Experiments

This page documents all our wet lab experiments, protocols, and procedures.

Protocols

Isolation and Purification of pdCas9 Plasmid and dnaAP2-GFP Plasmid

Plasmid Isolation using Macherey-Nagel NucleoSpin Plasmid DNA Purification Kit for Low Copy Plasmids

Notes Before Starting

This protocol is optimized for low-copy plasmids, P1 constructs, or cosmids.
Larger culture volumes require proportionally more lysis buffer than high-copy plasmid preps.
For frequent use, order an additional NucleoSpin® Buffer Set.
Ensure Wash Buffer A4 is prepared (see kit manual, Section 3).
Check Buffer A2 for SDS precipitate:
- If a white precipitate is visible → warm buffer at 30–40°C until dissolved.
- Cool to room temperature (18–25°C) before use.

Final Notes

Eluted DNA is ready for downstream applications (restriction digestion, cloning, PCR, sequencing, etc.).
For higher yield: perform a second elution with 30–50 µL buffer (heated to 70°C)
Store DNA at –20°C for long-term use.

Gel Electrophoresis for Confirmation of Plasmid

Protocol:

Mix 0.42g of agarose in 60 ml of TBE buffer (0.7% Agarose). Heat the solution to dissolve agarose.
Add 1.8 μL of SYBR dye in the solution after the agarose cooled down.
Place the combs in the gel plate and pour the gel.
Wait for it to solidify for 30 minutes.
Place the gel in the electrophoresis unit and added around 250 ml of TBE buffer (1X) Add buffer till the wells were submerged
Mix 4μL plasmid sample with 2 μL of 6x loading dye
Load DNA ladder and plasmid sample in the wells.
Run the gel at 100V for 45 minutes.
Observe the gel under UV.

Cloning of gRNA Target Sequence into the dCas9 Plasmid

Annealing of Oligonucleotides to Make dsDNA

(This dsDNA has the target sequence for dnaAP2 and overhangs for BsaI sites)

Reaction mix:

oligo 1(100 uM): 1 μL
oligo 2(100 uM): 1 μL
NEB T4 PNK Buffer (10x): 1 μL
T4 PNK (Polynucleotide Kinase): 0.5 μL
Nuclease free water: 6.5 μL
Total = 10 μL

Incubation:

Incubate at 37°C for 2 hours
Store at –20℃

Digestion of pdCas9 Plasmid with BsaI (Eco31I)

Reaction Mix:

dCas9 plasmid (218 ng/μL): 4 μL
BsaI (10 U/μL × 2 μL = 20 U): 2 μL
10X Buffer G: 2 μL
Nuclease free water: 12 μL
Total: 20 μL

Incubation in thermal cycler:

Step	Temperature	Time
1	37°C	16 hours
2	66°C	20 minutes
3	4°C	Hold

PCR clean-up

PCR Clean-up Protocol (NucleoSpin® Gel and PCR Clean-up Kit)

Notes Before Starting

Suitable for PCR product clean-up, DNA concentration, and removal of salts/enzymes (SDS < 0.1%).
Ensure Wash Buffer NT3 is prepared (add 200 ul of ethanol to the bottle)
For removal of small fragments (e.g., primer dimers), diluted Buffer NTI may be used

Ligation of gRNA

Reaction mix:

T4 ligase enzyme: 1 ul
T4 ligase buffer: 2ul
Plasmid and inserts are taken in 1:6 ratio (calculated using NEB ligation calculator)
Water: volume required to make total reaction mix to 20 ul

Incubate overnight at 16°C

Old protocol for cloning gRNA

Digestion of pdCas9 plasmid with BsaI (aka Eco31I)

Reaction Mix:

dCas9 plasmid (218 ng/μL): 4 μL
BsaI (10U/μL x 2 μL = 20U): 2μL
10X Buffer G: 2μL
Nuclease free water: 12μL
Total volume: 20 μL

Incubation in thermal cycler:

Step	Temperature	Time
1	37°C	16 hours
2	66°C	20 minutes
3	4°C	Hold

Ligation

Reaction mix (1:600):

annealed oligos (10uM): 1 ul
linearized plasmid (32ng/μL): 3.1 ul
T4 ligase: 1ul
T4 ligase buffer(10X): 1 ul
Nuclease free water: 5 ul
Total volume: 10ul
Incubated overnight at 4°C

Colony PCR for Screening of Recombinant Plasmids

Make a 100uM suspension of the in-fusion oligo (obtained in lyophilized form) by adding 250μL TE buffer.
Suspend 12 colonies from the plate with transformed cells in 10μL nuclease free water each. (in LaFH)
Streak each of these suspensions on a Chlor plate to prepare the backup plate for the 12 colonies. (in LaFH). Incubated the plate at 37℃
Prepare Negative Control 1 with a colony suspension from the original dCas9 transformation plate

Use these cell suspensions for PCR. Reaction mix:

Cell suspension (template): 8 μL
Forward primer (100uM): 1 μL
Reverse primer (100uM): 1 μL
dNTPs mix: 1 μL
Taq Polymerase Buffer (10x): 2 μL
Nuclease free water: 6.5 μL
Taq Polymerase: 0.5 μL
Total: 20 μL

Prepare Negative Control 2 (without template) by replacing cell suspension with NF H2O.

Incubation in thermal cycler:

Number of cycles	Step	Temperature	Time
-	Denaturation	94°C	60 seconds
30 cycles	Annealing	52°C	30 seconds
30 cycles	Extension	72°C (1 min/kb)	25 seconds
-	Hold	4–10°C	∞

Polyacrylamide Gel Electrophoresis for Colony PCR

Make a native 8% polyacrylamide gel with the following composition:

Acrylamide(30 %): 2.6 mL
TBE(10X): 1 mL
H2O: 6.4 mL
APS(10%): 200 μL
TEMED: 10 μL

Allow the gel to solidify and loaded about 10 μL of samples + loading dye. Run the gel at 100V for an hour and stained the gel with SYBR-safe dye for 30 min. Visualise the gel under UV.

Golden Gate Assembly

Reaction mix:

Plasmid (dCas9 or dCas9-Dam): 100 ng (~15 fmol)
Annealed oligos (0.1uM): 1.5 μL (~150 fmol)
T4 DNA Ligase (1000 U/μL): 0.5 μL (500 U)
BsaI-Hfv2 (20 U/μL): 0.75 μL (15 U)
T4 Ligase Buffer (10x): 2 μL
NF H2O: volume to make total volume to 20 ul

The reaction mix has a 10:1 insert to vector ratio.

