micrON hsa-miR-455-3p mimic

Target sequence: GCAGUCCAUGGGCAUAUACAC

miR-455-3p overexpression significantly suppressed pro-fibrotic markers, reduced the proliferation and facilitated apoptosis of activated LX-2 cells.

micrON hsa-miR-148a-5p mimic

Target sequence: AAAGUUCUGAGACACUCCGACU

miR-148a-5p up-regulation could significantly inhibit the expression of hepatic fibrosis markers, α-SMA and Col1α1 in activated LX-2 cells. [2]

Exosomes are cell-derived nanovesicles that mediate intercellular communication. Exogenous substances, such as microRNAs or small-molecule drugs, can be incorporated into exosomes and then delivered to specific types of cells or tissues to realize targeted therapy. [3]

[1] You H, Wang L, Bu F, et al. The miR-455-3p/HDAC2 axis plays a pivotal role in the progression and reversal of liver fibrosis and is regulated by epigenetics. FASEB J. 2021;35(7):e21700. doi:10.1096/fj.202002319RRR.

[2] Zhou Q, Rong C, Gu T, et al. Mesenchymal stem cells improve liver fibrosis and protect hepatocytes by promoting microRNA-148a-5p-mediated inhibition of Notch signaling pathway. Stem Cell Res Ther. 2022;13(1):354. Published 2022 Jul 26. doi:10.1186/s13287-022-03030-8.

[3] Liang Y, Duan L, Lu J, Xia J. Engineering exosomes for targeted drug delivery. Theranostics. 2021;11(7):3183-3195. Published 2021 Jan 1. doi:10.7150/thno.52570