Protocols


Strain Cultivation

  • Escherichia coli

    Materials (all sterilized by autoclaving)

    Table: LB liquid media (for 1 liter)
    MaterialQuantity
    yeast extract5 g
    tryptone10 g
    NaCl10 g
    Table: LB agar plate without ampicillin (for 1 liter)
    MaterialQuantity
    yeast extract5 g
    tryptone10 g
    NaCl10 g
    agar15 g
    Table: LB agar plate with ampicillin (for 1 liter)
    MaterialQuantity
    yeast extract5 g
    tryptone10 g
    NaCl10 g
    agar15 g
    1000× ampicillin stock1 mL

    Procedure

    1. Recovery

    • Thaw Escherichia coli glycerol stocks rapidly in a 37 °C water bath with gentle agitation until just melted.

    • Inoculate 100 µL of the thawed culture into 900 µL of liquid LB medium and incubate at 37 °C with shaking at 200 rpm for 1 hour.

    • Centrifuge the culture at 5000 × g for 1 minute at room temperature.

    • Remove approximately 900–950 µL of the supernatant, leaving 50–100 µL. Resuspend the pellet by gently pipetting.

    • Spread the resuspended cells onto LB agar plates supplemented with ampicillin. Allow the suspension to absorb, then incubate the plates inverted at 37 °C overnight (12–16 h).

    2. Maintenance

    • Spread the revived single colony onto an LB agar plate containing ampicillin, seal the edges with parafilm, and store at 4 °C.

    3. Cultivation

    • Pick a single colony and inoculate it into 5 mL of LB medium containing 100 μg/mL ampicillin. Incubate overnight at 37 °C with shaking at 230 rpm.

    • Inoculate the overnight culture into 100 mL of LB medium containing 100 μg/mL ampicillin at a 1:100 dilution and measure the initial OD600.

    • Incubate at 37°C with 200 rpm shaking until the OD600 reaches 0.5-0.6.

    4. Preservation

    • Add 20 μL of 100% glycerol to the remaining cells and store at -80 °C.
  • Saccharomyces

    Material

    Table: Stock solution (all sterilized by filtration)
    StockComposition (for 1 liter)
    40% galactose stock400.0 g galactose
    20% raffinose stock200.0 g raffinose
    20% glucose stock200.0 g glucose
    Amino acid & nucleotide stock100 mg L-Leucine/20 mg L-Histidine/20 mg L-Methionine/20 mg Uracil
    Table: SC liquid media (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    all 4 amino acid / nucleotide stock10 mL each
    DO supplement0.6 g
    Table: SC agar plate (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    all 4 amino acid / nucleotide stock10 mL each
    DO supplement0.6 g
    Agar15 g
    Table: SC-Ura-Leu-Met-His media (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    DO supplement0.6 g
    Table: SC-Ura media (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    all 3 amino acid stock10 mL each
    DO supplement0.6 g
    Table: SC-Leu media (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    Ura, Met, His stock10 mL each
    DO supplement0.6 g
    Table: SD-Ura activation media
    MaterialQuantity
    SC-Ura liquid media45 mL
    20% glucose stock5 mL
    Table: SC-Ura+Raf scale-up media
    MaterialQuantity
    SC-Ura liquid media450 mL
    20% raffinose stock50 mL
    Table: SD-Leu activation media
    MaterialQuantity
    SC-Leu liquid media45 mL
    20% glucose stock5 mL
    Table: SC-Leu+Raf scale-up media
    MaterialQuantity
    SC-Leu liquid media450 mL
    20% raffinose stock50 mL
    Table: SD-Ura agar plate (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    all 3 amino acid stock10 mL each
    DO supplement0.6 g
    20% glucose stock100 mL
    Agar15 g
    Table: SD-Leu agar plate (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    Ura, Met, His stock10 mL each
    DO supplement0.6 g
    20% glucose stock100 mL
    Agar15 g
    Table: SC-Ura one-step induction media
    MaterialQuantity
    SC-Ura liquid media180mL
    30% galactose-raffinose mixture (Gal:Raf=2:1)20mL
    Table: SC-Leu one-step induction media
    MaterialQuantity
    SC-Leu liquid media180mL
    30% galactose-raffinose mixture (Gal:Raf=2:1)20mL
    Table: SD (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    all 4 amino acid / nucleotide stock10 mL each
    DO supplement0.6 g
    20% glucose stock100 mL
    Agar (for plates only)15 g
    Table: SD-Ura-His-Leu (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    Met stock10 mL
    DO supplement0.6 g
    20% glucose stock100 mL
    Agar (for plates only)15 g
    Table: SD-Ura-His (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    Met, Leu stock10 mL each
    DO supplement0.6 g
    20% glucose stock100 mL
    Agar (for plates only)15 g
    Table: SD-Ura (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium sulfate5 g
    Met, Leu, His stock10 mL each
    DO supplement0.6 g
    20% glucose stock100 mL
    Agar (for plates only)15 g
    Table: YPD (for 500 mL)
    MaterialQuantity
    BeyoPure™ YPD Broth premixed powder (namely, 5 g/500mL yeast extract, 10 g/500mL peptone, 10 g/500mL D-glucose)1 bottle
    agar for plates10 g
    Table: YPD+G418 (for 500 mL)
    MaterialQuantity
    BeyoPure™ YPD Broth premixed powder1 bottle
    G418 stock2.5 g

    Procedure

    1. Recovery

    • Streak the Saccharomyces cerevisiae glycerol stock stored at -80 °C onto a YPD agar plate, and incubate inverted at 30 °C for 2–4 days to reactivate the strain.

    2. Maintenance

    • Spread the single colony onto the appropriate agar plates, seal the edges with parafilm, and store at 4 °C.

    3. Cultivation

    S. cerevisiae
    • Using a sterile toothpick, pick a single colony and inoculate it into 5 mL of the appropriate plasmid activation medium. Incubate overnight at 30 °C with shaking at 220-240 rpm.
    S. Boulardii
    • Using a sterile toothpick, pick a single colony and inoculate it into 5 mL of liquid YPD medium in a 5 mL culture tube.
    • Mix by vortexing and incubate overnight at 37 °C with shaking at 220-240 rpm.

    4. Preservation

    • Add 50% glycerol to a final concentration of 25% (mix at a 1:1 ratio) and mix thoroughly, then store at -80 °C.
  • Pseudomonas aeruginosa

    Material

    Table: TSA agar plate (for 1 liter)
    MaterialQuantity
    tryptone15 g
    soy peptone5 g
    NaCl5 g
    agar15 g
    Table: TSB liquid media (for 1 liter)
    MaterialQuantity
    tryptone15 g
    soy peptone5 g
    NaCl5 g
    Table: M63 (for 1 liter)
    MaterialQuantity
    20% Casein amino acids225 mL
    5x M63 stock200mL
    MgSO4 solution1mL
    20% Glucose stock10mL

    Procedure

    1.Recovery

    • Wipe the ampoule with absorbent cotton moistened with 75% ethanol
    • Heat the tip of the ampoule in a flame, then add a small drop of sterile water onto the heated tip to initiate cracking.
    • Break off the cracked tip using sterile forceps.
    • Using a sterile pipette, add 0.3–0.5 mL of liquid medium into the ampoule and gently shake to dissolve the lyophilized cells into suspension.
    • Transfer the entire cell suspension to a test tube.
    • Incubate at 37 °C with shaking at 200 rpm overnight.

    2.Maintenance

    • Spread the revived single colony onto a TSA agar plate, seal the edges with parafilm, and store at 4 °C.

    3.Cultivation

    • Pick a single colony and inoculate it into 5 mL of TSB medium. Incubate overnight at 37°C with 220 rpm shaking.

    4.Preservation

    • Add 0.6 mL of overnight culture and 0.4 mL of 50% glycerol into a cryovial.
    • Mix thoroughly by vortexing or repeated inversion. Store the bacterial glycerol stock at -80 °C.

DNA Cloning Methods

  • PCR

    Materials

    • PCR Master Mix (2X) (including 2X DNA Polymerase, 2X Buffer with Mg22+, 2X dNTP)
    • Nuclease-free Water
    • Forward Primer & Reverse Primer
    • Template DNA

    Procedure

    1. Reaction Mixture Preparation

    1. Thaw all PCR components (primer, template DNA, etc.) on ice and mix each components gently.

    2. Dilute the primer to 10 μM using ddH₂O (at least 10 μL per dilution).

    3. Prepare the PCR reaction mixture in PCR-tubes on ice according to the order in the table below.

      Table: Typical composition of a PCR reaction.
      ComponentFinal ConcentrationVolume
      Nuclease-free Water-(21-x) μL
      Template DNA1~10 ngx μL
      Primer Mix (10μM each)0.8 μM each4 μL
      PCR Master Mix (2X)1X25 μL
      Total-50 μL
    4. Mix gently by pipetting or brief vortex, then spin down.

    2. PCR Amplification

    1. Place the prepared PCR reaction mixture in the thermal cycler and set the cycling program according to the table below.

      Table: Typical program for a PCR reaction.
      StepTemperatureSetting
      Initial Denaturation92℃3 min
      Denaturation92℃30 sec
      Annealing55℃30 sec
      Extension68℃15~60 sec/kb
      Go to Step 2-30~35 cycles
      Final Extension68℃10 min
      Hold4℃∞
      • Tips: It is recommended to use an extension time of 15 sec/kb for amplicons within 6 kb, and 60 sec/kb for amplicons left over 6 kb.
    2. Store at -20°C until further use.

  • In-fusion Assembly

    Materials

    • 2 × CE Mix V3 (from ClonExpress Ultra One Step Cloning Kit V3)
    • ddH2O
    • Linearized Vector
    • Insert Fragments

    Procedure

    1. Measure the DNA concentration of the linearized vector and the insert fragments separately using Nanodrop®.

    2. Prepare the reaction mixture in PCR-tubes on ice according to the table below.

      Table: Typical composition of an in-fusion assembly reaction.
      ComponentVolume
      Linearized VectorX μL
      Insert Fragments (n≤10)Y1+Y2+…+Yn μL
      2 × CE Mix V35 μL
      ddH2Oto 10 μL
      • X/Y is the amount of vector/insert calculated by formula:
      • Single-fragment homologous recombination: The optimal mass of vector = [0.02 × number of bp] ng (0.03 pmol) The optimal mass of insert = [0.04 × number of bp] ng (0.06 pmol)
      • Multi-fragment homologous recombination: The optimal mass of vector = [0.02 × number of bp] ng (0.03 pmol) The optimal mass of each insert = [0.02 × number of bp] ng (0.03 pmol)
      • The recommended amounts of vector and insert are between 10~100 ng, respectively. When the optimal mass calculated using the formula is out of this range, the minimum/maximum input amount can be used directly.
    3. Mix gently by pipetting (do not vortex), then spin down.

    4. Place the reaction mixture in the thermal cycler and run the following program:

      • 50°C for 5-15 min (for single-fragment assembly) or 15-30 min (for multi-fragment assembly).
      • 4℃ forever.
    5. The recombination product can be used to transformation or stored at -20°C for one week.

  • Agarose Gel Electrophoresis

    Materials

    • Agarose
    • 50× TAE
    • M5 GelRed Plus Nucleic Acid Dye (10,000×)
    • 6× loading buffer
    • DNA Marker (DL2000/DL2000 plus/DL15000…)
    • ddH2O

    Procedure

    1. Gel Casting

    1. Prepare agarose gels according to the table below.

      Table: Typical formula for an agarose gel.
      ComponentFinal ConcentrationVolumeVolume
      Agarose0.8% (for plasmids or vectors)
      1% (for insert fragments)
      0.16 g
      0.2 g
      0.32 g
      0.4 g
      50× TAE1×400 μL800 μL
      ddH2O-19.6 mL39.2 mL
      Total-20 mL40 mL
    2. Microwave until fully dissolved (for ~2 min on the defrost setting).

    3. Once the solution has cooled down to about 60°C, add the M5 GelRed Plus Nucleic Acid Dye (10,000×) according to the dilution ratio and mix well.

    4. Pour the gel into the pre-assembled casting tray, then place a well comb and wait for ~30 min until the gel becomes firm.

    2. Electrophoresis

    1. For each sample, prepare the loading mix according to the table below.

      Table: Formula for the loading mix.
      ComponentVolumeVolume
      DNA Sample5 μL25 μL
      6× Loading Buffer1 μL5 μL
      Total6 μL30 μL
      • Suggestions: For analytical electrophoresis (e.g., plasmid verification), load 6 μL. For preparative electrophoresis (e.g., PCR product purification), load 30 μL.
    2. Load DNA marker and the sample mixtures into the wells, respectively.

      • Choose a DNA marker whose range covers the sizes of the DNA fragments.
    3. Run gel at 150 V for 30 min, then observe the results in the gel imager.

  • Gel Extraction

    Note: This protocol is effective for extracting DNA shorter than 10kb. The efficiency of extracting longer fragments is significantly decreased.

    Materials

    • Beyotime™ DNA Gel Extraction Kit:
      • Binding Buffer
      • Wash buffer (added ethanol)
      • Elution Buffer
      • DNA Purification Columns & Collection Tubes

    Procedure

    1. Gel Melting

    1. Excise the gel with intended DNA band and weigh the gel strip in a 1.5 mL EP tube. Break the strip if necessary.
    2. Add an equal volume of binding buffer to the gel fragments (e.g., add 100 μL of binding buffer for every 100 mg of gel). Mix thoroughly by vortex or inverting the tube.
    3. Incubate the mixture at 50-60°C for ~10 min until the gel is completely dissolved. Vortex or invert the tube 3-4 times during incubation to facilitate dissolution.
      • Note: After complete dissolution, continue incubating at 50-60°C for an additional 2 minutes. For DNA fragments >5 kb, use inversion instead of vortex.
    4. Transfer the dissolved gel solution to a DNA purification column and let it stand at room temperature for 1 min.
      • Note: If the volume exceeds the column capacity, load the sample in sequential steps: after centrifuging an initial portion, add the remaining solution to the same column and repeat.
    5. Centrifuge at ~16,000×g for 1 min. Discard the flow-through from the collection tube.

    2. Washing

    1. Add 700 μL of wash buffer to the column. Incubate at room temperature for 1 min.
    2. Centrifuge at ~16,000×g for 1 min to remove impurities. Discard the flow-through.
    3. Add 500 μL of wash buffer to the column. Centrifuge at ~16,000×g for 1 min to further remove impurities. Discard the flow-through.
    4. Centrifuge at ~16,000×g for an additional 1 min to eliminate residual ethanol and ensure complete evaporation.

    3. Elution

    1. Place the column in a clean 1.5 mL EP tube. Apply 30 μL of elution buffer directly to the center of the column. Then let it stand for 1 min.
    2. Centrifuge at ~16,000×g for 1 min. The eluate contains the intended DNA.
  • Plasmid Extraction (by Magnetic Beads)

    Materials

    • BeyoMag™ Plasmid Mini Preparation Kit with Magnetic Beads
      • RNase A (add to Solution I before first use)
      • Solution I (Resuspension buffer)
      • Solution II (Lysis buffer)
      • Solution III (Binding/Neutralization buffer)
      • Solution IV (Wash buffer; add specified volume of anhydrous ethanol before first use)
      • Solution V (Elution buffer)
      • BeyoMag™ magnetic beads (mix well before use)
      • Magnetic separation rack (recommended: 12- or 24-well magnetic rack)

    Procedure

    1. Pellet cells

    • Transfer 1.5 mL of an overnight E. coli culture into a 1.5 mL microcentrifuge tube. Centrifuge at 5,000×g at room temperature for 1 minute to pellet the cells. Discard the supernatant.
    • Repeat once with another 1.5 mL sample so the tube contains pellet from a total of 3 mL overnight culture.
      Note: Typically LB overnight (~16 h) growing to an OD600 of ~2–4 is recommended. If pellets are not compact, slightly increase centrifugation time. Do not centrifuge for too long or at too high speed — overly tight pellets are difficult to resuspend after adding Solution I.
    • After removing the supernatant, invert the open tube on absorbent paper to drain residual liquid. If cell density is low, consider using more culture (repeat pelleting 1–2 additional times). For high‑copy plasmids do not exceed ~3 mL culture per prep; for low‑copy plasmids do not exceed ~5 mL.

    2. Resuspend cells

    • Add 200 µL Solution I (Resuspension buffer containing RNase A) to each pellet. Resuspend thoroughly until no visible clumps remain. Vortex briefly or pipette up and down to break up the pellet.
      Note: Ensure RNase A is present in Solution I. The suspension should be homogeneous and turbid when held to a bright light.