Add 1.5 μL of annealed oligos (0.1uM) to 3 PCR tubes. Add 1.5 μL NF H2O instead to the control mix.
Add 100 ng of plasmid (S2, S4 or dCas9) to the 3 PCR tubes. Added 100 ng dCas9 to the control mix.
Incubate all four PCR tubes at 37°C for 45 min followed by 10 min at 60°C.

Transformation with Golden Gate Mix

Transform four 200 μL aliquots of XL1 Blue cells with 6 μL of golden gate reaction mix by the heat shock method.

Culturing of Transformed Cells

Plate the transformed cells on four agar plates (S2, S4, pdCas9 and Control) supplemented with Chlor+Tet antibiotics. Incubate the plates at 37°C for 16 hours.

Cloning of dCas9-Linker-Dam Plasmid

Genomic DNA Extraction from Tissue or Cells (DNeasy Mini Kit, QIAGEN)

Final Notes:

Lysates should be viscous but not gelatinous to prevent column clogging.
Proceed to additional wash and elution steps as per kit manual.

PCR Amplification of Dam Gene from E. coli Genome

Suspension of Lyophilized Oligos

Suspend in buffer, vortex + heat at 56°C for 5 min → 100uM stocks.

Dilution of Primers and Template

Prepare 10uM working primers.
Dilute E. coli genomic DNA (180 ng/μL) tenfold.

PCR Reaction Mix:

GXL Buffer (5X): 10 μL
dNTP mix (2.5mM each): 4 μL
Oligo 3 (10uM): 1 μL
Oligo 4 (10uM): 1.5 μL
GXL Polymerase: 1 μL
Template (15 ng/μL): 0.5 μL
NF H2O: 32 μL
Total volume: 50 ul

Thermal Cycling:

Number of cycles	Step	Temperature	Time
-	Denaturation	94°C	2 minutes
30 cycles	Annealing	60°C	15 seconds
-	Extension	68°C(1 min/kb)	1 minute
-	Hold	4–10°C	∞

In-Fusion Cloning

Reaction mix:

In-fusion master mix (5x): 2 μL
Linearized pdCas9 (88 ng/μL): 2 μL
Dam insert (27 ng/μL): 1.2 μL
NF H2O: 4.8 μL
Total volume: 10 ul

Transformation of competent cells with reaction mix.

Touchdown PCR

Reaction mix:

10X Taq Buffer: 2 μL
Oligo 3 (13uM): 0.5 μL
Oligo 4 (11uM): 0.5 μL
Taq Polymerase: 0.5 μL
dNTP mix: 1 μL
Cell suspension: 2 μL
NF H2O: 13.5 μL
Total volume: 20 μL

Thermal Cycling:

Number of cycles	Step	Temperature	Time
-	Pre-denaturation	94°C	2 minutes
8 cycles	Denaturation	94°C	30 seconds
-	Annealing	70°C	30 seconds
-	Extension	72°C	1 minute
22 cycles	Denaturation	94°C	30 seconds
-	Annealing	62°C	30 seconds
-	Extension	72°C	1 minute
-	Final Extension	72°C	3 minutes
-	Hold	4°C	∞

Co-transformation (dnaAP2-gfp and dCas9 plasmids)

Co-transform XL1 Blue cells with 200 ng each of GFP + dCas9-Dam(S2).
Controls: GFP only, S2 only.
Plate on Ampicillin +Chloramphenicol (co-transfection) and appropriate control plates.
Incubate overnight at 37°C

dnaAP2-GFP Fluorescence Assays

For Dam(-) cells

Transformation of Dam(-) cells with GFP plasmid (NEB heat shock protocol).
Plate on Amp+Chlor (strain already Chlor resistant).
Negative control: untransformed Dam(-) plated similarly.

For wild-type Dam(+) cells

Use XL1 Blue.
Culture gfp-transformed and control cells in LB broth with appropriate antibiotics.
Incubate overnight at 37°C, 180 rpm.

Preparation of Samples for Microplate Assay

Wash cells twice with PBS buffer (removes LB autofluorescence).
Store pellets at 4°C.

Fluorescence and OD600 measurements:

200 μL in duplicates, at different dilutions.
Absorbance: 600 nm
Fluorescence: Ex 485 nm / Em 528 nm
Gains: 50 and 76 (100 saturated).
Normalize fluorescence intensity by OD600.

Materials and Methods

dnaAP2-GFP plasmid construction

The sequence of the dnaA operon and the gfp-Mut2 gene c, was kindly provided by Bianca Sclavi. Using these sequences, the dnaA operon was modified by deletion of the P1 promoter to reduce background expression and by mutation of the dnaA binding sites to eliminate their regulatory effect on P2 expression. NGG motifs were also introduced to increase potential guide RNA binding sites. The modified operon, linked to mut2gfp, was synthesized in a pET-blank backbone by Twist Bioscience.

dCas9–Dam plasmid construction

A dCas9–Dam fusion construct was generated using In-Fusion cloning (Takara Bio). A 15–amino acid Gly-Ser linker was designed to connect the dCas9 and Dam coding sequences, ensuring proper spacing and minimizing steric interference between the domains. The Dam coding sequence was inserted downstream of the dCas9 stop codon to maintain the integrity of the open reading frame and ensure full-length protein expression.

Genomic DNA was extracted from E. coli using the DNeasy Blood and Tissue Kit (Qiagen). The Dam gene was PCR-amplified with oligo 1 and 2, with oligo 2 containing linker sequences using PrimeSTAR GXL DNA Polymerase (Takara Bio). In parallel, the pdCas9 plasmid was linearized with oligo 3 and 4 and amplified with overlapping primers that included the linker sequence. PCR products were confirmed by electrophoresis on 0.7% agarose gels prepared in 1× TBE buffer.

For In-Fusion cloning, PCR primers introduced the required 20 bp overlaps. The reaction was assembled in a 10 μL volume with 2 μL of 5× In-Fusion Master Mix and a 2:1 molar ratio of insert to vector (200 ng total DNA). The mixture was incubated at 50°C for 15 min and then placed on ice. A 200 μL aliquot of XL1-Blue competent cells was transformed with 5 μL of the reaction mixture by heat shock and plated on chloramphenicol- and tetracycline-containing LB agar plates, followed by overnight incubation at 37°C.

