerated nutrient consumption observed in high-expression strains
Competitive advantage: RuBisCO-positive strains maintained growth stability despite metabolic burden

Under sufficient oxygen but limited nutrient conditions, heterologous protein expression imposed significant metabolic burden. However, RuBisCO co-expression appeared to mitigate this burden through enhanced carbon utilization efficiency, particularly during stationary phase.

Gas Chromatography Analysis

CO₂ Emission Profiles

GC Analysis Findings:

Unexpected result: Control strain KM 4G5 demonstrated highest growth efficiency per unit CO₂ emission
Time-dependent pattern: After 16 hours, RuBisCO-containing strains showed slower CO₂ emission increase
Carbon utilization: Altered carbon dynamics observed in engineered strains
Method reliability: Triplicate measurements showed high reproducibility (<5% variation)

OD-GC Correlation Analysis

Integrated Results Interpretation:

Anaerobic conditions: KM 4G5 displayed lower CO₂ emission while maintaining superior growth
Exponential phase: KM 4G5 grew faster than engineered strains initially
Stationary phase advantage: RuBisCO-positive strains showed enhanced stability and slower OD decline
Metabolic timing: RuBisCO contribution appears more significant during stationary phase

While our initial hypothesis predicted higher growth efficiency for RuBisCO-containing strains at equivalent CO₂ emission levels, the results revealed a more complex relationship. RuBisCO expression appears to confer advantages primarily during nutrient-limited stationary phases rather than during exponential growth, suggesting context-dependent metabolic benefits.

Protein Expression Analysis

Cell Disruption Efficiency

Freeze-Thaw Lysis Assessment

Lysis Protocol Outcomes:

Method: Six freeze-thaw cycles (liquid N₂ 30 sec, -80°C water 60 sec)
Cell wall digestion: 0.3% Lyticase (10 U/μL) effective for pre-treatment
Visual observation: Cells showed swelling and partial rupture
Protein release: Limited target protein detection in supernatant fractions

Limitation Identified: The freeze-thaw approach primarily caused cell swelling and partial rupture. While proteins within disrupted cells were expected to release into supernatant, insufficient release was detected, suggesting either incomplete lysis or formation of small membrane pores preventing efficient protein extraction.

SDS-PAGE Analysis

Protein Detection Challenges

Electrophoresis Results:

Target protein: A2 β-casein expected at ~24 kDa
Observation: No distinct band representing target protein detected
Sample analysis: Both supernatant and pellet fractions examined
Method assessment: Cell disruption identified as potential bottleneck

Interpretation: The absence of the target protein band suggests that either the cell disruption method was insufficient for complete protein release, or the expression levels were below detection limits. Alternative lysis methods and expression optimization are required for conclusive protein detection.

Conclusions & Future Directions

Protein Expression Optimization Strategy

Identified Improvements:

Cell disruption: Optimize lysis method (bead beating, French press, or detergent-based)
Expression verification: Introduce GFP reporter to confirm Kit1 translation capability
Induction optimization: Fine-tune Lac4 promoter induction conditions
Detection sensitivity: Implement Western blotting for enhanced protein detection

While successful gene integration was conclusively demonstrated through multiple verification methods, protein expression detection requires methodological optimization. Future work will focus on improving cell disruption efficiency and implementing more sensitive detection methods to confirm functional A2 β-casein production in our engineered K. marxianus strains.

Overall Conclusions

Key Experimental Achievements