    3. Alkaline lysis

    • Add 200 µL Solution II (Lysis buffer) to each tube. Immediately invert the tube gently 4–6 times to mix until the solution becomes clear.
      • Do NOT vortex. Vigorous mixing will shear genomic DNA and can contaminate the plasmid preparation. If clumps remain after 4–6 inversions, invert an additional 3–5 times and incubate at room temperature for 2–3 minutes. Total lysis time should not exceed 5 minutes.

    4. Neutralization

    • Add 200 µL Solution III (Binding/Neutralization buffer) to each tube and invert gently 4–6 times. A white flocculate (cellular debris) should appear.
      • Do NOT vortex. Excessive mixing can reduce plasmid quality.

    5. Clarify lysate by centrifugation

    • Centrifuge the tubes at maximum speed (≈13,000 rpm) at room temperature for 10 minutes. A white pellet containing precipitated debris will form.
    • While centrifuging, prepare a new labeled 1.5 mL tube for the cleared lysate.

    6. Bind plasmid to beads

    • Carefully transfer the cleared supernatant to a new 1.5 mL tube without disturbing the white pellet.
    • Add 50 µL well-mixed BeyoMag™ magnetic bead suspension to the supernatant (mix beads thoroughly before use). Gently mix by inversion or slow pipetting and incubate at room temperature for 3–5 minutes to allow plasmid binding.
      Note: If higher yield is required, increase bead volume or extend binding time.

    7. Separate beads on magnetic rack

    • Place the tube on a magnetic rack and wait until beads fully collect at the tube wall (typically <1 minute). Carefully remove and discard the supernatant without disturbing the bead pellet.

    8. Wash #1

    • Remove the tube from the rack. Add 750 µL Solution IV (wash buffer) and gently resuspend the beads by flicking or gentle inversion (do not vortex). Place the tube back on the magnetic rack and allow the beads to collect. Carefully remove and discard the supernatant.
      Note: If beads stick to the tube walls, briefly invert the tube while holding it on the rack so beads fall; then remove supernatant.

    9. Wash #2

    • Repeat the wash step with 450 µL Solution IV. Resuspend beads gently, magnetically separate, and remove as much residual liquid as possible.

    10. Dry beads

    • Air-dry the bead pellet to remove residual ethanol: leave the open tube at room temperature for 5–10 minutes or place in a 37°C dry oven for 5 minutes to evaporate traces of ethanol. Do not overdry.

    11. Elute plasmid

    • Add 50–100 µL Solution V (Elution buffer or nuclease-free water, pH ≥ 6.5) to the bead pellet. Gently resuspend the beads and incubate at room temperature for 3–5 minutes; gently invert or flick the tube 1–2 times during incubation to improve elution.
    • Place the tube on the magnetic rack until beads collect. Carefully transfer the supernatant (eluted plasmid) to a new labeled 1.5 mL tube. Store at -20°C.
      Note: To increase concentration use a smaller elution volume (e.g., 50 µL). Elution at 50–55°C can increase yield slightly compared with room temperature elution.

    Notes and troubleshooting

    • Always ensure RNase A is present in Solution I before starting.
    • Avoid vortex after adding Solution II and Solution III — mechanical shearing increases genomic DNA contamination.
    • If the pellet after neutralization is not compact or the lysate is cloudy, increase initial centrifugation time or combine more culture to increase biomass.
    • If you observe low yield or impurities, consider increasing bead volume, extending the binding time, and ensuring ethanol was added to Solution IV and that the final dry step was performed.
    • Bead aggregation: reduce culture input volume, ensure beads are fully resuspended before use, and thoroughly resuspend beads during washes.
  • Plasmid Miniprep (by Spin‑column)

    Materials

    • Beyotime® Plasmid Mini Preparation Kit for All Purpose, Plasmid Miniprep Kit for All Purpose
      • RNase A (Solution I)
      • Solution I (Resuspension buffer)
      • Solution II (Lysis buffer)
      • Solution III (Neutralization buffer)
      • Solution PB (optional, column conditioning/wash buffer for EndA+ strains)
      • Solution IV (Wash buffer)
      • Solution V (Elution buffer)

    Procedure

    1. Pellet cells

    • Transfer 1.5 mL of an overnight E. coli culture into a 1.5 mL microcentrifuge tube. Centrifuge at 5,000 × g (approximately 5,000 rpm on many tabletop centrifuges) at room temperature for 1 minute to pellet the cells. Discard the supernatant.
    • Repeat once with another 1.5 mL sample so that each tube contains the pellet from a total of 3 mL overnight culture.
      Note: Typically LB overnight (~16 h) growing to an OD600 of ~2–4 is recommended. If pellets are not compact, slightly increase centrifugation time. Do not centrifuge for too long or at too high speed — overly tight pellets are difficult to resuspend after adding Solution I.
    • After removing the supernatant, add ~1.5 mL culture and repeat if needed. Invert the open tube on absorbent paper to drain residual liquid. If cell density is low, use more culture (repeat pelleting 1–2 additional times) to reach the desired biomass. For high‑copy plasmids do not exceed ~5 mL of culture per prep; for low‑copy plasmids do not exceed ~10 mL.

    2. Resuspended cells

    • Add 250 µL Solution I (resuspension buffer containing RNase A) to each pellet. Resuspend thoroughly until no visible clumps remain. Vortex at high speed for 5–10 seconds (or longer if required) to suspend the pellet.
    • If no vortex is available, pipette up and down or flick the tube to break up the pellet. The suspension should be homogeneous and turbid when held to a bright light.

    3. Alkaline lysis

    • Add 250 µL Solution II (lysis buffer) to each tube. Immediately invert the tube gently 4–6 times to mix until the solution becomes clear.
      • Do NOT vortex. Vigorous mixing will shear genomic DNA and can contaminate the plasmid preparation. If clumps remain after 4–6 inversions, invert an additional 3–5 times and incubate at room temperature for 2–3 minutes. Total lysis time should not exceed 5 minutes.

    4. Neutralization

    • Add 350 µL Solution III (neutralization buffer) to each tube and invert gently 4–6 times. A white flocculate (cellular debris) should appear.
      • Do NOT vortex. Excessive mixing can reduce plasmid quality.

    5. Clarify lysate by centrifugation

    • Centrifuge the tubes at maximum speed (~13,000 rpm) at room temperature for 10 minutes. A white pellet containing precipitated debris will form.
    • While centrifuging, prepare spin columns in labeled collection tubes.

    6. Bind plasmid to column

    • Carefully transfer the cleared supernatant to the spin column without disturbing the white pellet. Alternatively, aspirate the supernatant and apply it to the column.
    • Centrifuge at maximum speed for 30–60 seconds. Discard the flow‑through and retain the collection tube for reuse.
    • Add 500 µL Solution PB to the column and centrifuge 30–60 seconds. Discard the flow‑through.
      • Note: This step is recommended (or required) when extracting plasmid from EndA+ strains (e.g., JM110, BL21(DE3), TG1, HB101) or strains with high nuclease activity or particular surface modifications. For common EndA‑ strains such as DH5α and XL1‑Blue, and if plasmid will be used for routine restriction digestion, PCR or cloning, this step can be skipped. If plasmid is intended for transfection, include this step to reduce nuclease contamination.

    8. Wash column

    • Add 750 µL Solution IV (wash buffer, typically contains ethanol) to the column. Centrifuge at maximum speed for 30–60 seconds. Discard the flow‑through and keep the collection tube.

    9. Dry column

    • Centrifuge the column (with the empty collection tube) at maximum speed for 1 minute to remove residual wash buffer and allow trace ethanol to evaporate. It is important to discard the flow‑through before this spin so residual wash is removed thoroughly.

    10. Elute plasmid

    • Place the spin column into a clean, labeled 1.5 mL microcentrifuge tube. Add 50 µL Solution V (elution buffer, or nuclease‑free water pH ≥ 6.5) directly to the center of the column membrane. Incubate for 1 minute at room temperature to allow buffer to soak into the membrane.
    • If higher concentration is desired, elute with a smaller volume (e.g., 35 µL) or perform a second elution and pool.

    11. Collect eluate

    • Centrifuge at maximum speed for 1 minute. The eluate contains the purified plasmid DNA.
      • Yield and concentration: typical plasmid concentration is ~0.1–0.3 mg/mL. To concentrate the DNA further, perform ethanol precipitation.

    Notes and troubleshooting

    • Always ensure RNase A is present in Solution I before starting.
    • Avoid vortexing after adding Solution II and Solution III — mechanical shearing increases genomic DNA contamination.
    • If the pellet after neutralization is not compact or the lysate is cloudy, increase initial centrifugation time or combine more culture to increase biomass.
    • Do not overload the column with excessive lysate; follow kit recommendations for maximum culture volume (high‑copy ≤ 5 mL, low‑copy ≤ 10 mL per column).
    • If you observe low yield or impurities, consider performing the optional Solution PB wash (Step 7) and ensure ethanol was present in Solution IV and that the final dry spin (Step 9) was performed.
    Table: Examples for EndA- and EndA+ E. coli strains
    EndA-EndA+
    BJ5183BL21(DE3)
    DH1CJ236
    DH20HB101
    DH21JM83
    DH5αJM101
    JM103JM110
    JM105LE392
    JM106MC1061
    JM107NM522 (all NM series are EndA+)
    JM108NM554
    JM109P2392
    MM294PR700 (all PR series are EndA+)
    SK1590Q358
    SK1592RR1
    SK2267TB1
    SRBTG1
    TOP10Y1088 (all Y10 series are EndA+)
    XL1-BlueBMH 71-18
    XLOES1301
  • Genomic DNA Extraction

    Materials

    • RNase A
    • Proteinase K
    • Lyticase (yeast cell wall degrading enzyme)
    • Reducing agent (DTT or β-mercaptoethanol)
    • Sorbitol Buffer
    • Solution A
    • Solution B
    • Wash Buffer (ethanol must be added before use)
    • Elution Buffer (or nuclease-free water, pH ≥ 8.0 recommended)
    • Spin columns (DNA binding columns)
    • Collection tubes (1.5 mL or 2 mL microcentrifuge tubes)

    Procedure

    1. Pellet cells

    • Start with up to 5 × 107 yeast cells. Centrifuge at 8,000 rpm for 1 min and remove the supernatant as completely as possible.

      Note: An overnight yeast culture typically reaches OD600 ≈ 2.0. Collect cells by centrifugation and wash once with PBS to remove residual medium.

    2. Yeast cell wall digestion

    • Resuspend the cell pellet in 470 µL Sorbitol Buffer and mix thoroughly.
    • Add 25 µL lyticase and 5 µL reducing agent (e.g., DTT or β-mercaptoethanol). Mix by inversion until homogeneous.
    • Incubate at 30°C for 1–2 h. During incubation, gently invert the tube a few times to mix.
    • Centrifuge at 12,000 rpm for 1 min and discard the supernatant. Keep the pellet.

    3. DNA separation

    • Add 300 µL Solution A to the pellet and resuspend thoroughly.
    • Add 2 µL RNase A, mix by inversion, and incubate at room temperature for 10 min.
    • Add 220 µL Solution B and then add 20 µL Proteinase K. Mix by inversion until homogeneous.
    • Incubate in a 65°C water bath for 15–30 min. During incubation, invert the tube a few times to mix.
    • Centrifuge at 8,000 rpm for 30 s and carefully transfer the supernatant to a new tube.
      Note: Work quickly: after cooling to room temperature the lysate may become cloudy.

    4. DNA purification

    • Allow the lysate to cool to room temperature (if still warm), then add 375 µL absolute ethanol and mix thoroughly.
    • Transfer the mixture to a spin column placed in a collection tube. Centrifuge at 8,000 rpm for 1 min. Discard the flow-through and place the column back into the collection tube.
    • Add 600 µL Wash Buffer (confirm ethanol was added) to the column. Centrifuge at 12,000 rpm for 1 min. Discard the flow-through and return the column to the collection tube. Then repeat this step.
    • Centrifuge the column at 12,000 rpm for 2 min to remove residual wash buffer. Then open the column and place it at room temperature or in a 50°C dry oven for a few minutes to evaporate any remaining ethanol.
      Note: Removing residual ethanol is critical — residual ethanol can inhibit downstream enzymatic reactions (restriction digest, PCR, etc.).
    • Transfer the spin column to a clean microcentrifuge tube. Pre-warm Elution Buffer to 65°C and add 50–200 µL directly to the center of the column membrane (recommended volume 50 µL).
    • Incubate at room temperature for 5 min, then centrifuge at 12,000 rpm for 1 min to collect the eluate.
    • (Optional) To increase yield, add the eluate back onto the column and centrifuge at 12,000 rpm for 2 min.

    5. Storage

    • Store purified genomic DNA at -20°C to prevent degradation.

    Notes and troubleshooting

    • Store lyticase at -20°C.
    • Before use, add absolute ethanol to the Wash Buffer according to the label on each bottle (each bottle requires 45 mL of absolute ethanol to be added separately).
    • All centrifugation steps are performed at room temperature using a benchtop centrifuge.
    • Avoid repeated freeze–thaw cycles of samples; repeated freezing and thawing fragments DNA and reduces yield.
    • If any buffers show precipitates, dissolve them by warming in a 65°C water bath before use; this does not affect extraction performance.
    • If the spin column becomes clogged during centrifugation, increase the centrifugation time to clear the blockage.
    • Use at least 50 µL for elution; smaller volumes may reduce recovery efficiency. Elution buffer pH affects recovery — if using water, adjust pH to ~8.0 (e.g., with a small amount of NaOH). pH < 7.0 will reduce elution efficiency.
    • DNA fragment size depends on sample storage time and mechanical shearing during handling. Evaluate fragment size by agarose gel electrophoresis.
    • Measure DNA concentration and purity by spectrophotometry. Double‑stranded DNA: OD260 of 1.0 ≈ 50 µg/mL. Expected OD260/OD280 ratio: 1.7–1.9. If eluted in water, OD ratio may appear lower due to pH and ionic differences; this does not necessarily indicate low purity.
  • E. coli Transformaton (DH5α and BL21(DE3))

    Material

    • E. coli DH5α/BL21(DE3) competent cells
    • Plasmids (dissolved)
    • LB Broth
    • LB Agar Plate (without/with antibiotic)

    Procedure

    1. Place the competent cells on ice or in an ice-water for ~5 min until thawed.
      • Caution: Use the cells within 10 min after thawing, or it will significantly reduce transformation efficiency.
    2. Add the plasmid (with the amount of 1~2 ng) to 100 μL of competent cells. Mix gently by flicking the bottom of the tube or swirling gently. Do not mix by pipetting up and down.
    3. Immediately place the tube back on ice and incubate for 30 min.
    4. Transfer the tube directly to a 42°C water bath and incubate for 45 sec. Place the tube back on ice for 2 min to cool down. Do not shake or mix.
    5. Add 900 μL of 37°C pre-warmed, antibiotic-free LB broth to the tube. Mix by inverting the tube several times.
    6. Incubate the tube at 37°C in a shaking incubator (150 rpm) for 1 h to allow for recovery.
    7. Centrifuge the tube at 5,000 × g for 1 min at room temperature. Carefully aspirate and discard 900~950 μL of the supernatant, leaving 50~100 μL. Gently resuspend the bacterial pellet in the remaining supernatant by pipetting.
    8. Plate a small amount (e.g., ~10 μL) of the resuspended cells onto an LB agar plate without antibiotic as a positive control. Plate the remainder of the resuspended cells onto an LB agar plate containing the appropriate selective antibiotic.
    9. Invert the plates and incubate them overnight at 37°C.
  • Yeast Chemically Competent Cells Preparation and Transfection

    Materials

    • Yeast strain stored in 15–20% glycerol at -80°C
    • YPD agar plates
    • YPD liquid medium
    • Beyotime® Competent Cell Preparation and Transformation Kit for Saccharomyces Cerevisiae
      • Buffer A
      • Buffer B
      • Buffer C
      • DMSO
      • Carrier DNA (salmon sperm DNA, boiled and chilled; 10 µl per transfection)
    • Plasmid DNA (0.1–1 µg per transfection)

    Procedure

    1. Strain activation

    • Remove yeast glycerol stock from -80°C and streak onto a YPD agar plate. Invert and incubate at 30°C for 2–4 days to revive and isolate single colonies.

    2. Inoculation

    • Using a sterile inoculating loop or pipette tip, pick a single fresh yeast colony and inoculate 10 mL of YPD liquid medium in a sterile 50 mL conical tube or culture flask.