Plasmid DNA from resulting colonies was isolated using the modified protocol with the MN Miniprep Kit (Macherey-Nagel). Recombinant clones were identified by PCR screening and agarose gel electrophoresis (1%). Positive constructs were then confirmed by Sanger sequencing.

Co-transformation experiments

One aliquot of XL1 Blue cells was cotransformed with 200ng each of DNA2P-GFP plasmid carrying ampicillin resistance and 200ng of the dCas9 Dam plasmid containing chloramphenicol resistance using the heat shock method, and plated it on a chloramphenicol+ampicillin LB agar plate.

For controls, individual aliquots were transformed with either dnaAp2-GFP or dCas9-Dam and plated on ampicillin+tetracycline and chloramphenicol+tetracycline plates, respectively. Negative controls consisted of transforming the cells with each plasmid but plating them on non-selective antibiotic combinations (chloramphenicol+tetracycline for dnaAp2-GFP, ampicillin+tetracycline for dCas9-Dam). All plates were incubated for 16 h at 37°C, yielding colony counts consistent with typical heat-shock transformation efficiencies.

To confirm successful co-transformation, plasmids were isolated from the co-transformants using the same kit and protocol as mentioned before and digested with BsaI(both plasmids contain BsaI sites). The digestion reaction was conducted in 10 uL total volume with 1uL of 10X Cutsmart buffer, 200ng of plasmid and 4 units of the BsaI. The mixture was incubated for 30mins at 37°C and run on 1% agarose gel at 100V for 1 hour with 120ng DNA in each well. Observed bands verified the presence of both the plasmids thus confirming successful co-transformation.

gRNA cloning

Plasmid digestion was carried out using BsaI in a 20 µL reaction containing 600 ng/µL plasmid DNA, 1 µL BsaI, and 2 µL 10X CutSmart buffer. The reaction mixture was incubated at 37°C for 2 h and subsequently purified using a PCR cleanup kit (Macherey-Nagel). The concentrations of the insert and plasmid backbone were measured, and a 1:6 plasmid-to-insert ratio was used for ligation. Ligation was performed in a 20 µL reaction containing 1 µL ligase enzyme, 2 µL ligase buffer, 1ug of plasmid and corresponding amount of insert calculated using the NEB ligation calculator. The ligation mixture was incubated overnight at 16°C and then stored at 4°C.

GFP readings

Two aliquots of liquid culture of XL1-Blue cells containing the GFP plasmid were prepared in ampicillin + chloramphenicol-supplemented medium. An additional liquid culture of untransformed XL1-Blue cells was also prepared. All cultures were incubated overnight at 37°C and 180 rpm. One millilitre of each culture was pelleted, washed twice with PBS buffer, and finally resuspended in PBS

Sequences

Reporter Plasmid

🔍

dnaA operon linked to mut2-gfp (Credits: Bianca Sclavi)

For our experiment we modified the dnaA operon

🔍

pdCas9 Plasmid

(dead Cas9 with minimal CRISPR Array, tracr RNA and CamR)