    3. Overnight culture

    • Incubate the 10 mL starter culture at 28–30°C with shaking at ~250 rpm overnight (~12–16 hours).

    4. Subculture to mid‑log phase

    • Transfer an appropriate volume of the overnight culture into 50 mL YPD so that the starting OD600 is between 0.2–0.3 (typically transfer ~1–2 mL into 50 mL, adjust as needed). Incubate at 30°C with shaking at 250–300 rpm for 2–3 hours until OD600 reaches 0.4–0.6.

    • Note: The target OD600 (0.4–0.6) is critical — cells in mid‑log phase give the best competence. As a rule of thumb, each 10 mL of culture can yield four 100 µL competent aliquots; scale accordingly.

    5. Preparation of competent cells

    • When the culture reaches OD600 = 0.4–0.6, transfer the appropriate volume (for example, 10 mL for a small prep) to a sterile 15 mL tube and centrifuge at 3,000 × g for 3 minutes at room temperature. Carefully discard the supernatant and keep the cell pellet.

    • Resuspend the pellet thoroughly in 7 mL Buffer A. Centrifuge again at 3,000×g for 3 minutes at room temperature and discard the supernatant.

    • Resuspend the washed pellet in 400 µL Buffer B. Incubate at room temperature for 10 minutes. After this incubation the cells are chemically competent and ready for transfection.

    6. Yeast transfection

    • To a sterile 1.5 mL tube containing 100 µL competent cells add 0.1–1 µg plasmid DNA and 10 µL heat‑denatured carrier DNA (ssDNA). Gently mix by pipetting or flicking the tube.

    • Add 600 µL Buffer C to the tube and mix by inverting or gently pipetting. Incubate in a 30°C water bath for 30 minutes.

    • After incubation, add 70 µL DMSO to the mixture and mix gently by inversion. Heat shock in a 42°C water bath for 15 minutes, then immediately transfer the tubes to an ice bath for 3–5 minutes.

    • Centrifuge the tubes at 12,000–14,000 × g for 10 seconds at room temperature. Carefully remove and discard the supernatant, then resuspend the cell pellet in 100 µL Buffer A.

    • Plate the entire resuspended volume onto the appropriate selective agar plate. Invert and incubate at 30°C for 2–3 days until single colonies appear.

    Notes and Troubleshooting

    • Immediately aliquot competent cells into 100 µL portions in sterile 1.5 mL tubes for transfection.
    • The procedure above is written for a typical small-scale preparation where 10 mL of culture yields four 100 µL aliquots of competent cells. Scale volumes proportionally for larger or smaller preparations.
    • Prepared competent cells are best used immediately. Short-term storage at 4°C for up to 1 week is possible but efficiency will decrease with time. For longer storage, add glycerol to a final concentration of 15% and freeze at -80°C; frozen aliquots are effective for at least ~3 months but efficiency may decline.
    • Factors affecting transfection efficiency:
      • Yeast strain differences and growth conditions strongly influence efficiency.
      • Using highly pure plasmid DNA improves efficiency; different plasmid backbones and sizes will transform at different rates.
      • Adding DMSO prior to the 42°C heat step can increase transfection efficiency by 2–5× in many cases.
    • If transfection efficiency is low:
      • Verify cells were in mid‑log phase (OD600 0.4–0.6) at the time of preparation.
      • Confirm carrier DNA was properly denatured (boiled, then chilled on ice) and is present in the transfection mix.
      • Ensure reagents — especially LiAc or PEG if present in your Buffers — are fresh and prepared correctly.
  • Yeast Electrocompetent Cells Preparation and Transfection

    Materials

    • 1 M DTT (Dithiothreitol)
    • 1 M HEPES buffer (pH 8.0)
    • 1 M Sorbitol
    • YPD plates and YPD liquid medium
    • 1.5 mL and 50 mL sterile centrifuge tubes
    • Sterile microcentrifuge tubes (1.5 mL)
    • Sterile pipettes and tips
    • 0.2 cm electroporation cuvettes (ice pre-chilled)
    • Electroporator capable of settings below
    • Ice bucket and pre-chilled solutions

    Procedure

    1. Growth / Activation

    • Pick a single freshly isolated colony from a YPD plate and inoculate 5–10 mL YPD liquid medium.
    • Incubate overnight at 30°C, 220 rpm.
    • Next day dilute the overnight culture 1:100 into 100 mL fresh YPD.
    • Grow at 30°C, 220 rpm for ~3–5 hours until OD600 reaches 0.8–1.0 (log phase).

    2. Pretreatment

    • Transfer the culture into sterile centrifuge tubes and pellet cells at 4°C, 5,000 × g for 1 min.
    • Remove the supernatant. Gently resuspend the pellet in 25 mL ice-cold sterile water.
    • Centrifuge again at 4°C, 5,000 × g for 1 min and discard the supernatant.
    • Add 10 mL freshly prepared pretreatment buffer (prepare immediately before use):
      • 9.8 mL sterile water
      • 100 µL 1 M HEPES (pH 8.0)
      • 100 µL 1 M DTT
    • Gently resuspend the cells, transfer to a 50 mL tube, and incubate with gentle shaking (≈100 rpm) at 30°C for 15 minutes.

    3. Wash and concentrate

    • After incubation, pellet cells at 4°C, 5,000 × g for 1 min. Discard the supernatant.
    • Resuspend the pellet gently in 25 mL ice-cold 1 M sorbitol. Centrifuge at 4°C, 5,000 × g for 1 min.
    • Repeat the sorbitol wash once more. After the second wash, carefully remove all residual liquid by pipetting.
    • Resuspend the cells in 0.5 mL ice-cold 1 M sorbitol.
    • Use the prepared competent cells immediately (do not store).

    4. Electroporation setup

    • Switch on the electroporator and set the following parameters:
      • Voltage: 1.5 kV
      • Capacitance: 25 µF
      • Resistance: 200 Ω
    • Place a chilled 0.2 cm electroporation cuvette and a 1 mL tube containing ice-cold 1 M sorbitol on ice.

    5. Mix DNA and cells

    • Use an ice-cold 1.5 mL microcentrifuge tube.
    • Add 40–50 µL freshly prepared competent cells to the tube.
    • Add 200–500 ng plasmid DNA (keep volume minimal, < 5 µL if possible). Mix by gentle pipetting. DO NOT VORTEX.
    • Immediately transfer the mixture to the bottom of the pre-chilled electroporation cuvette, ensuring the liquid covers the metal surface and no bubbles are present.

    6. Pulse (electroporation)

    • Wipe any moisture from the outside of the cuvette with a tissue and place it in the electroporator sample holder.
    • Deliver the pulse by pressing the instrument’s pulse button. Be aware of high-voltage risk.
      • A successful pulse is usually accompanied by an audible beep and a time constant (τ) readout. Optimal τ is typically between 4.5–5.5 ms.
    • Immediately add 1 mL ice-cold 1 M sorbitol to the cuvette. Gently pipette up and down a few times to resuspend the cells and transfer the mixture to a new 1.5 mL tube. Work quickly to recover damaged cells.

    7. Recovery

    • Add an equal volume (1 mL) of 2× YPD medium to the cell suspension to give a final rich recovery medium (YPDS).
    • Incubate at 30°C with shaking at 150 rpm for 1–2 hours to allow expression of selectable markers and recovery.

    8. Plating

    • Pellet cells gently (3,000 × g, 3 min). Remove most of the supernatant and leave ~100–200 µL to resuspend the cells.
    • Plate 100 µL of the cell suspension evenly onto the appropriate selective SD plates. You may plate serial dilutions (e.g., undiluted, 1:5, 1:10) to estimate transformation efficiency.

    9. Incubation and colony appearance

    • Invert plates and incubate at 30°C for 2–4 days until colonies are visible. Larger plasmids often give rise to slower-growing transformants.

    Notes and troubleshooting

    • Keep everything cold: Except for the DTT treatment (pretreatment at 30°C) and the recovery step, perform all centrifugation, washing and handling steps on ice or at 4°C.
    • Cell state: Ensure yeast are in mid-log phase (OD600 = 0.8–1.0) for optimal competency.
    • Time constant (τ): Monitor the electroporation time constant after pulsing:
      • τ < 4 ms: possible air bubbles in the sample or insufficient voltage.
      • τ > 6 ms or a loud arcing / crackling sound: indicates high conductivity (residual salts) in the sample. Increase wash stringency to reduce salts.
    • Plasmid size: Transformation efficiency decreases with increasing plasmid size. For plasmids >30 kb consider increasing DNA amount (up to ~1 µg) and further optimization.
    • Work quickly after pulse: Adding sorbitol immediately after pulsing is critical to rescue electro-damaged cells.
    • Sterility: Use sterile reagents, tips and tubes to minimize contamination during recovery and plating.

Protein Expression & Analysis

  • Bacterial Protein Induced Expression & Extraction

    Materials

    • Ampicillin stock solution
      • 100 mg/ml aqueous solution
    • 1M IPTG stock solution
    • Buffer W
      • 100 mM Tris/HCl (pH 8)
      • 150 mM NaCl
      • 1 mM EDTA
    • 5× SDS-PAGE sample buffer
      • 0.25 M Tris·Cl (pH 8.0)
      • 25% glycerol
      • 7.5% SDS
      • 0.25 mg/ml bromophenol blue
      • 12.5% v/v β-mercaptoethanol
    Table: LB liquid media (for 1 liter)
    MaterialQuantity
    Yeast Extract5 g
    Tryptone10 g
    NaCl10 g

    Procedure

    • Inoculate 10 mL of LB medium containing 100 μg/mL ampicillin, and incubate overnight at 37°C with shaking at 200 rpm.

    • Dilute the overnight culture 1:100 into 100 mL of LB medium supplemented with ampicillin, and continue growth at 37°C with shaking at 200 rpm.

    • Induce protein expression when the OD600 reaches 0.5–0.6.

    • Add 50 μL of IPTG to achieve a final concentration of 0.5 mM, and induce protein expression for 18 hours at 25°C with shaking at 180 rpm.

  • Yeast Protein Expression & Extraction

    Yeast Protein Induced Expression

    Materials

    • 100× Histidine Solution
      • 0.2g Histidine
      • 100mL ddH2O
    • 100× Methionine Solution
      • 0.2g Methionine
      • 100mL ddH2O
    • 100× Leucine Solution
      • 1g Leucine
      • 100mL ddH2O
    • 100× Uracil Solution
      • 0.2g Uracil
      • 100mL ddH2O
    • 30% galactose-raffinose mixture (Gal:Raf=2:1)
    Table: Stock solution (all sterilized by filtration)
    StockComposition (for 1 liter)
    40% Galactose Stock400.0 g galactose
    20% Raffinose Stock200.0 g raffinose
    20% Glucose Stock200.0 g glucose
    Amino Acid & Nucleotide Stock100 mg L-Leucine/20 mg L-Histidine/20 mg L-Methionine/20 mg Uracil
    Table: SC-Ura-Leu-Met-His media (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium Sulfate5 g
    DO Supplement0.6 g
    Table: SC-Ura media (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium Sulfate5 g
    All 3 Amino Acid Stock10 mL each
    DO Supplement0.6 g
    Table: SC-Leu media (for 1 liter)
    MaterialQuantity
    YNB1.7 g
    Ammonium Sulfate5 g
    Ura, Met, His Stock10 mL each
    DO Supplement0.6 g
    Table: SD-Ura activation media
    MaterialQuantity
    SC-Ura Liquid Media45 mL
    20% Glucose Stock5 mL
    Table: SD-Leu activation media
    MaterialQuantity
    SC-Leu Liquid Media45 mL
    20% Glucose Stock5 mL
    Table: SC-Ura+Raf scale-up media
    MaterialQuantity
    SC-Ura Liquid Media450 mL
    20% Raffinose Stock50 mL
    Table: SC-Leu+Raf scale-up media
    MaterialQuantity
    SC-Leu Liquid Media450 mL
    20% Raffinose Stock50 mL

    Note: All media preparations requiring sterilization are autoclaved; filter sterilization is performed under biosafety cabinet for heat-sensitive components.

    Procedure

    1. Activation & Seed Culture

    • Pick a single positive colony (verified by electrophoresis) and inoculate it into 10 mL of the corresponding activation medium.

    2. Expansion & Induction

    • Conventional induction method
      • Measure the OD600 of the overnight culture.
      • Inoculate an appropriate volume of the culture into 100 mL of the corresponding scale-up medium to achieve an initial OD600 between 0.2 and 0.4.
      • Incubate at 30°C with shaking at 250 rpm, and monitor OD600 every hour.
      • When OD600 reaches between 0.8 and 1.2, add 5 mL of a 40% galactose solution to induce protein expression.
      • Induce at 30°C with shaking at 250 rpm for the desired duration.
    • One-step induction method
      • Measure the OD600 of the overnight culture.
      • Inoculate an appropriate volume of the culture into 100 mL of the corresponding scale-up medium to achieve an initial OD600 between 0.2 and 0.4.
      • Add 10 mL of the 30% galactose-raffinose mixture.
      • Induce at 30°C with shaking at 250 rpm for the desired duration.

    Yeast Protein Constitutive Expression

    Materials

    • 100× Histidine Solution
      • 0.2g Histidine
      • 100mL ddH2O
    • 100× Methionine Solution
      • 0.2g Methionine
      • 100mL ddH2O
    • 100× Leucine Solution
      • 1g Leucine
      • 100mL ddH2O
    • 100× Uracil Solution
      • 0.2g Uracil
      • 100mL ddH2O
    Table: Stock solution (all sterilized by filtration)
    StockComposition (for 1 liter)
    20% Glucose Stock200.0 g Glucose
    Table: YPD (for 500 mL)
    MaterialQuantity
    BeyoPure™ YPD Broth premixed powder (namely, 5 g/500mL yeast extract, 10 g/500mL peptone, 10 g/500mL D-glucose)1 bottle
    agar for plates10 g
    Table: SC-His media
    MaterialQuantity
    YNB1.7 g
    Ammonium Sulfate5 g
    Ura, Leu, Met Stock10 mL each
    DO Supplement0.6 g
    Table: SC-His-Ura media
    MaterialQuantity
    YNB1.7 g
    Ammonium Sulfate5 g
    Leu, Met Stock10 mL each
    DO Supplement0.6 g
    Table: SC-His-Ura-Leu media
    MaterialQuantity
    YNB1.7 g
    Ammonium Sulfate5 g
    Met Stock10 mL each
    DO Supplement0.6 g

    Procedure

    1. Activation & Seed Culture (Using Drop-out Medium)

    • Pick a single positive colony (verified by electrophoresis) or inoculate 10 µL of liquid culture into 10 mL of the corresponding SC Selection + Glc activation medium.
    • Incubate at 30°C, 250 rpm overnight (16-18 hours).

    2. Expansion Culture & Expression (Using YPD Medium)

    • Measure the OD600 of the overnight culture.
    • Dilute the culture 1:20 to 1:50 into 200 mL of corrensbonding expansion medium to achieve an initial OD600 between 0.2 and 0.4.
    • Induce at 30°C with shaking at 250 rpm for the desired duration.

    Yeast Protein Extraction

    Intracellular Protein Extraction

    Materials

    • Yeast Protein Extraction Kit
      • Isotonic solution
      • Hypotonic solution
      • Chymotrypsin Inhibitor
      • PMSF
    • β-Mercaptoethanol
    YPD medium (Per liter)
    ComponentAmount
    Yeast Extract10g
    Peptone20g
    Dextrose(D-glucose)20g

    Procedure

    • Transfer single colonies from the selective medium to 100 mL of YPD medium and culture at 30°C until the logarithmic growth phase ( OD600 = 0.8–1.2, approximately 15 hours). Centrifuge at 8000 rpm (5000 × g) for 1 minute, collect the cells, and measure the wet weight.

    • For every 50 mg of wet cell weight, add 500 μL of isotonic solution, 5 μL of snailase, and 1 μL of β-mercaptoethanol. Resuspend the cells by pipetting or vortexing.

    • Incubate in a 30°C water bath for 60 minutes, then centrifuge at 5000 rpm (2500 × g) for 1 minute. Discard the supernatant and collect the pellet.

    • Resuspend the pellet in 500 μL of isotonic solution, then centrifuge at 5000 rpm (2500 × g) for 1 minute. Discard the supernatant and collect the pellet. Repeat this washing step once.

    • Resuspend the pellet in 500 μL of hypotonic solution (before use, add 5 μL of PMSF to 500 μL of hypotonic solution). Freeze the suspension in a -20°C freezer for 30 minutes, then thaw at room temperature (repeat this cycle 2–3 times).

    • Centrifuge the solution at 12,000 rpm (12,830 × g) for 5 minutes. The resulting supernatant is the yeast protein extract (store at -20°C).

    Cell Wall Protein Extraction - Mechanical Homogenization

    Materials

    • Western & IP Lysis Buffer
    • Grinding Beads

    Procedure

    • Centrifuge at 5000 × g for 3 minutes, remove the supernatant, and resuspend the pellet with 1 mL of pre-chilled PBS. Wash by repeating this step three times.

    • Resuspend the pellet in 1 mL of Western & IP cell lysis buffer, transfer to a sample tube, and add an equal volume of 0.1 mm glass beads.

    • Homogenize using a homogenizer at 6 m/s for 10 seconds per homogenization step, with a 10-second pause between steps, repeating for a total of 9 times.

    • After homogenization, take a small aliquot of the suspension and observe under a microscope to assess the extent of cell disruption. If insufficient, repeat the homogenization.

    • After homogenization, briefly centrifuge the suspension and transfer the supernatant to a 1.5 mL microcentrifuge tube.

    • Wash the grinding beads and sample tube, drain excess liquid, and return to their original positions.

    • Centrifuge at 16,000 × g for 10 minutes at 4°C.

    Cell Wall Protein Extraction - Enzymatic Lysis

    Materials

    • Yeast Protein Extraction Kit
      • Isotonic solution
      • Hypotonic solution
      • Chymotrypsin Inhibitor
      • PMSF
    • β-Mercaptoethanol
    • Lyticase

    Procedure

    • Collect cells by centrifugation (5,000 × g, 5 minutes). Discard the supernatant.
    • Measure the wet weight of the pellet.
    • For every 50mg of wet cell weight, add 500 μl of isotonic solution, 1.4 μl of β-mercaptoethanol, 7 μL of PMSF, and and 10,000 U of Lyticase (cell wall lysis enzyme, 200 U/mg). Resuspend the pellet by pipetting or vortexing.
    • Incubate at 37°C in a metal bath for 90 minutes. Gently invert the tube to mix every 30 minutes.
    • Centrifuge at 5,000 × g for 1 minute. Carefully collect the supernatant and transfer it to a new tube. Discard the pellet.
    • Centrifuge the supernatant at 12,000 × g for 10 minutes, carefully aspirate and transfer the supernatant, discarding the pellet. Label the supernatant and store at -20°C.

    Isolation of Secretory Protein

    Procedure

    • Aliquot the cell suspension into 50 mL centrifuge tubes, balance the tubes, and centrifuge at 5000 × g for 2 minutes to pellet the cells.
    • Carefully aspirate the supernatant and transfer it to a new centrifuge tube.
    • Repeat the above steps once.
    • Label the supernatant and store at -20°C.
  • Purification

    Purification of His-tagged Proteins

    Materials

    • BeyoMag™ His-tagged Protein Purification Agarose Magnetic Beads (IDA-Ni)
    • Protein sample
    • 20% ethanol
    • Binding/Wash Buffer
    • Elution Buffer
    • 1X TBS
    • 2ml centrifuge tube
    • 0.22 μm pore size filter membrane
    • Syringe
    Binding/Wash Buffer
    ComponentConcentration
    Tris10mM
    NaCl500mM

    Caution: Filter the ddH2O and buffer solution through a 0.22 μm pore size filter membrane before use, and store at 4℃ for future use.

    Elution Buffer
    ComponentConcentration
    Tris10mM
    NaCl500mM
    Imic500mM
    Caution: Filter the ddH2O and buffer solution through a 0.22 μm pore size filter membrane before use, and store at 4℃ for future use.

    Procedure

    1. Preparation of Anti-His Magnetic Beads

    1. Resuspend the Magnetic Beads in the vial (gently pipette for 10 times, do not vortex). Transfer 10-20 μl of Magnetic Beads suspension into a new centrifuge tube (for 500 μl of protein sample). The amount of bead suspension can be scaled up or down proportionally based on the volume of protein sample.
      Caution: If using more than 0.2 ml of bead suspension, place the tube into a magnetic stand to collect beads and remove the supernatant.
    2. Add 500μl of 1X TBS (ST661/ST665) to the beads and pipette gently to mix. Place the tube into a magnetic stand to collect the beads against the side of the tube. Remove and discard the supernatant. Repeat this step twice.
    3. Resuspend the Magnetic Beads with 1X TBS at an equal volume to the initial volume of bead suspension taken in step 1.

    2. Protein Purification

    1. Add the protein sample to the washed magnetic beads and incubate them on a rotary mixer at room temperature for 20-30 minutes.
    2. Place the centrifuge tube on the magnetic stand for 10 seconds to separate. Gently aspirate and retain a portion of the supernatant for measurement of purification efficiency, and discard the remaining supernatant.
    3. Add 1.5 ml of Binding/Wash Buffer, gently vortex to resuspend the magnetic beads, perform magnetic separation for 10 seconds, then discard the supernatant.
    4. Repeat step 3 twice.
    5. Elution #1: Add 0.75 ml of Elution Buffer, gently invert the centrifuge tube to ensure the magnetic beads are suspended. Incubate at room temperature for 5 minutes, then perform magnetic separation for 10 seconds. Collect the eluate into a new centrifuge tube.
    6. Elution #2: Add another 0.75 ml of Elution Buffer to the magnetic beads and repeat the above steps. Combine the eluate from the two rounds.
    7. Mix the elution solution thoroughly and evenly distribute it into two 1.5 ml centrifuge tubes. Add an equal volume of 50% glycerol to each centrifuge tube and mix well.
    8. Divide the mixed liquid into 100 µl portions for each centrifuge tube and store at -20°C.

    3. Cleaning and Regeneration of Magnetic Beads

    1. Add 2 ml of Elution Buffer to the centrifuge tube, invert several times, vortex for 10 seconds to resuspend the magnetic beads, perform magnetic separation, and remove the supernatant. Repeat this process 3 times.
    2. Add 2 ml of 20% ethanol to the centrifuge tube, invert several times, vortex for 10 seconds to resuspend the magnetic beads, perform magnetic separation, and remove the supernatant. Repeat this process 3 times.
    3. Store the magnetic beads in 20% ethanol, ensuring the total volume is equal to the initial suspension volume. Place it at 4°C and it can be used for the purification of the same protein in the next experiment.

    4. Calculation of the purification efficiency and purity

    1. Calculate the purification efficiency using the following formula.
      Purification efficiency=Total amount of purified proteinTotal amount of protein in sampleTotal amount=Concentration (mg/ml)×Volume (ml)\begin{align*} \text{Purification efficiency} &= \frac{\text{Total amount of purified protein}}{\text{Total amount of protein in sample}} \\ \text{Total amount} &= \text{Concentration (mg/ml)} \times \text{Volume (ml)} \end{align*}
    2. Separate the purified protein by SDS-PAGE. After electrophoresis, measure the gray-scale integrals of the target band and the total protein band by ImageJ. Calculate the proportion of the target protein in the total protein to obtain the purity.

    Purification of FLAG-tagged Proteins

    Materials

    • BeyoMag™ Anti-Flag Magnetic Beads
    • Protein sample
    • 1X TBS
    • 3X Flag Stock Solution (5mg/ml)

    Procedure

    1. Preparation of Anti-Flag Magnetic Beads

    1. Resuspend the Magnetic Beads in the vial (gently pipette for 10 times, do not vortex). Transfer 10-20 μl of Magnetic Beads suspension into a new tube (for 500 μl of protein sample). The amount of beads suspension can be scaled up or down proportionally based on the volume of the protein sample.
      Caution: If using more than 0.2 ml of bead suspension, place the tube into a magnetic stand to collect beads and remove the supernatant.
    2. Add 500μl of 1X TBS to the beads and pipette gently to mix. Place the tube into a magnetic stand to collect the beads against the side of the tube. Remove and discard the supernatant. Repeat this step twice.
    3. Resuspend the Magnetic Beads with 1X TBS at an equal volume to the initial volume of beads suspension taken in step 1.

    2. Protein binding

    1. Add 500 μl of cell lysate to the washed beads, pipette gently to resuspend beads, and incubate for 2 hours at room temperature or overnight at 4ºC while gently rotating the tube on a rotary mixer.
      Caution: Occasional aggregation of magnetic beads during the binding process doesn’t affect experimental results.
    2. Place the tube into a magnetic stand to collect beads against the side of the tube. Remove and discard the supernatant.
      Caution: A small amount of supernatant can be reserved in a clean EP tube for examination of the binding results.
    3. Wash beads with 500μl of 1X TBS and gently pipette to mix. Place the tube into a magnetic stand to collect the beads against the side of the tube. Remove and discard the supernatant. Repeat this step 3 times.
      Caution: The A280 of supernatant can also be measured to determine whether the beads are washed thoroughly. Repeat washing until the A280 is smaller than 0.05.

    3. Elution

    1. Dilute the 3X Flag Stock Solution at 5mg/ml with 1X TBS buffer to a final concentration of 150 μg/ml to obtain 3X Flag elution buffer.
    2. Add 100μl of 3X Flag elution buffer to resuspend the beads by pipetting gently and incubate with gentle shaking or on a rotator for 30-60 minutes at room temperature or 1-2 hours at 4ºC. The elution efficiency can be improved by prolonging the incubation time appropriately or by repeated elution.
    3. Place the tube into a magnetic stand for 10 seconds and transfer the supernatant to a clean EP tube.
    4. For immediate use, keep the eluates at 4ºC; or store at -20ºC or -80ºC for long-term storage.

    Purification of Myc-tagged Proteins

    Materials

    • BeyoMag™ Anti-Myc Magnetic Beads
    • Protein sample
    • 1X TBS
    • 2ml centrifuge tube
    • c-Myc polypeptide solution (150 μg/mL)

    Procedure

    1. Preparation of Anti-Myc Magnetic Beads

    1. Use a pipette to gently stir and resuspend the Anti-Myc magnetic beads. Based on the calculation that 20 μl of magnetic bead suspension is needed for every 500 μl of sample, take an appropriate amount of Anti-Myc magnetic beads and transfer them to a clean 2 ml centrifuge tube. Add 0.5 mL of 1X TBS.
    2. Use a pipette to gently stir and thoroughly resuspend the Anti-Myc magnetic beads. Place them on a magnetic stand and let them separate for 10 seconds. Remove the supernatant.
    3. Repeat step 2 twice.
    4. Resuspend the Anti-Myc magnetic beads with 1X TBS in an amount equivalent to the initial volume.

    2. Purification of the protein sample

    1. Add the corresponding volume of protein sample to the magnetic beads and place them on a rotary mixer. Incubate at room temperature for 2 hours.
    2. Place the sample on the magnetic stand and separate for 10 seconds. Gently aspirate and retain a portion of the supernatant for use in the subsequent purification effect detection, and discard the remaining supernatant.
    3. Add 500 μl of 1X TBS and gently vortex to resuspend the Anti-Myc magnetic beads with a pipette. Place the sample on a magnetic stand and separate for 10 seconds. Then remove the supernatant.
    4. Repeat step 3 twice.
    5. For every 20 μl of the original magnetic beads, add 100 μl of the c-Myc peptide elution solution (150 μg/ml), mix well, and then place it on a rotating shaker for incubation at room temperature for 30 to 60 minutes.
    6. Place the sample on a magnetic stand for 10 seconds for separation. Then transfer the supernatant to a new centrifuge tube.
    7. The supernatant is the purified Myc-tagged protein and should be stored at 4 degrees for future use, or at -20 degrees or -80 degrees for long-term storage.
  • SDS-PAGE

    Materials

    • Ultra Pure Water (ddH2O)
    • SDS-PAGE Gel One-step Super Quick Preparation Kit (Red Stacking Gel) (Beyotime, China)
      • 30% Acr–Bis (29:1)
      • 1M Tris–HCl, pH 8.8
      • 10% SDS (Sodium Dodecyl Sulfate)
      • Gel Polymerization Catalyst
      • 1M Tris–HCl, pH 6.8 (Red color)
    • Protein Sample
    • eStain® L1 Protein Staining System

    Procedure

    1. Gel Casting

    • Use Beyotime SDS-PAGE Gel One-step Super Quick Preparation Kit (Red Stacking Gel) for gel casting.
    • Choose an appropriate acrylamide % for the gels depending on the molecular weight of the target protein according to.
    Table 1. The Optimal Separation range of SDS-PAGE gels at various concentrations
    Gel PercentageMW of target protein (kDa)
    6%50-150
    8%30-90
    10%20-80
    12%12-60
    15%10-40
    • Prepare a 10% Gel Polymerization Catalyst solution with ddH2O or other high-purity water. For example, weigh 0.1 g of Gel Polymerization Catalyst, dissolve it in ultrapure water and make up to 1 mL.
      Caution: The gel polymerization catalyst solution is prone to degradation. It is recommended to aliquot and store at -20ºC, where it typically remains effective for six months.
    • Prepare 5 mL resolving gel mix and 2 mL stacking gel mix.
      Caution: Work carefully in order to avoid direct exposure to toxic acrylamide.
    Table: Resolving Gel
    ReagentsVolume (mL)
    SDS-PAGE One-step Resolving Gel Master Mix5
    10% gel polymerization catalyst0.05
    TEMED Substitute0.002

    Note: The SDS-PAGE One-step Resolving Gel Master Mix should be matched to the MW of target protein in Table 1.

    Table: Stacking Gel
    ReagentsVolume (mL)
    SDS-PAGE One-step Resolving Gel Master Mix5
    10% gel polymerization catalyst0.05
    TEMED Substitute0.002
    • Add 4.5 mL of the resolving gel mix, and then immediately add the stacking gel mix to fill the assembled glass plates. While adding, pay attention to avoiding bubbles, and the liquid surface should remain flat.
      Caution 1: Shake the Stacking Gel Master Mix to mix it well before use.
      Caution 2: When adding the stacking gel, it is important to gently and slowly add it with a 1mL pipette while moving it left and right, instead of pouring it in one spot. This is to prevent the stacking gel from rushing into the resolving gel and disrupting the smoothness of the gel interface.
    • Insert the comb and leave at room temperature (~25℃) until gels are fully solidified (usually within 10-30 minutes).

    2. Sample Preparation

    • According to experimental requirements, lyse cell or tissue samples with appropriate lysis buffers.
    • Protein quantification (optional). To ensure consistent protein loading of each sample, protein concentration of each sample needs to be determined. The compatibility of different protein quantification methods varies greatly for some detergents, reducing agents, or other factors.
    • Preheat the Thermal Block Heater to 95℃.
    • Add SDS sample buffer to the samples to yield a final concentration of 1X.
    • Vortex and briefly spin down samples.
    • Incubate the samples in the heat block for 5 mins at 95°C to fully denature proteins.
      Caution: Samples should always be heated at 95℃. Excessive temperatures (e.g., 100℃) or time (e.g., more than 15 minutes) may result in protein degradation or abnormal coloration of the indicator in the sample loading buffer.
    • After cooling to room temperature, the mixture can be loaded onto gels for electrophoresis.
      Caution: When using a water bath to dissolve BeyoWB™ SDS-PAGE sample loading buffer (5X), store it at room temperature immediately after dissolution to avoid prolonged exposure to the water bath. After use, it should be stored as soon as possible at -20ºC. If necessary, aliquot the loading buffer.

    3. Electrophoresis

    • Measure out 50 mL of BeyoWB™ SDS-PAGE Electrophoresis Buffer (Tris-Gly, 20X) provided in the kit and transfer it into a clean graduated cylinder. Add ultrapure water, deionized water, or distilled water to a final volume of 1L and mix thoroughly to obtain 1.0 L of BeyoWB™ SDS-PAGE Electrophoresis Buffer (Tris-Gly, 1X). The buffer can also be prepared in any required volume. Unused electrophoresis buffer can be stored at room temperature for 2-3 days or at 4℃ for 1-2 weeks.
    • Insert the gel into the running chamber. Secure the gel in the electrophoresis tank and slowly and gently remove the comb.
    • Fill the inner chamber with the electrophoresis buffer and ensure there are no leaks. In the outer chamber, add enough buffer to cover the bottom of the gel. Typically, 400 mL of electrophoresis buffer is sufficient for simultaneous running of two gels, and 800 mL for simultaneous running of four gels.
    • Load an appropriate volume of protein sample prepared. First, add marker into the first lane. And then add protein samples. Gently insert the pipette tip vertically into the sample well for loading. The optimal sample volume can be determined experimentally. Overloading the sample can lead to band distortion and overlay of strong signals. Typically, load 5-20 μL of samples, although the maximum sample volume for each well in the provided precast gel is 30 μL.
    • Close the lid of the electrophoresis tank and insert the power supply plugs into the corresponding power sockets of the electrophoresis unit.
      • If using precast gel, it is recommended to run the electrophoresis at 180 V for 25 minutes. However, the electrophoresis time may vary depending on the electrophoresis tank and ambient temperature. Generally, stop the electrophoresis when the bromophenol blue reaches near the bottom of the gel or when the target protein is expected to be properly separated according to the electrophoresis result of the prestained protein ladder.
      • If using the gel made in step 1, run the electrophoresis at 10 V until all the bands enter the separating gel. Then, run the electrophoresis at 150 V until the bromophenol blue reaches near the bottom of the gel.