🔍

Sequence

accaaaacatagtttgctttatgagtattttacggtttataacgaattga caaaggtcaaatatgttactgaaggaatgcgaaaaccagcatttctttca ggtgaacagaagaaagccattgttgatttactcttcaaaacaaatcgaaa agtaaccgttaagcaattaaaagaagattatttcaaaaaaatagaatgtt ttgatagtgttgaaatttcaggagttgaagatagatttaatgcttcatta ggtacctaccatgatttgctaaaaattattaaagataaagattttttgga taatgaagaaaatgaagatatcttagaggatattgttttaacattgacct tatttgaagatagggagatgattgaggaaagacttaaaacatatgctcac ctctttgatgataaggtgatgaaacagcttaaacgtcgccgttatactgg ttggggacgtttgtctcgaaaattgattaatggtattagggataagcaat ctggcaaaacaatattagattttttgaaatcagatggttttgccaatcgc aattttatgcagctgatccatgatgatagtttgacatttaaagaagacat tcaaaaagcacaagtgtctggacaaggcgatagtttacatgaacatattg caaatttagctggtagccctgctattaaaaaaggtattttacagactgta aaagttgttgatgaattggtcaaagtaatggggcggcataagccagaaaa tatcgttattgaaatggcacgtgaaaatcagacaactcaaaagggccaga aaaattcgcgagagcgtatgaaacgaatcgaagaaggtatcaaagaatta ggaagtcagattcttaaagagcatcctgttgaaaatactcaattgcaaaa tgaaaagctctatctctattatctccaaaatggaagagacatgtatgtgg accaagaattagatattaatcgtttaagtgattatgatgtcgatgccatt gttccacaaagtttccttaaagacgattcaatagacaataaggtcttaac gcgttctgataaaaatcgtggtaaatcggataacgttccaagtgaagaag tagtcaaaaagatgaaaaactattggagacaacttctaaacgccaagtta atcactcaacgtaagtttgataatttaacgaaagctgaacgtggaggttt gagtgaacttgataaagctggttttatcaaacgccaattggttgaaactc gccaaatcactaagcatgtggcacaaattttggatagtcgcatgaatact aaatacgatgaaaatgataaacttattcgagaggttaaagtgattacctt aaaatctaaattagtttctgacttccgaaaagatttccaattctataaag tacgtgagattaacaattaccatcatgcccatgatgcgtatctaaatgcc gtcgttggaactgctttgattaagaaatatccaaaacttgaatcggagtt tgtctatggtgattataaagtttatgatgttcgtaaaatgattgctaagt ctgagcaagaaataggcaaagcaaccgcaaaatatttcttttactctaat atcatgaacttcttcaaaacagaaattacacttgcaaatggagagattcg caaacgccctctaatcgaaactaatggggaaactggagaaattgtctggg ataaagggcgagattttgccacagtgcgcaaagtattgtccatgccccaa gtcaatattgtcaagaaaacagaagtacagacaggcggattctccaagga gtcaattttaccaaaaagaaattcggacaagcttattgctcgtaaaaaag actgggatccaaaaaaatatggtggttttgatagtccaacggtagcttat tcagtcctagtggttgctaaggtggaaaaagggaaatcgaagaagttaaa atccgttaaagagttactagggatcacaattatggaaagaagttcctttg aaaaaaatccgattgactttttagaagctaaaggatataaggaagttaaa aaagacttaatcattaaactacctaaatatagtctttttgagttagaaaa cggtcgtaaacggatgctggctagtgccggagaattacaaaaaggaaatg agctggctctgccaagcaaatatgtgaattttttatatttagctagtcat tatgaaaagttgaagggtagtccagaagataacgaacaaaaacaattgtt tgtggagcagcataagcattatttagatgagattattgagcaaatcagtg aattttctaagcgtgttattttagcagatgccaatttagataaagttctt agtgcatataacaaacatagagacaaaccaatacgtgaacaagcagaaaa tattattcatttatttacgttgacgaatcttggagctcccgctgctttta aatattttgatacaacaattgatcgtaaacgatatacgtctacaaaagaa gttttagatgccactcttatccatcaatccatcactggtctttatgaaac acgcattgatttgagtcagctaggaggtgactgaagtatattttagatga agattatttcttaataactaaaaatatggtataatactcttaataaatgc agtaatacaggggcttttcaagactgaagtctagctgagacaaatagtgc gattacgaaattttttagacaaaaatagtctacgaggttttagagctatg ctgttttgaatggtcccaaaactgagaccagtctcggaagctcaaaggtc tcgttttagagctatgctgttttgaatggtcccaaaacttcagcacactg agacttgttgagttccatgttttagagctatgctgttttgaatggactcc attcaacattgccgatgataacttgagaaagagggttaataccagcagtc ggataccttcctattctttctgttaaagcgttttcatgttataataggca aaagaagagtagtgtgatcgtccattccgacagcatcgccagtcactatg gcgtgctgctagcgctatatgcgttgatgcaatttctatgcgcacccgtt ctcggagcactgtccgaccgctttggccgccgcccagtcctgctcgcttc gctacttggagccactatcgactacgcgatcatggcgaccacacccgtcc tgtggatcctctacgccggacgcatcgtggccggcatcaccggcgccaca ggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcg ggctcgccacttcgggctcatgagcgcttgtttcggcgtgggtatggtgg caggccccgtggccgggggactgttgggcgccatctccttgcatgcacca ttccttgcggcggcggtgctcaacggcctcaacctactactgggctgctt cctaatgcaggagtcgcataagggagagcgtcgaccgatgcccttgagag ccttcaacccagtcagctccttccggtgggcgcggggcatgactatcgtc gccgcacttatgactgtcttctttatcatgcaactcgtaggacaggtgcc ggcagcgctctgggtcattttcggcgaggaccgctttcgctggagcgcga cgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgct caagccttcgtcactggtcccgccaccaaacgtttcggcgagaagcaggc cattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcgt tcgcgacgcgaggctggatggccttccccattatgattcttctcgcttcc ggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcaggtaga tgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagcc taacttcgatcattggaccgctgatcgtcacggcgatttatgccgcctcg gcgagcacatggaacgggttggcatggattgtaggcgccgccctatacct tgtctgcctccccgcgttgcgtcgcggtgcatggagccgggccacctcga cctgaatggaagccggcggcacctcgctaacggattcaccactccaagaa ttggagccaatcaattcttgcggagaactgtgaatgcgcaaaccaaccct tggcagaacatatccatcgcgtccgccatctccagcagccgcacgcggcg catctcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgctcc tgtcgttgaggacccggctaggctggcggggttgccttactggttagcag aatgaatcaccgatacgcgagcgaacgtgaagcgactgctgctgcaaaac gtctgcgacctgagcaacaacatgaatggtcttcggtttccgtgtttcgt aaagtctggaaacgcggaagtcccctacgtgctgctgaagttgcccgcaa cagagagtggaaccaaccggtgataccacgatactatgactgagagtcaa cgccatgagcggcctcatttcttattctgagttacaacagtccgcaccgc tgccggtagctccttccggtgggcgcggggcatgactatcgtcgccgcac ttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcg cccaacagtcccccggccacggggcctgccaccatacccacgccgaaaca agcgccctgcaccattatgttccggatctgcatcgcaggatgctgctggc taccctgtggaacacctacatctgtattaacgaagcgctaaccgttttta tcaggctctgggaggcagaataaatgatcatatcgtcaattattacctcc acggggagagcctgagcaaactggcctcaggcatttgagaagcacacggt cacactgcttccggtagtcaataaaccggtaaaccagcaatagacataag cggctatttaacgaccctgccctgaaccgacgaccgggtcgaatttgctt tcgaatttctgccattcatccgcttattatcacttattcaggcgtagcaa ccaggcgtttaagggcaccaataactgccttaaaaaaattacgccccgcc ctgccactcatcgcagtactgttgtaattcattaagcattctgccgacat ggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagc accttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaa gaagttgtccatattggccacgtttaaatcaaaactggtgaaactcaccc agggattggctgagacgaaaaacatattctcaataaaccctttagggaaa taggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtag aaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgttt cagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatc accagctcaccgtctttcattgccatacggaattccggatgagcattcat caggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttt tctttacggtctttaaaaaggccgtaatatccagctgaacggtctggtta taggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatg ccattgggatatatcaacggtggtatatccagtgatttttttctccattt tagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggt agtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatc aacgtctcattttcgccaaaagttggcccggggcttcccggtatcaacag ggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatt tattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtg tatgatggtgtttttgaggtgctccagtggcttctgtttctatcagctgt ccctcctgttcagctactgacggggtggtgcgtaacggcaaaagcaccgc cggacatcagcgctagcggagtgtatactggcttactatgttggcactga tgagggtgtcagtgaagtgcttcatgtggcaggagaaaaaaggctgcacc ggtgcgtcagcagaatatgtgatacaggatatattccgcttcctcgctca ctgactcgctacgctcggtcgttcgactgcggcgagcggaaatggcttac gaacggggcggagatttcctggaagatgccaggaagatacttaacaggga agtgagagggccgcggcaaagccgtttttccataggctccgcccccctga caagcatcacgaaatctgacgctcaaatcagtggtggcgaaacccgacag gactataaagataccaggcgtttccccctggcggctccctcgtgcgctct cctgttcctgcctttcggtttaccggtgtcattccgctgttatggccgcg tttgtctcattccacgcctgacactcagttccgggtaggcagttcgctcc aagctggactgtatgcacgaaccccccgttcagtccgaccgctgcgcctt atccggtaactatcgtcttgagtccaacccggaaagacatgcaaaagcac cactggcagcagccactggtaattgatttagaggagttagtcttgaagtc atgcgccggttaaggctaaactgaaaggacaagttttggtgactgcgctc ctccaagccagttacctcggttcaaagagttggtagctcagagaaccttc gaaaaaccgccctgcaaggcggttttttcgttttcagagcaagagattac gcgcagaccaaaacgatctcaagaagatcatcttattaatcagataaaat atttctagatttcagtgcaatttatctcttcaaatgtagcacctgaagtc agccccatacgatataagttgtaattctaatgtttgacagcttatcatcg ataagctttaatgcggtagtttatcacagttaaattgctaacgcagtcag gcaccgtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgt caccctggatgctgtaggcataggcttggttatgccggtactgccgggcc tcttgcgggattacgaaatcatcctgtggagcttagtaggtttagcaaga tggcagcgcctaaatgtagaatgataaaaggattaagagattaatttccc taaaaatgataaaacaagcgttttgaaagcgcttgtttttttggtttgca gtcagagtagaatagaagtatcaaaaaaagcaccgactcggtgccacttt ttcaagttgataacggactagccttattttaacttgctatgctgttttga atggttccaacaagattattttataacttttataacaaataatcaaggag aaattcaaagaaatttatcagccataaaacaatacttaatactatagaat gataacaaaataaactactttttaaaagaattttgtgttataatctattt attattaagtattgggtaatattttttgaagagatattttgaaaaagaaa aattaaagcatattaaactaatttcggaggtcattaaaactattattgaa atcatcaaactcattatggatttaatttaaactttttattttaggaggca aaaatggataagaaatactcaataggcttagctatcggcacaaatagcgt cggatgggcggtgatcactgatgaatataaggttccgtctaaaaagttca aggttctgggaaatacagaccgccacagtatcaaaaaaaatcttataggg gctcttttatttgacagtggagagacagcggaagcgactcgtctcaaacg gacagctcgtagaaggtatacacgtcggaagaatcgtatttgttatctac aggagattttttcaaatgagatggcgaaagtagatgatagtttctttcat cgacttgaagagtcttttttggtggaagaagacaagaagcatgaacgtca tcctatttttggaaatatagtagatgaagttgcttatcatgagaaatatc caactatctatcatctgcgaaaaaaattggtagattctactgataaagcg gatttgcgcttaatctatttggccttagcgcatatgattaagtttcgtgg tcattttttgattgagggagatttaaatcctgataatagtgatgtggaca aactatttatccagttggtacaaacctacaatcaattatttgaagaaaac cctattaacgcaagtggagtagatgctaaagcgattctttctgcacgatt gagtaaatcaagacgattagaaaatctcattgctcagctccccggtgaga agaaaaatggcttatttgggaatctcattgctttgtcattgggtttgacc cctaattttaaatcaaattttgatttggcagaagatgctaaattacagct ttcaaaagatacttacgatgatgatttagataatttattggcgcaaattg gagatcaatatgctgatttgtttttggcagctaagaatttatcagatgct attttactttcagatatcctaagagtaaatactgaaataactaaggctcc cctatcagcttcaatgattaaacgctacgatgaacatcatcaagacttga ctcttttaaaagctttagttcgacaacaacttccagaaaagtataaagaa atcttttttgatcaatcaaaaaacggatatgcaggttatattgatggggg agctagccaagaagaattttataaatttatcaaaccaattttagaaaaaa tggatggtactgaggaattattggtgaaactaaatcgtgaagatttgctg cgcaagcaacggacctttgacaacggctctattccccatcaaattcactt gggtgagctgcatgctattttgagaagacaagaagacttttatccatttt taaaagacaatcgtgagaagattgaaaaaatcttgacttttcgaattcct tattatgttggtccattggcgcgtggcaatagtcgttttgcatggatgac tcggaagtctgaagaaacaattaccccatggaattttgaagaagttgtcg ataaaggtgcttcagctcaatcatttattgaacgcatgacaaactttgat aaaaatcttccaaatgaaaaagtact