    4.Gel Staining

    • Place the gel horizontally on the mesh surface of the gel fixation clamp. Spread a filter paper evenly on the gel, then close the gel fixation clamp.
    • Insert the gel fixation clamp into one channel of the staining machine and start the staining process.
    • When the process finishes, pull out the clamp and take the gel out for photographing.
  • Western Blot

    Materials

    • BeyoWB™ 80 min Electrophoresis, Transfer and Western Blot Kit (Beyotime, China)
      • BeyoWB™ PVDF Membrane (6.6x8.5 cm, 0.45μm)
      • BeyoWB™ Transfer Buffer (10X)
      • BeyoWB™ BeyaECL A Solution
      • BeyoWB™ BeyaECL B Solution
    • QuickBlock™ Western Solution Kit
      • QuickBlock™ Western Blocking Solution
      • QuickBlock™ Western Antibody Dilution Buffer
      • Western Washing Buffer (10X)
      • QuickBlock™ Western Secondary Antibody Dilution Buffer
    • Extra Thick Filter Paper
    • Ultrapure Water
    • 95% Ethanol
    • Anhydrous Methanol
    • His Tag Mouse Monoclonal Antibody
    • HRP-labeled Goat Anti-Mouse IgG(H+L)
    Table 1: Primary Antibody Working Solution
    ReagentsVolume (mL)
    His Tag Mouse Monoclonal Antibody0.005
    QuickBlock™ Western Antibody Dilution Buffer5
    Table 2: Secondary Antibody Working Solution
    ReagentsVolume (mL)
    HRP-labeled Goat Anti-Mouse IgG(H+L)0.010
    QuickBlock™ Western Secondary Antibody Dilution Buffer5

    Procedure

    1. Balance

    • Measure 100 mL of BeyoWB™ Transfer Buffer (10X) and pour it into a clean graduated cylinder. Add ultrapure water to a total volume of approximately 700 mL. Add 200 mL of anhydrous ethanol or 210 mL of 95% ethanol and mix thoroughly. Adjust the final volume to 1 liter with ultrapure water in the graduated cylinder, mix well, and the 1X transfer buffer is ready for use.
    • Wash the gel with transfer buffer. Place the gel in a container, and add 15 mL transfer buffer. Put the container on a horizontal shaker at 40 rpm. Rinse for 5–10 minutes.
    • Cut one PVDF membrane and two extra thick filter paper to the same size of the gel.
    • Put the extra thick filter paper to a container with sufficient transfer buffer.

    2. Activate the PVDF membrane

    • Add approximately 10 mL anhydrous methanol to a container.
    • Use flat-tipped tweezers to hold one corner of the PVDF membrane, positioning it as horizontally as possible on the surface of the anhydrous methanol.
      Caution: Ensure the container is completely dry before adding anhydrous methanol; if not thoroughly dry, pre-rinse with a small amount of methanol.
    • The PVDF membrane will quickly become uniformly semi-transparent and gradually sink into the conditioning solution. The activation typically takes about 2–5 minutes.
    • Remove the PVDF membrane with flat-tipped tweezers and place it into the transfer buffer for a quick rinse of 5–10 seconds.
    • Put the PVDF membrane into another container with sufficient transfer buffer. Put the container on a horizontal shaker at 40 rpm for 1–2 minutes.

    3. Prepare the transfer sandwich in the transfer chamber

    • Place thick filter paper first, then add the PVDF membrane. Trim a small corner at the top right of the membrane to serve as a marker for orientation.
    • Place the gel on top, followed by another piece of filter paper.
      Caution: Removing air bubbles completely is critical for achieving good transfer results. A bubble roller can be used to gently roll out the bubbles at each step.
    • Add 1–2 mL of transfer buffer to the sandwich in the transfer chamber to ensure the filter paper is fully wetted.

    4. Transfer

    • Firmly clamp the transfer sandwich and lock the sandwich with the white slider, ensuring that the sandwich stays in place. Insert the transfer sandwich with the black side facing the black side of the transfer core assembly. Perform the transfer at a constant current of 25V, 1A for 11 minutes at room temperature, without cooling needed.

    5. Membrane Blocking

    • After the transfer is finished, immediately place the membrane into a washing box pre-filled with 15 mL BeyoWB™ Western Wash Buffer. Put the container on a tilting shaker at 20 rpm. Rinse for 1–2 minutes.
    • Remove the wash buffer from the box using a pipette. Add 10 mL BeyoWB™ Blocking Buffer. Put the container on a tilting shaker at 20 rpm. Rinse for 10 minutes.

    6. Primary antibody incubation

    • Remove the Blocking Solution from the box using a pipette. Add 15 mL Primary Antibody Working Solution. Put the container on a tilting shaker at 20 rpm. Rinse for 15-20 minutes.
      Caution: Recover the Primary Antibody Working Solution for future reuse. Recovered antibodies can typically be reused 5–10 times. Store diluted antibodies, including previously used diluted antibodies, at 4°C.
    • Wash the gel with wash buffer 3 times. Each time using 15 mL wash buffer, 3 minutes.

    7. Secondary antibody incubation

    • Add 15 mL Secondary Antibody Working Solution. Put the container on a tilting shaker at 20 rpm. Rinse for 15-20 minutes.
    • Wash the gel with wash buffer 3 times. Each time using 15 mL wash buffer, 3 minutes.
      Caution: Recover the Secondary Antibody Working Solution for future reuse. Recovered antibodies can typically be reused 5–10 times. Store diluted antibodies, including previously used diluted antibodies, at 4°C.

    8. Protein detection

    • Prepare the BeyoECL Working Solution. Each PVDF membrane needs 1.2 mL working solution. Mix 0.6ml of BeyoECL A solution with 0.6ml of BeyoECL B solution to make 1.2 mL of the BeyoECL Working Solution. It is recommended to use it immediately after preparation.

    • Lay a clean plastic wrap on the benchtop. Discard the remaining wash solution in the container, then place the membrane flat on the plastic wrap. Ensure there is no obvious residual wash solution on the membrane surface. If any residue is present, carefully absorb it with lens paper, taking care not to touch the membrane.

    • Add 1.2 mL of the BeyoECL Star Working Solution onto the membrane, ensuring even coverage, and let it sit for 5 minutes.

    • Discard the Working Solution and gently remove excess liquid with absorbent paper. Then proceed with chemiluminescence imaging.

      ​

Micromotor Construction & Estimation

  • Gel Encapsulation Experiment

    Materials

    • 1× PBS (pH 6.8)
    • 1.5% (w/v) Sodium alginate solution
    • Nano calcium carbonate
    • Liquid paraffin containing 0.5% Span 80®
    • Glacial acetic acid (sterile)
    • Acetate buffer (pH ≈ 5.5)
    • Saccharomyces boulardii culture at logarithmic growth phase

    Procedure

    • Centrifuge 50 mL of logarithmic-phase Saccharomyces boulardii culture (1100 × g, 5 min) to collect cells. Wash twice with deionized water, then resuspend in just enough deionized water. Measure OD value and adjust the final OD600 to 1.946.
    • In a sterile 100 mL beaker, add 10 mL sodium alginate solution. Start the digital overhead stirrer at 310 rpm.
    • Mix 1 mL yeast suspension with 10 mL sodium alginate solution to obtain the yeast-containing sodium alginate mixture.
    • Add 0.1 g nano calcium carbonate into the sodium alginate–yeast solution and stir until well dispersed.
    • Add 55 mL liquid paraffin containing 0.5% Span 80 to achieve an aqueous-to-oil phase ratio of 1:5.
    • After emulsifying for 15 min, use a plastic dropper to add 1.38 mL glacial acetic acid dropwise within 30 min, while continuing stirring. From the start of acid addition, continue stirring for 60 min to promote calcium carbonate dissolution and initiate gelation.
    • Washing: Centrifuge at 1100 rpm for 5 min, remove the upper oil phase after microsphere sedimentation. Wash with acetate buffer (optionally containing 1% Tween 80) and centrifuge again. Repeat until no visible oil phase remains.
  • Gel Degradation Test

    Materials

    • Calcium alginate hydrogel microspheres (prepared as described above)

    • Phosphate-buffered saline (PBS, pH 7.4)

    • Acetate buffer (pH 5.0)

    • 1M HCl solution (pH 1.0)

    • Deionized water

    • 1.5 mL Eppendorf (EP) tubes, labeled 1–9

    • Optical microscope

    • Vortex mixer

    Procedure

    • Sample Preparation: Collect equal volumes (e.g., 500 μL) of calcium alginate hydrogel microspheres and transfer them into nine 1.5 mL EP tubes labeled 1–9.
    • Buffer Treatment: Add 1 mL of different buffer solutions to each tube according to the following setup:
      • Tube 1–3: PBS (pH 7.4)
      • Tube 4–6: Acetate buffer (pH 5.0)
      • Tube 7–9: 1M HCl solution (pH 1.0)
    • Mix gently using a vortex mixer to ensure even suspension.
    • Incubate all tubes at 37 °C under static conditions. Record time points at 0 h, 1 h, 3 h, 6 h, 12 h, and 24 h.
    • At each time point, visually inspect and photograph the supernatant turbidity as an indicator of gel disintegration.
    • Microscopic Examination: Take a small aliquot (≈10 μL) from each tube at each time point and observe under an optical microscope (bright field) to assess changes in microsphere integrity and morphology.
  • Scanning Electron Microscopy (SEM) Observation

    Materials

    • Concentrated and purified sodium alginate hydrogel
    • Liquid nitrogen

    Experimental Procedure

    • Pipette a small amount of hydrogel solution onto a copper freezing sample holder.
    • Place the holder onto the manipulator rod and insert it into the sample pretreatment chamber. Add purified liquid nitrogen (filtered with filter paper) while simultaneously applying vacuum (to form supercooled liquid nitrogen).
    • Transfer the sample into the transfer chamber. Once the vacuum levels of the transfer chamber and the sample preparation chamber are consistent, open the intermediate valve and push the transfer rod to move the sample into the preparation chamber (at −145 °C).
    • Use the blade to cut the sample.
    • Maintain the sample at −90 °C for 5 minutes to allow ice sublimation.
    • Perform ion sputtering to coat the sample with a ~3 nm gold layer.
    • Place the sample into the environmental scanning electron microscope (ESEM) for observation.
  • Fabrication of Gel Micromotors Using a Microfluidic Chip

    Materials

    • 2% Sodium Alginate Solution
    • 10% Sodium Carbonate Solution
    • 1% CaCl2 Solution
    • Soybean oil containing 1% Span 80

    Procedure

    figure

    • Contents of Inlets

      • Inlet 1: Soybean oil.
      • Inlet 2: 2% sodium alginate solution.
      • Inlet 3: Sodium carbonate solution with concentrations of 10%.
      • Inlet 4: 1% CaCl2 solution.
      • Inlet 5: Soybean oil.
    • Place on a glass slide and observe morphology under an optical microscope at 10–40× magnification.

    • Flow rates:

      • Inlets 1 and 5: 70–350 μL/h
      • Inlets 2 and 3: 5–25 μL/h
      • Inlet 4: frequency synchronized with droplet cutting rate in the intersection.
  • Micromotor Preparation via Macroscale Emulation

    Materials

    • 2% Sodium Alginate Solution
    • Nano calcium carbonate
    • crystal violet stain
    • 1% CaCl2 Solution

    Procedure

    • Disperse 5 g of nano-calcium carbonate in 50 mL of sodium alginate solution.
    • Load 2% sodium alginate solution and sodium alginate solution containing 10 wt% nano-calcium carbonate into two 1 mL syringes, respectively, and connect the syringe needles to two microfluidic tubes.
    • Add 1% calcium chloride solution into a 50 mL beaker.
    • Use glue to align and fix the two microfluidic tubes, inserting their outlets into the mouth of the beaker.
    • Push the syringes to extrude the two liquids simultaneously, forming Janus droplets, which fall into the calcium chloride solution.
  • Micromotor Propulsion Test in Simulated Gastric Acid Environment

    Materials

    • 1 M HCl solution
    • Gel micromotors

    Procedure

    • Add 400 mL of 1 M HCl solution into a 1000 mL beaker.
    • Place the hydrogel microspheres inside, record a video, and track their motion.

Assays

  • BCA Protein Assay

    Materials

    • BCA Protein Assay Kit
      • BCA Reagent A
      • BCA Reagent B
      • Protein Standard(BSA)
      • BSA Preparation Solution
    • 1×PBS (pH = 7.4)

    Procedure

    1. Preparation of protein standard samples

    1. Add 1.2 ml of the BSA Preparation Solution to a tube containing 30 mg of Protein Standard.

    2. Take an appropriate amount of the 25 mg/ml Protein Standard and dilute it with 1×PBS to reach a final concentration of 0.5 mg/ml.

    2. Configuration of BCA working solution

    1. Based on the sample quantity, prepare an appropriate amount of BCA working solution by adding 50 volumes of BCA Reagent A to 1 volume of BCA Reagent B, and mix thoroughly.
    Table 1: BCA working solution.
    ComponentVolume
    BCA Reagent A5mL
    BCA Reagent B100μL

    Caution: The BCA working solution remains stable at room temperature within 24 hours.

    3. Determination of protein concentration

    1. Add the Protein Standard and 1×PBS to the wells of the 96-well plate according to the quantities specified in the Table 2 below.
    Table 2: Gradient concentration Protein Standard.
    Volume of Protein StandardVolume of 1×PBSFinal Concentration
    0 μL20 μL0 mg/mL
    1 μL19 μL0.025 mg/mL
    2 μL18 μL0.05 mg/mL
    4 μL16 μL0.1 mg/mL
    8 μL12 μL0.2 mg/mL
    12 μL8 μL0.3 mg/mL
    16 μL4 μL0.4 mg/mL
    20 μL0 μL0.5 mg/mL
    1. Add an appropriate volume of the sample to the sample wells of the 96-well plate. If the sample volume is less than 20 µl, add the standard substance diluent to make up to 20 µl.

    2. Add 200 µl of BCA working solution to each well, and incubate at 37°C for 20-30 minutes.
      Caution: When using the BCA method to determine protein concentration, the color will deepen continuously over time. And the color development reaction will accelerate due to the increase in temperature.

    3. Measure the absorbance at A562 using an enzyme detector.

    4. Based on the corrected standard substance concentration and absorbance in the blank, plot a standard curve.

    5. Calculate the protein concentration of the sample based on the standard curve and the volume of the sample used.

  • BeyoBCA Rapid Protein Assay

    Materials

    • BeyoBCA Rapid Protein Assay Kit
      • BCA Reagent A
      • BCA Reagent B
      • BCA Reagent C
      • Protein Standard (BSA)
      • BSA Preparation Solution
    • 1×PBS (pH = 7.4)

    Procedure

    1. Preparation of protein standard samples

    1. Add 1.2 ml of the BSA Preparation Solution to a tube containing 30 mg of Protein Standard.

    2. Take an appropriate amount of the 25mg/ml Protein Standard and dilute it with 1× PBS to reach a final concentration of 10mg/ml.

    2. Configuration of BCA working solution

    1. Based on the sample quantity, prepare an appropriate amount of BCA working solution, and mix thoroughly. The specific preparation method can be found in the Table 1 below.
    Table 1: BCA working solution.
    ComponentVolume
    BCA Reagent A100μL
    BCA Reagent B96μL
    BCA Reagent C4μL

    Caution: The BCA working solution remains stable at room temperature within 30 minutes.

    3. Determination of protein concentration

    1. Add the Protein Standard and 1×PBS to the wells of the 96-well plate according to the quantities specified in the Table 2 below.
    Table 2: Gradient concentration Protein Standard.
    Vial NumberVolume of Protein StandardVolume of 1×PBSFinal Concentration
    A70 μL Protein Standard(10mg/ml)0 μL10 mg/mL
    B35 μL of Vial A35 μL5 mg/mL
    C35 μL of Vial B35 μL2 mg/mL
    D35 μL of Vial C35 μL1 mg/mL
    E35 μL of Vial D35 μL0.5 mg/mL
    F35 μL of Vial E35 μL0.25 mg/mL
    G35 μL of Vial F35 μL0.125 mg/mL
    H0 μL35 μL0 mg/mL
    1. Add an appropriate volume of the sample to the sample wells of the 96-well plate. If the sample volume is less than 10 µl, add the standard substance diluent to make up to 10 µl.

    2. Add 200 µl of BCA working solution to each well, mix well and leave at room temperature (around 25°C) for 5 minutes.

    3. Measure the absorbance at A480 using an enzyme detector.

    4. Based on the corrected standard substance concentration and absorbance in the blank, plot a standard curve.

    5. Calculate the protein concentration of the sample based on the standard curve and the volume of the sample used.

  • Cell Counting Assay

    Procedure

    1. Absorption spectrophotometry method

    1. Preheat the spectrophotometer 40-60 minutes in advance.

    2. Modify the wavelength to 600 nm.

    3. In Mode T, do calibration to 0 at the black cuvette and 100 at the cuvette with the solvent.

    4. Switch to Mode A and measure the OD value of the sample culture.

    5. If the OD value is significantly higher than 0.8, dilute the culture medium appropriately to a range of 0.2 to 0.8 (dilution factor D) and re-determine the value.

    2. BioTech® Epoch 2 Instrument measurement method

    1. Preheat the enzyme label reader 2-3 minutes in advance, and set the protocol and relevant parameters.

    2. Set up two sets of duplicate culture media and the test solution, and add 200 μL to each of the 96-well plates.

    3. If the OD600 value of the sample to be tested exceeds 1.0, then set a suitable dilution gradient of the appropriate concentration.

    3. Blood cell counting plate measurement method

    1. Dilute the yeast culture solution by dd (d=1d = 1 if not diluted)

    2. Add 10 μL drop to the area between the cover glass and the inclined surface of the counting plate to allow the culture medium to seep in and fill the counting chamber completely at one time.

    3. Count the number of cells in the yellow squares in the microscopic count chart, and then calculate the average value mm.

    4. The number of cells in each yellow square should be controlled within 50 to 100 (2 to 3 adhered cells are counted as 1 cell; if more than 4 to 5 adhered cells are present, the yeast solution needs to be diluted again before counting). The range of variation should not exceed 15; otherwise, the cells are considered dispersed unevenly and the solution needs to be re-added for counting.

      figure

      • Cell density in diluent: n(cells/mL)=m×25×104n\mathrm{(cells/mL)}=m×25×10^4

      • Original cell density: N(cells/mL)=d⋅nN\mathrm{(cells/mL)}=d·n

  • Fluorescence Reporting

    Materials

    • PBS
    • Protein Samples
    • 96-well plate

    Procedure

    1. Add 200 μL of each protein sample to the 96-well plate, and add 200 μL of PBS to another well as a control.
    2. Detect the samples using the microplate reader’s default wavelengths (excitation wavelength 488 nm, emission wavelength 528 nm).
    3. Use the fluorescence intensity data provided by the microplate reader to determine the EGFP content in the protein samples, thereby inferring the expression of the exogenous plasmid in the cells.
  • Genotype Identification

    Materials

    • Yeast Colony PCR Kit with Alkaline Lysis
      • Yeast Lysis Buffer
      • Neutralization Buffer
      • Yeast Colony PCR Mix (Green, 2X)
    • 1M sobitol
    • 100mM EDTA
    • 14nM β-mercaptoethanol
    • PCR Master Mix
    • Agarose
    • 1×TAE
    • DNA Marker
    • M5 GelRed Plus nucleic acid dye (10000×)

    Procedure

    1-1. Yeast Colony PCR

    1. Add 10 µl of Yeast Lysis Buffer to each tube. Use a sterile pipette tip to pick a yeast monoclonal colony (0.2-1 mm in size) and transfer it into a PCR tube containing 10 µl of Yeast Lysis Buffer. Mix by pipetting or vortexing, and centrifuge briefly to collect the liquid at the bottom of the tube. Simultaneously, label the colony on the plate.

    2. Heat the tube at 95°C for 5 minutes in a PCR machine to fully release the yeast DNA. Then add 10 µl of Neutralization Buffer and mix thoroughly.

    3. Prepare the PCR mix on ice, and then start PCR with the steps below.

      Table: PCR System Composition
      ReagentVolume
      Ultrapure Water7.4 μL
      primer mix2×0.8 μL
      Yeast Colony PCR mix10 μL
      template1 μL
      total20 μL
      Table: PCR Process Overview
      StepsTemperatureTime
      Initial Denaturation94°C3min
      Denaturation94°C30s
      Annealing55°C30s
      Extension72°C1min/kb
      Go to STEP2 for 30 cycles
      final Extension72°C10min
      hold4°C

    1-2. Genome Extraction & PCR

    Table: Yeast Lysis Buffer
    ComponentConcentration
    Sorbitol1M
    EDTA100nM
    β-mercaptoethanol14nM
    1. Centrifuge to collect yeast pellet. Resuspend in 600 μL of yeast lysis buffer, add 200 U of lyticase, and incubate at 30°C for 30 minutes. Centrifuge at 300g for 10 minutes to collect the precipitate, and discard the supernatant. Resuspend the precipitate in 180μL of Sample Lysis Buffer A.

    2. Add 20 μL of Proteinase K and vortex to mix. Incubate in a 55°C water bath until complete lysis is achieved.

    3. Vortex vigorously at maximum speed for 15s. Add 200 μL of Sample Lysis Buffer B and vortex to mix. Incubate at 70°C for 10 minutes. Add 200 μL of absolute ethanol and vortex to mix.

    4. Transfer the mixture from step e to a DNA purification column. Centrifuge at 6000g for 1min. Discard the flow-through in the collection tube.

    5. Add 500 μL of Wash Buffer I and centrifuge at 6000g for 1min. Discard the flow-through in the collection tube.

    6. Add 600 μL of Wash Buffer II and centrifuge at 12,000rpm for 1 min. Discard the flow-through in the collection tube.

    7. Centrifuge again at 12,000rpm 1 min to remove residual ethanol.

    8. Place the DNA purification column into a clean 1.5 mL microcentrifuge tube. Add 30μL of Elution Buffer and let it stand at room temperature for 1–3 min. Centrifuge at 12,000 rpm for 1 minute. The resulting liquid is the purified total DNA. Use the Nanodrop to measure the concentration of total DNA.

    9. Prepare the PCR mix, and then start PCR with the steps below

      Table: PCR System Composition
      ComponentVolume
      Water(21-x) μL
      Templatex μL (1μg)
      Primer Mix2×2 μL
      PCR Master Mix25 μL
      total50 μL
      Table: PCR Process Overview
      StepsTemperatureTime
      Initial Denaturation92°C3min
      Denaturation92°C30s
      Annealing55°C30s
      Extension68°C1min/kb
      Go to STEP2 for 30 cycles
      final Extension68°C10min
      hold4°C

    2. Agarose Gel Electrophoresis

    1. Weigh 0.16 g of agarose and dissolve it in 1× TAE buffer to a total volume of 20 mL. Heat the mixture in a microwave until completely dissolved. Add 2 μL of M5 GelRed Plus nucleic acid dye (10,000×), mix gently, and pour the solution into a medium-sized gel tray. Insert a comb and allow the gel to solidify at room temperature.
    2. During loading, add DNA marker into one well on the side of the gel. Run electrophoresis at 150 V for approximately 30 min. Observe the electrophoresis results using a gel imaging system and determine the cell genotype based on the band pattern.
  • Modified Immunocytofluorescence (ICF) Assay

    Materials

    • PLL storage solution(10X)
    • 0.2 μm membrane filter
    • Immunol Staining Wash Buffer
    • Immunol Staining Fix Solution
    • QuickBlock™ Blocking Buffer for Immunol Staining
    • QuickBlock™ Primary Antibody Dilution Buffer for Immunol Staining
    • QuickBlock™ Secondary Antibody Dilution Buffer for Immunofluorescence
    • Primary antibody
    • Secondary antibody
    • Calcofluor White (5mM, 200X)
    Table: PLL storage solution(10X)
    ComponentAmount
    poly-L-lysine5mg
    ddH2_2O5ml

    Caution: Dissolve compounds thoroughly. Store at -20℃.

    Procedure

    1. Equipment Preparation

    1. Prepare the PLL slides: In the petri dish, immerse the new clean slides in the PLL working solution at room temperature for 5 minutes (1-2 mL per slide), then dry them in a 60℃ oven for 1 hour and leave them at room temperature overnight for drying.

      Caution: If necessary, clean the slides with 70% ethanol containing 1% HCl.

    2. Sample Preparation

    1. Dilute the PLL stock solution 10 times and filter sterilize it through a 0.2 μm membrane filter to obtain the PLL working solution.

      Caution: Use immediately after preparation. Store it at 4℃ for a short period.

    2. Cultivate 5 ml of yeast expressing protein A to the early stage of logarithmic growth. (106^6~10^7^ cells/ml)

    3. Centrifuge at 5000×g for 1 minute, then discard the supernatant. Wash with 1×PBS (pH=7.4).

    4. Repeat step 2 twice.

    5. Add 1 mL of cold immunostaining fixative, and fix at 4℃ for 10 minutes or longer.

    6. Centrifuge at 5000×g for 1 minute, then discard the supernatant. Wash with the Immunol Staining Wash Buffer for 5 minutes.

    7. Repeat step 5 twice.

    8. Centrifuge at 5000×g for 1 minute. Discard most of the supernatant. Keep approximately 50 μl. Place it on a PLL slide and let it air dry slightly until the cells do not move randomly.

    3. Blocking

    1. Add an appropriate amount (about 1-2 mL per slide) of QuickBlock™ Blocking Buffer for Immunol Staining to immerse the slide.
    2. Slowly shake it on a side-shaking incubator for 15 minutes.

    Caution: From the beginning of the blocking process, it is essential to ensure that the samples are kept moist to prevent them from drying out. Otherwise, a very high background level will be easily generated.

    4. Protein B Incubation

    1. Use the QuickBlock™ Primary Antibody Dilution Buffer for Immunol Staining to dilute the protein B, obtaining the protein B working solution. Approximately 1 mL is needed for each sample.

    2. Remove the sealing solution from slides and carefully absorb the remaining liquid along the edges using absorbent paper. Immediately add the protein B working solution, and gently shake the mixture at room temperature or 4°C on a rotator for 1 hour.

      Caution: If the result is not satisfactory, the sample can be gently shaken at 4℃ and incubated overnight.

    3. Add the Immunol Staining Wash Buffer, and gently shake it on the side-shaking incubator for 5 minutes. After removing the wash buffer, add new wash buffer again and shake for another 5 minutes. It should be washed twice.

      Caution: If the background color is still too high, appropriately extend the washing time and increase the number of washes.

    5. Primary Antibody Incubation

    1. Dilute the primary antibody with the QuickBlock™ Primary Antibody Dilution Buffer to obtain the primary antibody working solution. Approximately 1 mL of the working solution is needed for each slide.

    2. Remove the sealing solution from slides and carefully absorb the remaining liquid along the edges using absorbent paper. Immediately add the primary antibody working solution, and gently shake the mixture at room temperature or 4°C on a rotator for 1 hour.

      Caution: If the result is not satisfactory, the sample can be gently shaken at 4℃ and incubated overnight.

    3. Recycle the primary antibody.

    4. Add the Immunol Staining Wash Buffer, and gently shake it on the side-shaking incubator for 5 minutes. After removing the wash buffer, add new wash buffer again and shake for another 5 minutes. It should be washed for 3 times.

      Caution: If the background color is still too high, appropriately extend the washing time and increase the number of washes.

    6. Secondary Antibody Incubation

    1. Dilute the secondary antibody with the QuickBlock™ Secondary Antibody Dilution Buffer for Immunofluorescence. Adjust the dilution ratio appropriately based on the intensity of the fluorescence. Approximately 1 mL of the working solution is needed for each sample.

    2. Discard the washing solution and carefully absorb the remaining liquid with absorbent paper along the edges. Immediately add the diluted secondary antibody working solution, and gently shake it at a side swing shaker at room temperature or 4°C for 1 hour.

    3. Recycle the secondary antibody.

    4. Add the immunostaining Staining Wash Buffer, and gently shake it on the side-shaking incubator for 5 minutes. Keep in dark place. After removing the wash buffer, add new wash buffer again and shake for another 5 minutes. It should be washed for 3 times.

      Caution: If the background color is still too high, appropriately extend the washing time and increase the number of washes.

    7. Calcofluor White counterstaining

    1. Dilute the Calcofluor White stock solution with ddH2_2O at a ratio of 1:200. According to the intensity of the fluorescence, the dilution ratio can be appropriately increased or decreased. Approximately 1 mL of working solution is needed for each piece.
    2. Discard the washing solution and carefully blot the edges with absorbent paper to dry them. Then, immediately add the diluted CFW staining solution and perform the staining process for 10 minutes.
    3. (Optional) Add the immunostaining washing solution, then gently shake it on a rotator table. Keep in dark place for 2 to 3 minutes for washing, and then remove all the washing solution.

    8. Fluorescence Detection

    1. Drop a drop of anti-fluorescence quenching mounting solution onto the slide, then cover it.

      Caution: When covering the slide, try to avoid bubbles. Do not allow the slide to move relative to the sample.

    2. Observe under a fluorescence microscope.

    3. If preservation is required, cover the specimen with paraffin or nail polish and store it at -20℃.

  • Modified Co-Immunoprecipitation (Co-IP) Assay

    Materials

    • Extracted HopQ protein

    • BeyoMag™ His-tagged protein purification agarose magnetic beads(IDA-Ni)

    • Ultra pure water

    • 1xTBS

      Table: The components of 1×TBS (PH=7.25-7.55) .
      ConcentrationComponent
      50 mmol/LTris-HCl
      150 mmol/LNaCl
    • Elution Buffer

      Table: The components of Elution Buffer.
      ConcentrationComponent
      10 mmol/LTris-HCl
      500 mmol/LNaCl
      • Filter with a 0.22 μm filter membrane and store at 4℃ for future use.
    • Binding/Wash Buffer

      Table: The components of Binding/Wash Buffer.
      concentrationComponent
      10 mmol/LTris-HCl
      500 mmol/LNaCl
      500 mmol/LImidazole
      • Filter with a 0.22 μm filter membrane and store at 4℃ for future use.
    • 20% Ethanol

    • 5mg/ml c-Myc Peptide solution

    • Primary Antibody: His Tag Mouse Monoclonal Antibody

    • Secondary Antibody: Garlic peroxidase-labeled goat anti-mouse IgG(H+L)

    Procedure

    1. Purify HopQ Protein

    1. Preparation of BeyoMag™ His-tagged Protein Purification Agarose Magnetic Beads (referred to as IDA-Ni Magnetic Beads)
      • Gently resuspend the IDA-Ni magnetic beads with a pipette.
      • Calculate the amount of magnetic bead suspension needed based on 1 mL of suspension for every 5-10 mg of target protein (with a molecular weight of approximately 60 kD). Transfer an appropriate amount of IDA-Ni magnetic beads to a clean centrifuge tube, and remove the supernatant by magnetic separation.
      • Add an equal volume or a slightly larger volume of Binding/Wash Buffer to wash the magnetic beads.
      • Use a pipette to gently agitate and resuspend the IDA-Ni magnetic beads. Place them on the magnetic stand (FMS012/FMS024) and let them separate for 10 seconds. Remove the supernatant. Repeat this process twice.
    2. Binding
      • Add protein to equilibrated beads and incubate at room temperature on a rotary mixer for 20 minutes.
      • Place on the magnetic rack and let it separate for 10 seconds. Remove the excess supernatant.
      • Add 2 ml of Binding/Wash Buffer and gently pipette to resuspend the IDA-Ni magnetic beads.
      • Place on the magnetic rack and let it separate for 10 seconds. Remove the supernatant. Repeat this washing process three times.
    3. Washing
      • Add 0.5 ml of Elution Buffer, gently invert the centrifuge tube several times.
      • suspend and incubate for 5 minutes, perform magnetic separation, and collect the eluate into a new centrifuge tube.
      • Repeat the above steps once.

    2. Yeast co-culture

    1. Select a single colony of the positive yeast strain C1ND and inoculate it into 5 mL of LB medium (containing 100 μg/mL Amp) for overnight cultivation at 37°C.

    2. The overnight culture is inoculated at a ratio of 1:100 into 100 mL of LB (containing 100 μg/mL Amp), and then culture at 37°C and 200 rpm until the OD600 reach 0.5-0.6.