dCas9-linker-Dam with gRNA Plasmid

Constructed by inserting gly-ser linker and Dam sequence downstream of dCas9 using in-fusion cloning. gRNA inserted by golden gate assembly.

🔍

Sequence

accaaaacatagtttgctttatgagtattttacggtttataacgaattgacaaaggtcaaatatgttactgaaggaatgcgaaaaccagcatttctttcaggtgaacagaagaaagccattgttgatttactcttcaaaacaaatcgaaaagtaaccgttaagcaattaaaagaagattatttcaaaaaaatagaatgttttgatagtgttgaaatttcaggagttgaagatagatttaatgcttcattaggtacctaccatgatttgctaaaaattattaaagataaagattttttggataatgaagaaaatgaagatatcttagaggatattgttttaacattgaccttatttgaagatagggagatgattgaggaaagacttaaaacatatgctcacctctttgatgataaggtgatgaaacagcttaaacgtcgccgttatactggttggggacgtttgtctcgaaaattgattaatggtattagggataagcaatctggcaaaacaatattagattttttgaaatcagatggttttgccaatcgcaattttatgcagctgatccatgatgatagtttgacatttaaagaagacattcaaaaagcacaagtgtctggacaaggcgatagtttacatgaacatattgcaaatttagctggtagccctgctattaaaaaaggtattttacagactgtaaaagttgttgatgaattggtcaaagtaatggggcggcataagccagaaaatatcgttattgaaatggcacgtgaaaatcagacaactcaaaagggccagaaaaattcgcgagagcgtatgaaacgaatcgaagaaggtatcaaagaattaggaagtcagattcttaaagagcatcctgttgaaaatactcaattgcaaaatgaaaagctctatctctattatctccaaaatggaagagacatgtatgtggaccaagaattagatattaatcgtttaagtgattatgatgtcgatgccattgttccacaaagtttccttaaagacgattcaatagacaataaggtcttaacgcgttctgataaaaatcgtggtaaatcggataacgttccaagtgaagaagtagtcaaaaagatgaaaaactattggagacaacttctaaacgccaagttaatcactcaacgtaagtttgataatttaacgaaagctgaacgtggaggtttgagtgaacttgataaagctggttttatcaaacgccaattggttgaaactcgccaaatcactaagcatgtggcacaaattttggatagtcgcatgaatactaaatacgatgaaaatgataaacttattcgagaggttaaagtgattaccttaaaatctaaattagtttctgacttccgaaaagatttccaattctataaagtacgtgagattaacaattaccatcatgcccatgatgcgtatctaaatgccgtcgttggaactgctttgattaagaaatatccaaaacttgaatcggagtttgtctatggtgattataaagtttatgatgttcgtaaaatgattgctaagtctgagcaagaaataggcaaagcaaccgcaaaatatttcttttactctaatatcatgaacttcttcaaaacagaaattacacttgcaaatggagagattcgcaaacgccctctaatcgaaactaatggggaaactggagaaattgtctgggataaagggcgagattttgccacagtgcgcaaagtattgtccatgccccaagtcaatattgtcaagaaaacagaagtacagacaggcggattctccaaggagtcaattttaccaaaaagaaattcggacaagcttattgctcgtaaaaaagactgggatccaaaaaaatatggtggttttgatagtccaacggtagcttattcagtcctagtggttgctaaggtggaaaaagggaaatcgaagaagttaaaatccgttaaagagttactagggatcacaattatggaaagaagttcctttgaaaaaaatccgattgactttttagaagctaaaggatataaggaagttaaaaaagacttaatcattaaactacctaaatatagtctttttgagttagaaaacggtcgtaaacggatgctggctagtgccggagaattacaaaaaggaaatgagctggctctgccaagcaaatatgtgaattttttatatttagctagtcattatgaaaagttgaagggtagtccagaagataacgaacaaaaacaattgtttgtggagcagcataagcattatttagatgagattattgagcaaatcagtgaattttctaagcgtgttattttagcagatgccaatttagataaagttcttagtgcatataacaaacatagagacaaaccaatacgtgaacaagcagaaaatattattcatttatttacgttgacgaatcttggagctcccgctgcttttaaatattttgatacaacaattgatcgtaaacgatatacgtctacaaaagaagttttagatgccactcttatccatcaatccatcactggtctttatgaaacacgcattgatttgagtcagctaggaggtgacggcggtagcagccgtagtagcagcagtggtggtggtggtagtggtggcggtggcatgaagaaaaatcgcgcttttttgaagtgggcagggggcaagtatcccctgcttgatgatattaaacggcatttgcccaagggcgaatgtctggttgagccttttgtaggtgccgggtcggtgtttctcaacaccgacttttctcgttatatccttgccgatatcaatagcgacctgatcagtctctataacattgtgaagatgcgtactgatgagtacgtacaggccgcacgcgagctgtttgttcccgaaacaaattgcgccgaggtttactatcagttccgcgaagagttcaacaaaagccaggatccgttccgtcgggcggtactgtttttatatttgaaccgctacggttacaacggcctgtgtcgttacaatctgcgcggtgagtttaacgtgccgttcggccgctacaaaaaaccctatttcccggaagcagagttgtatcacttcgctgaaaaagcgcagaatgcctttttctattgtgagtcttacgccgatagcatggcgcgcgcagatgatgcatccgtcgtctattgcgatccgccttatgcaccgctgtctgcgaccgccaactttacggcgtatcacacaaacagttttacgcttgaacaacaagcgcatctggcggagatcgccgaaggtctggttgagcgccatattccagtgctgatctccaatcacgatacgatgttaacgcgtgagtggtatcagcgcgcaaaattgcatgtcgtcaaagttcgacgcagtataagcagcaacggcggcacacgtaaaaaggtggacgaactgctggctttgtacaaaccaggagtcgtttcacccgcgaaaaaataatgaagtatattttagatgaagattatttcttaataactaaaaatatggtataatactcttaataaatgcagtaatacaggggcttttcaagactgaagtctagctgagacaaatagtgcgattacgaaattttttagacaaaaatagtctacgaggttttagagctatgctgttttgaatggtcccaaaactgagaccagtctcggaagctcaaaggtctcgttttagagctatgctgttttgaatggtcccaaaacttcagcacactgagacttgttgagttccatgttttagagctatgctgttttgaatggactccattcaacattgccgatgataacttgagaaagagggttaataccagcagtcggataccttcctattctttctgttaaagcgttttcatgttataataggcaaaagaagagtagtgtgatcgtccattccgacagcatcgccagtcactatggcgtgctgctagcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttggccgccgcccagtcctgctcgcttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgtggatcctctacgccggacgcatcgtggccggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcgggctcgccacttcgggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggcgccatctccttgcatgcaccattccttgcggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagagcgtcgaccgatgcccttgagagccttcaacccagtcagctccttccggtgggcgcggggcatgactatcgtcgccgcacttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgctctgggtcattttcggcgaggaccgctttcgctggagcgcgacgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgctcaagccttcgtcactggtcccgccaccaaacgtttcggcgagaagcaggccattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcgttcgcgacgcgaggctggatggccttccccattatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcaggtagatgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagcctaacttcgatcattggaccgctgatcgtcacggcgatttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgccgccctataccttgtctgcctccccgcgttgcgtcgcggtgcatggagccgggccacctcgacctgaatggaagccggcggcacctcgctaacggattcaccactccaagaattggagccaatcaattcttgcggagaactgtgaatgcgcaaaccaacccttggcagaacatatccatcgcgtccgccatctccagcagccgcacgcggcgcatctcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttgaggacccggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtgaagcgactgctgctgcaaaacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtgtttcgtaaagtctggaaacgcggaagtcccctacgtgctgctgaagttgcccgcaacagagagtggaaccaaccggtgataccacgatactatgactgagagtcaacgccatgagcggcctcatttcttattctgagttacaacagtccgcaccgctgccggtagctccttccggtgggcgcggggcatgactatcgtcgccgcacttatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgccctgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctgtggaacacctacatctgtattaacgaagcgctaaccgtttttatcaggctctgggaggcagaataaatgatcatatcgtcaattattacctccacggggagagcctgagcaaactggcctcaggcatttgagaagcacacggtcacactgcttccggtagtcaataaaccggtaaaccagcaatagacataagcggctatttaacgaccctgccctgaaccgacgaccgggtcgaatttgctttcgaatttctgccattcatccgcttattatcacttattcaggcgtagcaaccaggcgtttaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccggggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagctgtccctcctgttcagctactgacggggtggtgcgtaacggcaaaagcaccgccggacatcagcgctagcggagtgtatactggcttactatgttggcactgatgagggtgtcagtgaagtgcttcatgtggcaggagaaaaaaggctgcaccggtgcgtcagcagaatatgtgatacaggatatattccgcttcctcgctcactgactcgctacgctcggtcgttcgactgcggcgagcggaaatggcttacgaacggggcggagatttcctggaagatgccaggaagatacttaacagggaagtgagagggccgcggcaaagccgtttttccataggctccgcccccctgacaagcatcacgaaatctgacgctcaaatcagtggtggcgaaacccgacaggactataaagataccaggcgtttccccctggcggctccctcgtgcgctctcctgttcctgcctttcggtttaccggtgtcattccgctgttatggccgcgtttgtctcattccacgcctgacactcagttccgggtaggcagttcgctccaagctggactgtatgcacgaaccccccgttcagtccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggaaagacatgcaaaagcaccactggcagcagccactggtaattgatttagaggagttagtcttgaagtcatgcgccggttaaggctaaactgaaaggacaagttttggtgactgcgctcctccaagccagttacctcggttcaaagagttggtagctcagagaaccttcgaaaaaccgccctgcaaggcggttttttcgttttcagagcaagagattacgcgcagaccaaaacgatctcaagaagatcatcttattaatcagataaaatatttctagatttcagtgcaatttatctcttcaaatgtagcacctgaagtcagccccatacgatataagttgtaattctaatgtttgacagcttatcatcgataagctttaatgcggtagtttatcacagttaaattgctaacgcagtcaggcaccgtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcataggcttggttatgccggtactgccgggcctcttgcgggattacgaaatcatcctgtggagcttagtaggtttagcaagatggcagcgcctaaatgtagaatgataaaaggattaagagattaatttccctaaaaatgataaaacaagcgttttgaaagcgcttgtttttttggtttgcagtcagagtagaatagaagtatcaaaaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatgctgttttgaatggttccaacaagattattttataacttttataacaaataatcaaggagaaattcaaagaaatttatcagccataaaacaatacttaatactatagaatgataacaaaataaactactttttaaaagaattttgtgttataatctatttattattaagtattgggtaatattttttgaagagatattttgaaaaagaaaaattaaagcatattaaactaatttcggaggtcattaaaactattattgaaatcatcaaactcattatggatttaatttaaactttttattttaggaggcaaaaatggataagaaatactcaataggcttagctatcggcacaaatagcgtcggatgggcggtgatcactgatgaatataaggttccgtctaaaaagttcaaggttctgggaaatacagaccgccacagtatcaaaaaaaatcttataggggctcttttatttgacagtggagagacagcggaagcgactcgtctcaaacggacagctcgtagaaggtatacacgtcggaagaatcgtatttgttatctacaggagattttttcaaatgagatggcgaaagtagatgatagtttctttcatcgacttgaagagtcttttttggtggaagaagacaagaagcatgaacgtcatcctatttttggaaatatagtagatgaagttgcttatcatgagaaatatccaactatctatcatctgcgaaaaaaattggtagattctactgataaagcggatttgcgcttaatctatttggccttagcgcatatgattaagtttcgtggtcattttttgattgagggagatttaaatcctgataatagtgatgtggacaaactatttatccagttggtacaaacctacaatcaattatttgaagaaaaccctattaacgcaagtggagtagatgctaaagcgattctttctgcacgattgagtaaatcaagacgattagaaaatctcattgctcagctccccggtgagaagaaaaatggcttatttgggaatctcattgctttgtcattgggtttgacccctaattttaaatcaaattttgatttggcagaagatgctaaattacagctttcaaaagatacttacgatgatgatttagataatttattggcgcaaattggagatcaatatgctgatttgtttttggcagctaagaatttatcagatgctattttactttcagatatcctaagagtaaatactgaaataactaaggctcccctatcagcttcaatgattaaacgctacgatgaacatcatcaagacttgactcttttaaaagctttagttcgacaacaacttccagaaaagtataaagaaatcttttttgatcaatcaaaaaacggatatgcaggttatattgatgggggagctagccaagaagaattttataaatttatcaaaccaattttagaaaaaatggatggtactgaggaattattggtgaaactaaatcgtgaagatttgctgcgcaagcaacggacctttgacaacggctctattccccatcaaattcacttgggtgagctgcatgctattttgagaagacaagaagacttttatccatttttaaaagacaatcgtgagaagattgaaaaaatcttgacttttcgaattccttattatgttggtccattggcgcgtggcaatagtcgttttgcatggatgactcggaagtctgaagaaacaattaccccatggaattttgaagaagttgtcgataaaggtgcttcagctcaatcatttattgaacgcatgacaaactttgataaaaatcttccaaatgaaaaagtact