    3. Add IPTG to achieve a final concentration of 0.5 mM, take three 15mL centrifuge tubes, and aliquot 10 mL of the bacterial solution into each tube.

    4. Three centrifuge tubes are labeled and separately added with the purified product of HopQ. Incubate the cultures for 4-24 hours.

      Table: The handling method of Tubes.
      LabelComponent
      Tube A1mL HopQ protein
      Tube B3mL HopQ protein
      Tube C5mL HopQ protein

    3. Lysis

    1. Centrifuge at 12000g for 2 minutes at 4°C. Add 3 μL of protease inhibitor.
    2. Resuspend the cells with 0.3 ml of BeyoLytic™ bacterial activity protein extraction reagent. Incubate at room temperature for 15 minutes.
    3. Harvest soluble proteins by centrifugation at 12000g for 5 minutes at 4°C.

    4.Pull down

    1. Preparation of Anti-Myc Beads.
      • Blot the Anti-Myc magnetic beads and add 1X TBS until the final volume reaches approximately 0.5 mL. Place on the magnetic rack and let it separate for 10 seconds. Remove the supernatant. Repeat this process twice.
      • Using 1X TBS to resuspend the Anti-Myc magnetic beads according to the initial volume.
    2. Binding and Washing
      • Add Anti-Myc magnetic beads in a ratio of 10 μL or 20 μL per 500 μL of protein sample to the sample, and then place it on a shaking incubator or a rotary mixer.
      • Incubate at room temperature for 2 hours or at 4°C overnight.
      • Place on the magnetic rack and separate for 10 seconds. Retain a portion of the supernatant for testing the effect of immunoprecipitation, and discard the rest of the supernatant.
      • Add 500 μl of 1X TBS and gently pipette to resuspend the Anti-Myc magnetic beads. Place on a magnetic stirrer and let it separate for 10 seconds. Remove the supernatant.
      • Repeat this washing process three times.
    3. Elution
      • For every 10-20 μL of the original magnetic beads, add 100 μL of 3× c-Myc peptide elution solution (150 μg/ml), mix well, and then place it on a shaking incubator or a rotary mixer at room temperature for 30-60 minutes.
      • Place on the magnetic rack and separate for 10 seconds. Transfer the supernatant to a new centrifuge tube.
      • The eluted Myc-tagged protein should be stored at 4°C for future use, or at -20°C or -80°C for long-term preservation.

    5. analysis

    1. Perform SDS-PAGE (using 4% precast gradient gel, Bio-RAD).
    2. Analyze the resolved proteins by performing a Western Blot using His Tag Mouse Monoclonal Antibody.
    3. Use secondary antibody(Garlic peroxidase-labeled goat anti-mouse IgG) for detection.
    4. Based on the known molecular weights of HopQ and C1ND, determine the rationality of the position where the interaction bands appear.
  • Pull-down Assay

    Materials

    • Protein sample

    • Anti-Myc Magnetic Beads

    • c-Myc peptide elution buffer

    Procedure

    1. Preparation of Anti-Myc Magnetic Beads

    • Gently resuspend the Anti-Myc beads using a pipette. Transfer an appropriate volume of bead suspension (10 μL or 20 μL per 500 μL of sample) into a clean microcentrifuge tube. Add 1× TBS to a final volume of approximately 0.5 mL.

    • Gently pipette up and down to completely resuspend the beads. Place the tube on a magnetic rack for 10 seconds and discard the supernatant. Repeat this wash step twice.

    • Resuspend the beads in 1× TBS to the original volume.

    2. Immunoprecipitation

    • Bead incubation: Add Anti-Myc beads to the protein sample at a ratio of 10 μL or 20 μL of bead suspension per 500 μL of protein sample.

    • Incubate in a rotating mixer or nutator at room temperature for 2 hours, or overnight at 4°C.
      Note: Bead aggregation or sheet-like appearance during incubation is normal and does not affect the result.

    • Magnetic separation: After incubation, place the tube on a magnetic rack for 10 s. Save a portion of the supernatant to assess immunoprecipitation efficiency, discard the rest.

    • Wash: Add 500 μl of 1× TBS and gently resuspend the beads by pipetting. Place on the magnetic rack for 10 s and discard the supernatant. Repeat this wash step three times.

    3. Elution

    • Preparation of c-Myc peptide elution buffer solution: Mix 30 μL of 5 mg/mL c-Myc peptide solution with 970 μL of sterile water to obtain 1 mL of 150 μg/mL elution buffer.

    • For every 10–20 μL of original bead volume, add 100 μL of 3× c-Myc peptide elution buffer (150 μg/mL). Mix gently and incubate in a rotating mixer or nutator at room temperature for 30–60 minutes, or at 4°C for 1–2 hours. To improve elution efficiency, extend the incubation time or perform repeated elution.

    • After incubation, place the tube on a magnetic rack for 10 s and transfer the supernatant to a new microcentrifuge tube. The supernatant contains the eluted Myc-tagged protein.

    • Store the eluted Myc-tagged protein at 4 °C for short-term use, or at −20 °C for long-term storage.

  • Biofilm Staining

    Materials

    • M63 medium
    • 0.1% crystal violet solution
    • 30% acetic acid aqueous solution
    • AiiA protein solution
      • AiiA protein dissolution buffer (10 mM Tris-HCl, 1 mM EDTA, 6% trehalose, pH 8.0)
      • AiiA protein dissolution solution (1 μg/μL)
      • AiiA protein working stock solution (20 μg/mL)

    Procedure

    1. Inoculum Preparation

    • Inoculate overnight cultures of Pseudomonas aeruginosa in TSB at a 1:50 ratio into fresh M63 medium. Inoculate Saccharomyces cerevisiae and Saccharomyces boulardii at a 1:20 ratio into M63 medium. For yeast, centrifuge at 5,000 × g for 1 minute, remove the supernatant, and resuspend in an equal volume of M63 medium. Repeat this washing step three times in total.

    2. Time-Course Biofilm Growth

    • Take a pre-sterilized 96-well plate and add 50 μL of diluted Pseudomonas aeruginosa culture to wells A1-A6, B1-B6, and C1-C6.
    • Add 50 μL of sterile water to wells A1-A6, and mix by pipetting.
    • Add 50 μL of diluted Saccharomyces cerevisiae culture to wells B1-B6, and mix by pipetting.
    • Add 50 μL of diluted Saccharomyces boulardii culture to wells C1-C6, and mix by pipetting.
    • Seal the 96-well plate with Parafilm in a biosafety cabinet and incubate at 37°C for the corresponding time points (4h, 8h, 12h, 16h, 20h, 24h).

    3. Biofilm Staining and Washing

    • Invert the 96-well plate and gently tap to remove the liquid.
    • Use the lid of a large pipette tip box or another container as a washing basin. Rinse it thoroughly and fill it with an appropriate amount of ultrapure water. Slowly immerse the 96-well plate into the water, shake gently, remove, and tap to discard the water. Repeat the washing step once more (change the water for the second wash).
    • Add 125 μL of 0.1% crystal violet solution to each well and incubate at room temperature for 15 minutes.
    • Wash the plate four times, then tap it thoroughly dry on a stack of paper towels (tap firmly).
    • Place the plate upside down to air dry (for several hours to overnight, until completely dry). After drying, take a photograph of the plate.
    • Dissolve and quantify the crystal violet:
      • Add 125 μL of 30% acetic acid aqueous solution to each well and incubate at room temperature for 15 minutes.
      • Transfer 125 μL of the dissolved crystal violet-acetic acid solution to a new 96-well plate (to allow for margin, uniformly take 100 μL of the solution and convert the absorbance proportionally based on volume).
      • Add 100 μL of 30% acetic acid solution to four wells as control wells, and measure the absorbance at 550 nm.
  • GPCR Function Validation

    Materials

    • SD-His-Ura liquid medium
    • SD-His liquid medium
    • Sterile 1×PBS
    • 100 mM dATP stock solution
    • Yeast cultures
    Table: Histamine gradient solutions
    LabelHistamine Concentration
    00
    130 nM
    2120 nM
    3600 nM
    43 μM
    515 μM

    Procedure

    Note: Maintain sterile conditions throughout the experiment.
    While the biosafety cabinet is under UV sterilization, microplate reader settings can be pre-adjusted.

    1. Preparation of Histamine Gradient

    • Label histamine gradient solutions from high to low concentration as 4, 3, 2, and 1; PBS buffer serves as solution 0.

    2. Preparation of dATP Gradient

    • Mix 8 μL of 100 mM dATP stock solution with 92 μL of PBS; label as solution 3.
    • Dilute 50 μL of solution 3 twofold with PBS; label as solution 2.
    • Dilute 50 μL of solution 2 twofold with PBS; label as solution 1.
    • PBS buffer serves as solution 0.

    Note: Store the remaining dATP stock solution at −20 °C after use.

    3. Yeast Culture and Sample Addition

    • Saccharomyces cerevisiae strains were pre-cultured overnight in SD medium
    • Gently resuspend cells before use.
    • Add 140 μL of yeast suspension and 10 μL of the designated reagent to each well according to the layout.

    4. Fluorescence Detection

    • Add 200 μL of each protein sample to the 96-well plate, and add 200 μL of PBS to another well as a control.
    • Detect the samples using the microplate reader’s default wavelengths (excitation wavelength 488 nm, emission wavelength 528 nm).
    • Use the fluorescence intensity data provided by the microplate reader to determine the EGFP content in the protein samples, thereby inferring the expression of the exogenous plasmid in the cells.

Materials & Methods


Delivery System

Construction of Micromotors via Emulsification Method
Yeast Gel Preparation

The yeast gel encapsulation was performed using an emulsification/internal gelation method. Saccharomyces boulardii CNCM Ⅰ-745 was first cultured overnight at 30 °C and 250 rpm in 50 mL of YPD medium in an Erlenmeyer flask. The culture was then diluted to an OD₆₀₀ of 1.2, washed with deionized water, and centrifuged at 1100 g to remove residual medium.

For encapsulation, 4.5 g of sodium alginate (Energy Chemical, China) was dissolved in 300 mL of deionized water in a 500 mL blue-cap bottle, shaken thoroughly, and labeled as “1.5% (w/v) SG-300.” The solution was sterilized at 121 °C for 15 min using an autoclave. Subsequently, 1 mL of yeast suspension was mixed with 10 mL of the 1.5% sodium alginate solution, followed by the addition of 0.1 g of nano-sized calcium carbonate (MREDA, China). The mixture was stirred continuously at 310 rpm.

An emulsion was then prepared by mixing the aqueous phase with 55 mL of liquid paraffin (MREDA, China) containing 0.5% Span 80® (Konoscience, China) at an oil-to-water phase ratio of 5:1. After 15 min of emulsification, 1.38 mL of glacial acetic acid (TGREAG, China) was added dropwise over 30 min to initiate internal gelation. The mixture was stirred for an additional 60 min to form stable yeast-loaded hydrogel microspheres. The resulting microspheres were washed with an acetate buffer (pH 5.5) prepared from acetic acid and anhydrous sodium acetate (MREDA, China) to remove residual oil.

pH Stability Test

For each tube, 1 mL of buffer solution was added as follows: tubes 1–3 received phosphate-buffered saline (PBS, pH 7.4; MACKLIN, China), tubes 4–6 received acetate buffer (pH 5.0) prepared using anhydrous sodium acetate (MREDA, China) and glacial acetic acid (TGREAG, China), and tubes 7–9 received 1 M hydrochloric acid solution (pH 1.0).

Construction of Micromotors via Microfluidic Method
System Construction and Material Preparation

A PDMS-glass hybrid microfluidic chip was fabricated using soft lithography to construct a platform for targeted gastric drug delivery. The process began with the preparation of an SU-8 patterned mold on a silicon wafer. In collaboration with DxFluidics, two microfluidic chips with five inlets were produced, specifically designed for generating Janus microspheres. The chip has a thickness of 3 mm, inlet holes of 0.5 mm, and is bonded to a 1 mm glass substrate.

Reagent Preparation and Microfluidic Configuration for Yeast Encapsulation

Analytical balance was used to precisely weigh the chemicals for the engineered yeast encapsulation system. Sodium alginate solution (2% w/w) was prepared by dissolving 6.00g of sodium alginate (Energy Chemical, China) in 300mL of deionized water within a 500mL blue-cap bottle, followed by stirring dissolution in an 80°C water bath for 30 minutes. After thorough dissolution, the suspension was sterilized via autoclaving at 121°C for 15 minutes. The solution was then mixed with Saccharomyces boulardii CNCM Ⅰ-745 at a concentration of 10⁸ cells/mL to create the yeast-alginate suspension. Simultaneously, 10% sodium carbonate solution and 1% calcium chloride solution were prepared using anhydrous sodium carbonate (TGREAG, China) and anhydrous calcium chloride (XILONG SCIENTIFIC, China). The chip was placed on the stage of an inverted microscope, and flow rates were controlled via a five-channel syringe pump as follows:

shiyitu

Figure: Schematic of the microfluidic method.

tuzhi

Figure: Design of the microfluidic chip.

  • Inlet 1: Soybean oil at 150μL/h (continuous phase)
  • Inlet 2: Engineered yeast-alginate suspension (2% sodium alginate, 10⁸ cells/mL) at 80μL/h
  • Inlet 3: 10% sodium carbonate solution (or 5%) at 80μL/h
  • Inlet 4: 1% CaCl₂ solution at 100μL/h (cross-linking agent)
  • Inlet 5: Soybean oil at 150μL/h (sheathing flow)

A stable laminar flow of yeast-alginate suspension and sodium carbonate solutions was formed at the T-junction, and subsequently segmented into bicomponent droplets by the oil phase at the cross-junction, creating the foundation for asymmetric microsphere formation.

Gelation, Collection, and Functional Validation of Gastric Delivery Microspheres

A 1 M HCl solution was prepared by diluting concentrated hydrochloric acid (6 M HCl, HUSHI, China) with deionized water. A 1 M hydrochloric acid solution was used to simulate the gastric acid environment. Gel-based micromotors were employed as the test samples. In a typical experiment, 400 mL of the 1 M HCl solution was added to a 1000 mL beaker to serve as the reaction medium. The hydrogel micromotors were then introduced into the solution, and their motion behavior was recorded using a digital camera. The propulsion and trajectory of the micromotors were subsequently analyzed by tracking their movement from the recorded videos.

Adhesion System

To validate the interaction between our adhesion target, HopQ, and our adhesion molecule, C1ND, we established a series of experiments covering protein expression in E. coli, purification, and subsequent interaction assays including co-immunoprecipitation and immunocytochemistry.

Expression and Analysis of C1ND
Plasmid Transformation

Plasmids encoding the adhesion system components were transformed into chemically competent E. coli DH5α cells (Juhemei, China). Single colonies were cultured, and plasmids were then extracted using the Plasmid Miniprep Kit (Beyotime, China). The plasmid is then transformed into Saccharomyces cerevisiae BY4741 using the Competent Cell Preparation and Transformation Kit for Saccharomyces Cerevisiae(Beyotime, China).The transformed culture was plated onto SD-Ura selective agar plates and incubated in a 30°C constant temperature incubator for 2 days until single colonies appeared.

Protein Expression

Pick a single positive colony and inoculate it into 10 mL of the SC-Ura+Glu activation medium overnight. Inoculate an appropriate volume of the culture into 100 mL of the SC-Ura selective medium to achieve an initial OD600 between 0.2 and 0.4. Add 10 mL of the 30% galactose-raffinose mixture(Macklin, China).Induce at 30°C with shaking at 250 rpm for 18-20 hours.

Expression and Analysis of HopQ
Plasmid Transformation

Plasmids encoding the adhesion system components were transformed into chemically competent E. coli DH5α cells (Juhemei, China). Single colonies were cultured, and plasmids were then extracted using the Plasmid Miniprep Kit (Beyotime, China). The expression plasmid was transformed into E. coli BL21(DE3) competent cells (Beyotime, China).

Protein Expression

A 10 mL overnight culture of the transformed BL21(DE3) was inoculated into 300 mL of LB medium with 100 µg/mL ampicillin. The culture was grown at 37°C, 200 RPM, until OD₆₀₀ reached 0.5-0.6. Expression was induced with 0.5 mM IPTG for 14-16 hours.