Glycine-Serine Linker Sequence

Oligos for guide RNA target sequence (spacer) cloning

The guide RNA targets the GATC sites in the dnaAP2 promoter region on the reporter plasmid
Spacer sequence was cloned into the CRISPR Array by annealing the following oligos followed by golden gate assembly using BsaI enzyme

Primers for In-fusion Cloning of Linker-Dam in pdCas9

Primers for colony PCR (screening for spacer cloning)

DNMT3A with tet-on promoter

🔍

References

References and Citations

Braun, R. E., O'Day, K., & Wright, A. (1985). Autoregulation of the DNA replication gene dnaA in E. coli K-12. Cell, 40(1), 159–169. https://doi.org/10.1016/0092-8674(85)90319-8
Iuliani, I., et al. (2024). Direct single-cell observation of a key Escherichia coli cell-cycle oscillator. Science Advances, 10, eado5398. https://doi.org/10.1126/sciadv.ado5398
Braun, R. E., & Wright, A. (1986). DNA methylation differentially enhances the expression of one of the two E. coli dnaA promoters in vivo and in vitro. Molecular and General Genetics, 202(2), 246–250. https://doi.org/10.1007/BF00331644
Westphal, L. L., Sauvey, P., Champion, M. M., Ehrenreich, I. M., & Finkel, S. E. (2016). Genomewide Dam methylation in Escherichia coli during long-term stationary phase. mSystems, 1(6), e00130-16. https://doi.org/10.1128/mSystems.00130-16
Hermann, A., & Jeltsch, A. (2003). Methylation sensitivity of restriction enzymes interacting with GATC sites. Biotechniques, 34(5), 924–930. https://doi.org/10.2144/03345bm05
Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., & Zhang, F. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science, 339(6121), 819–823. https://doi.org/10.1126/science.1231143
Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F., & Marraffini, L. A. (2013). Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Nucleic Acids Research, 41(15), 7429–7437. https://doi.org/10.1093/nar/gkt520
Xiong, T., Rohm, D., Workman, R. E., Roundtree, L., Novina, C. D., Timp, W., & Ostermeier, M. (2018). Protein engineering strategies for improving the selective methylation of target CpG sites by a dCas9-directed cytosine methyltransferase in bacteria. PLoS ONE, 13(12), e0209408. https://doi.org/10.1371/journal.pone.0209408
Raja, P., Wolf, J. N., & Bisaro, D. M. (n.d.). RNA silencing directed against geminiviruses: Post-transcriptional and epigenetic components. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms.
Bae, S. H., Sim, M. S., et al. (2024). Intracellular flux prediction of recombinant Escherichia coli producing gamma-aminobutyric acid. Journal of Microbiology and Biotechnology.
Maier, J. A. H., et al. (2017). Design of synthetic epigenetic circuits featuring memory effects and reversible switching based on DNA methylation. Nature Communications, 8, Article 1535. https://doi.org/10.1038/s41467-017-01652-2

Protocols​

Isolation and Purification of pdCas9 Plasmid and dnaAP2-GFP Plasmid​

Plasmid Isolation using Macherey-Nagel NucleoSpin Plasmid DNA Purification Kit for Low Copy Plasmids​

Notes Before Starting​

Final Notes​

Gel Electrophoresis for Confirmation of Plasmid​

Protocol:​

Cloning of gRNA Target Sequence into the dCas9 Plasmid​

Annealing of Oligonucleotides to Make dsDNA​

Digestion of pdCas9 Plasmid with BsaI (Eco31I)​

PCR clean-up​

PCR Clean-up Protocol (NucleoSpin® Gel and PCR Clean-up Kit)​

Ligation of gRNA​

Old protocol for cloning gRNA​

Digestion of pdCas9 plasmid with BsaI (aka Eco31I)​

Ligation​

Colony PCR for Screening of Recombinant Plasmids​

Polyacrylamide Gel Electrophoresis for Colony PCR​

Golden Gate Assembly​

Transformation with Golden Gate Mix​

Culturing of Transformed Cells​

Cloning of dCas9-Linker-Dam Plasmid​

Genomic DNA Extraction from Tissue or Cells (DNeasy Mini Kit, QIAGEN)​

Final Notes:​

PCR Amplification of Dam Gene from E. coli Genome​

Suspension of Lyophilized Oligos​

Dilution of Primers and Template​

In-Fusion Cloning​

Touchdown PCR​

Co-transformation (dnaAP2-gfp and dCas9 plasmids)​

dnaAP2-GFP Fluorescence Assays​

For Dam(-) cells​

For wild-type Dam(+) cells​

Preparation of Samples for Microplate Assay​

Materials and Methods​

dnaAP2-GFP plasmid construction​

dCas9–Dam plasmid construction​

Co-transformation experiments​

gRNA cloning​

GFP readings​

Sequences​

Reporter Plasmid​

dnaA operon linked to mut2-gfp (Credits: Bianca Sclavi)​

pdCas9 Plasmid​

dCas9-linker-Dam with gRNA Plasmid​

Glycine-Serine Linker Sequence​

Oligos for guide RNA target sequence (spacer) cloning​

Primers for In-fusion Cloning of Linker-Dam in pdCas9​

Primers for colony PCR (screening for spacer cloning)​

Primers for sequencing constructed plasmid:​

DNMT3A with tet-on promoter​

References​

Protocols

Isolation and Purification of pdCas9 Plasmid and dnaAP2-GFP Plasmid

Plasmid Isolation using Macherey-Nagel NucleoSpin Plasmid DNA Purification Kit for Low Copy Plasmids

Notes Before Starting

Final Notes

Gel Electrophoresis for Confirmation of Plasmid

Protocol:

Cloning of gRNA Target Sequence into the dCas9 Plasmid

Annealing of Oligonucleotides to Make dsDNA

Digestion of pdCas9 Plasmid with BsaI (Eco31I)

PCR clean-up

PCR Clean-up Protocol (NucleoSpin® Gel and PCR Clean-up Kit)

Ligation of gRNA

Old protocol for cloning gRNA

Digestion of pdCas9 plasmid with BsaI (aka Eco31I)

Ligation

Colony PCR for Screening of Recombinant Plasmids

Polyacrylamide Gel Electrophoresis for Colony PCR

Golden Gate Assembly

Transformation with Golden Gate Mix

Culturing of Transformed Cells

Cloning of dCas9-Linker-Dam Plasmid

Genomic DNA Extraction from Tissue or Cells (DNeasy Mini Kit, QIAGEN)

Final Notes:

PCR Amplification of Dam Gene from E. coli Genome

Suspension of Lyophilized Oligos

Dilution of Primers and Template

In-Fusion Cloning

Touchdown PCR

Co-transformation (dnaAP2-gfp and dCas9 plasmids)

dnaAP2-GFP Fluorescence Assays

For Dam(-) cells

For wild-type Dam(+) cells

Preparation of Samples for Microplate Assay

Materials and Methods

dnaAP2-GFP plasmid construction

dCas9–Dam plasmid construction

Co-transformation experiments

gRNA cloning

GFP readings

Sequences

Reporter Plasmid

dnaA operon linked to mut2-gfp (Credits: Bianca Sclavi)

pdCas9 Plasmid

dCas9-linker-Dam with gRNA Plasmid

Glycine-Serine Linker Sequence

Oligos for guide RNA target sequence (spacer) cloning

Primers for In-fusion Cloning of Linker-Dam in pdCas9

Primers for colony PCR (screening for spacer cloning)

Primers for sequencing constructed plasmid:

DNMT3A with tet-on promoter

References