Protein Extraction and Purification

Centrifuge the cell culture at 5000 xg, 4°C, for 10 min. Discard the supernatant. Resuspend the pellet in LB medium and repeat the centrifugation step. Calculate the cell wet weight by weigh the empty tube and the tube containing the cell pellet. For every gram of the cell pellet, add 30 mL of lysis buffer which contains 60 mg Lysozyme (Beyotime, China), 30 mL Active Bacterial Protein Extraction Reagent (Beyotime, China), 300 µL 100x His-Tag Compatible Protease Inhibitor Cocktail (Beyotime, China), and 6 µL BeyoZonase Super Nuclease (Beyotime, China).Using BeyoMag™ His-tag Protein Purification Agarose Magnetic Beads (IDA-Ni) (Beyotime, China) to purify HopQ protein.

Co-Immunoprecipitation (Co-IP) and Western Blot Analysis
Protein-Yeast Interaction

S. cerevisiae cells expressing C1ND were cultured to an OD₆₀₀ of 1.0-2.0, Following incubation, harvest the yeast cells by low-speed centrifugation at 3,000 x g for 5 min at 4 °C, discard the supernatant. Wash the yeast cell pellet twice with washing buffer to remove residual medium. Resuspend the cells by adding 450 µL of washing buffer to each tube of yeast pellet. Add 5–10 µg of purified HopQ protein to each yeast tube. Incubate all tubes on a rotating shaker at 4 °C with gentle agitation for 2−4 hours.

Yeast Cell Lysis

For each 50mg cell pellet, add 500 µL of lysis buffer which contains 1.4 µL of β-mercaptoethanol (BME), 7 µL of 100x Protease Inhibitor Cocktail, 2000 U of Lyticase. Resuspend the cell pellet by gentle pipetting.

The final soluble protein sample will be analyzed via SDS-PAGE and Western Blotting to confirm protein identity and quantity. Samples will then be loaded onto the gel and separated by electrophoresis according to standard procedures.

Immunocytofluorescence (ICF) Assay

S. cerevisiae cells expressing C1ND (and empty vector controls) were cultured, harvested, and fixed with Immune Staining Fixation Solution (Beyotime, China). The fixed cells were adhered to microscope slides pre-coated with Poly-L-lysine (Yuanye, China). Slides were blocked with QuickBlock™ Immune Staining Blocking Buffer (Beyotime, China). Purified HopQ protein was then incubated with the cells for 1 hour. After washing, bound HopQ was detected by incubating with a primary His Tag Mouse Monoclonal Antibody (Beyotime, China) (1:500 dilution) for 1 hour. Slides were washed and incubated with a secondary Cy3-conjugated Goat Anti-Mouse IgG (H+L) (Beyotime, China) (1:1000 dilution) for 1 hour in the dark. The yeast cell wall was counterstained with Calcofluor White stain (Yuanye, China). Slides were mounted and observed under a fluorescence microscope.

Sensory System

Plasmid Construction

Coding sequences for GPCRs and GPCR-P2A-Protein constructs were PCR-amplified from cloning plasmids (human GPCRs) or synthesized (chimeric GPCRs and terminal complexes), and then inserted in the expression vector pESC-HIS-pGAP-αMF by In-fusion cloning. Coding sequence for chimeric G-proteins were synthesized and inserted in the expression vector pESC-URA-MatRep-pGAP by In-fusion cloning.

PCRs were performed using BeyoFusion PCR Master Mix (2X) (Beyotime, China). The PCR product was run on a 1% agarose gel in 1x TAE buffer, cut out, and extracted using the DNA Gel Extraction Kit (Beyotime, China).The In-fusion assembly was conducted in 10 µL total volume with 10µL of 2x ClonExpress Ultra One Step Cloning Kit V3 (Vazyme Biotech, China).

In-fusion products were respectively transformed into Escherichia coli DH5α competent cells. Transformants were selected using colony PCR with testing primers. Plasmids were then extracted from these positive clones and verified by sequencing to ensure the sequences were 100% correct, The matched plasmids were then transformed into the chassis yeast strain using Competent Cell Preparation and Transformation Kit for Saccharomyces Cerevisiae (Beyotime, China), selected, and scaled-up for further tests.

Schematic of synthesis

Figure: Schematic of synthesis. This figure illustrates the entire process of assembling sensory system components from the initial sequence. The vectors are highlighted in blue boxes, with the PCR primers used for each sequence assembly displayed in the gray boxes above the arrows. The final synthesized components are shown in orange-yellow boxes. The first row, from left to right, demonstrates the synthesis of chimeric GPCRs, chimeric G proteins, and human GPCRs. The second row, from left to right, demonstrates the synthesis of knockout plasmids, modified vectors for reporter genes, and terminal complexes.

GPCR function validation

The experiment utilized SD-His-Ura and SD-His liquid media to culture S. cerevisiae transformed with different plasmid combinations. Sterile 1× PBS (Beyotime, China) and 100 mM dATP(Beyotime, China) were prepared, along with histamine(Innochem, China) gradient solutions at concentrations of 0, 30 nM, 120 nM, 600 nM, 3 μM, and 15 μM (labeled as 0-5), and dATP gradient solutions (prepared by mixing 8 μL of 100 mM dATP with 92 μL PBS to obtain Solution 3, followed by twofold serial dilution to obtain Solutions 2 and 1, with PBS as Solution 0).

The entire experiment was performed under sterile conditions, with the enzyme plate reader pre-adjusted in the UV-sterilized biosafety cabinet. After overnight pre-cultivation of the yeast strains, the cells were gently resuspended, and 140 μL of yeast suspension and 10 μL of the specified reagent were added to each well according to the 96-well plate layout. After sealing the plate, the “GPCR×FG Validation” protocol was selected, the plate layout adjusted, and “Use Plate Lid” was checked. The plate was correctly positioned, and fluorescence detection was initiated.

Therapy System

To validate the therapatic effect of AiiA, we validated the anti-biofilm activity of AiiA protein by culturing the protein together with Pseudomonas aeruginosa and using crystal violet staining method.

Validation of Anti-Biofilm Activity

AiiA protein was dissolved in lysis buffer (10 mM Tris-HCl, 1 mM EDTA) to yield a 20 μg/mL stock solution. The stock was subsequently diluted with M63 medium to prepare working solutions at final concentrations of 1, 2, 5, and 10 μg/mL. We activated P. aeruginosa freeze-dried powder and inoculated it onto TSA medium. Then we picked single colonies and inoculated them into TSB medium at a 1:50 dilution ratio, then transferred them to M63 medium. In accordance with the experimental design, P. aeruginosa suspensions, and pre-prepared AiiA protein solutions were added to a 96-well microplate. After 24 hours of cultivation, we stained them with 0.1% crystal violet staining solution (Biosharp, China) at the corresponding time points. We dissolved it with 30% acetic acid water solution and measured the absorbance at 550nm using a microplate reader.

Sequences


gRNAs

Table 1. List of gRNA targeting sequences.
TypeNameSequenceDescription
gRNAssgSte2-1TCACCTCTACTGATGAACTG
gRNAssgSst2-1GAGAAATCTAAGCCAGAACA
tRNA-linked sgRNAsdsgRNATCACCTCTACTGATGAACTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAACAAGCGCAAGTGGTTTAGTGGTAAAATCCAACGTTGCCATCGTTGGGCCCCCGGTTCGATTCCGGGCTTGCGCAGAGAAATCTAAGCCAGAACAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGdual-gRNAs, linked by yeast tRNAGly

Primers for plasmid construction

Plasmids for therapy modules
Table 2. Primers to replace the secretion signal.
No.NameSequenceDescription
59OtMF-FACTATAGGGCCCGGGGCCACCATGAGATTTCCTTCAATTTTTACTForward primer for MFαs
60OtMF-RATGGTGATGGTGGTGAGCTTCAGCCTCTCTTTTCTCGReverse primer for MFαs
61OtVec-FCACCACCATCACCATCATTTGCForward primer for (pFUS1-)AiiA-pESC-LEU linearization
62OtVec-RCCCGGGCCCTATAGTGAGReverse primer for (pFUS1-)AiiAs-pESC-LEU linearization
Table 3. coding sequence replacement
No.NameSequenceDescription
AiiAUtAVec-FATGGAACAGAAGTTGATTTCCGAAGAAGForward primer for vector linearization for AiiA insert
AiiAUtAVec-RATGATGGTGATGGTGGTGAGCTReverse primer for vector linearization for AiiA insert
Plasmids for sensor modules
Table 4. Primers for modifying expression vectors.
TypeNameSequenceDescription
PrimersFGmC-RAAGAATTGTTAATTAAGAGCTTACTTGTACAGCTCATCCATGCCGReverse primer for mCherry in FG-pESC-URA
PrimersFGpG-RAGTCGTATTACGGATCCGGGTCGAAACTAAGTTCTGGTGTTTTAAAACTAAAAAAAAGACTAACReverse primer for pGAP in FG-pESC-URA
PrimersFGVec-FCCCGGATCCGTAATACGACTCACForward primer for pESC-URA linearization
PrimersFGVec-RGCTCTTAATTAACAATTCTTCGCCAGAGGReverse primer for pESC-URA linearization
PrimersFGpF-RTGGACACCATCTAGTGCGGCCGCCCReverse primer for pFUS1 in FG-pESC-URA
PrimersFGmC-FGCCGCACTAGATGGTGTCCAAGGGAGAAGAGGForward primer for mCherry in FG-pESC-URA
PrimersFGpF-FTTGATAATGAAATCTCAGAGGCTGAGTCTCATTTTTCTForward primer for pFUS1 in FG-pESC-URA
PrimersFGpG-FCTCTGAGATTTCATTATCAATACTCGCCATTTCAAAGAATACGTForward primer for pGAP in FG-pESC-URA
PrimersGMpG-FCTATTACGCCAGCTGAATTGTCATTATCAATACTCGCCATTTCAAAGAATACGTAAATAATTAATAGTForward primer for pGAP in GM-pESC-HIS
PrimersGMMF-RGAAATCAACTTCTGTTCCATAGCTTCAGCCTCTCTTTTCTCGAGForward primer for MFαs in GM-pESC-HIS
PrimersGMVec-FATGGAACAGAAGTTGATTTCCGAAGAAGForward primer for pESC-HIS linearization
PrimersGMVec-RCAATTCAGCTGGCGTAATAGCGAAGReverse primer for pESC-HIS linearization
PrimersGMpG-RTCATGGTGGCCTAGTGCGGCCGCCCForward primer for pGAP in GM-pESC-HIS
PrimersGMMF-FGCCGCACTAGGCCACCATGAGATTTCCTTCAATTTTTACTForward primer for MFαs in GM-pESC-HIS
PrimersSplESC-FACCTCTGACACATGCAGCTCForward primer for vector splicing
PrimersSplESC-RGAGCTGCATGTGTCAGAGGTReverse primer for vector splicing
Table 5. Primers for loading the coding sequences on the vectors.
NumberNameSequenceDescription
15HIns-F-2GAAGAAGACCTCGAGGCTCCTAATGGGACTGCCTCForward primer for histamine receptor 2
16HIns-R-2GCGGTACCAAGCTTATCTGTCGGTAGCACCTTGAGGReverse primer for histamine receptor 2
17H/P(P)Vec-FTAAGCTTGGTACCGCGGCForward primer for GM-pESC-HIS linearization
18HVec-RCTCGAGGTCTTCTTCGGAAATCAACTReverse primer for GM-pESC-HIS linearization for human histamine receptors
19HIns-F-3GAAGAAGACCTCGAGGAGAGAGCACCACCTGACGForward primer for histamine receptor 3
20Hins-R-3GCGGTACCAAGCTTACTTCCAACAATGTTCGAGGCTACTReverse primer for histamine receptor 3
21HPIns-FGAGGCTGAAGCTATGGAAAGAGCCCCCCCAGATGForward primer for mhH3R-P2A-protein
22HPIns-R-GGCGGTACCAAGCTTAGAACAACCCACAATCTTTAAGGTTTTGCTReverse primer for mhH3R-P2A-Gpai
23HPVec-RCATAGCTTCAGCCTCTCTTTTCTCGAGReverse primer for GM-pESC-HIS linearization for GPCR-fused proteins
24HIns-F-4GAAGAAGACCTCGAGCCAGATACTAATAGCACAATCAACCTGTCCForward primer for histamine receptor 4
25HIns-R-4GCGGTACCAAGCTTAGCTAGAGACTGATCTTGAGTGCTGACReverse primer for histamine receptor 4
26PPIns-FGAGGCTGAAGCTATGATGGCAGCAGACCTGGGForward primer for P2Y2-P2A-Gpa
27PPIns-RGCGGTACCAAGCTTATCAGTATAAACCACATTCTTTAAGGTTTTGCTReversed primer for P2Y2-P2A-Gpa
28HIns-F-1GAAGAAGACCTCGAGTCACTGCCTAACTCATCTTGCCTCCForward primer for histamine receptor 1
29HIns-R-1GCGGTACCAAGCTTAGGACCTTATATGCAAGATCCGCTTGReverse primer for histamine receptor 1
30HPIns-R-CGCGGTACCAAGCTTACTTGTACAGCTCATCCATGCCGReverse primer for hH3R-P2A-mCherry
31tail-iAAATAGACCGCAGTCTTTAAGGTTTTGCTGGATGATTAGATCGGReverse primer for Gpai
32GpVec-F-iGACTGCGGTCTATTTTAAGCTTGGTACCGCGGCForward primer for FG-pESC-URA linearization for Gpai
33tail-sAAGTAGTTCATATTGTTTAAGGTTTTGCTGGATGATTAGATCGGReverse primer for Gpas
34GpVec-F-sCAATATGAACTACTTTAAGCTTGGTACCGCGGCForward primer for FG-pESC-URA linearization for Gpas
35tail-qCACCAAATTGTATTCTTTAAGGTTTTGCTGGATGATTAGATCGGReverse primer for Gpaq
36GpVec-F-qGAATACAATTTGGTGTAAGCTTGGTACCGCGGCForward primer for FG-pESC-URA linearization for Gpaq
37GpIns-FGAAGAAGACCTCGAGATGGGGTGTACAGTGAGTACGCForward primer for Gpai/s/q
38GpVec-RCTCGAGGTCTTCTTCGGAAATCAACTReverse primer for GM-pESC-URA linearization
39SIns-RGCGGTACCAAGCTTATAAATTATTATTATCTTCAGTCCAGAACTTTCTGGCTTReverse primer for chimeric histamine-mating receptors
Table 6. Primers to change the tag on HopQAD.
TypeNameSequenceDescription
PrimerstagVec-RGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGReverse primer for vector linearization
PrimerstagVec-FACAAAGACGACGACGATAAATAAGCTGAGCAATAACTAGCATAACCCCForward primer for vector linearization
PrimerstagHop-RATTGTTGGTGGTCGAACTGGCReverse primer for HopQAD
PrimerstagHop-FCCGCACTCGAATGGCTGTACAAAAAGTTAAAAATGCAGAForward primer for HopQAD
PrimerstagEG-RGTACAGCCATTCGAGTGCGGCCGCReverse primer for bacterial EGFP
PrimerstagEG-FCTTTAAGAAGGAGATATACCATGGTGAGCAAGGGCGAGForward primer for bacterial EGFP

Primers for PCR tests

Primers for KO detection
Table 7. Primers for knock-out detection.
TypeNameSequenceDescription
PrimersSTE2-1-FTTAAGCAGGCCAACGTCCATForward primer for Ste2
PrimersSTE2-1-RTCGACGTCAGCATCAAACCTReverse primer for Ste2
PrimersSTE2-8-FAAATGTCTGATGCGGCTCCTForward primer for Ste2
PrimersSTE2-8-RAGACAGCGTGCCTGGATAAAReverse primer for Ste2
PrimersSST2-4-FTTTCAGCAGAACGCCGAATGForward primer for Sst2
PrimersSST2-4-RTGTCAGTGCGTGATGGTTGTReverse primer for Sst2
PrimersSTE2_n1-FCGATACCTTTTCTTTTCACCTGCForward primer for Ste2
PrimersSTE2_n1-RGAACTCGTAAAAGCAAAGGTGGReverse primer for Ste2
PrimersSTE2_n2_FACCGTTAAGAACCATATCCAAGAForward primer for Ste2
PrimersSTE2_n2_RCCTGAGAGTTCTAGATCATGGCReverse primer for Ste2
PrimersSST2_n1_FCCTTCTAGGTTTTGCACGCAForward primer for Sst2
PrimersSST2_n1_RAACAAATCACACCTCCGCTTReverse primer for Sst2
PrimersSST2_n2_FTTTGCACGCACTATCTGAGGForward primer for Sst2
PrimersSST2_n2_RGCTCACGTTAGTCACATCTCAGReverse primer for Sst2
PrimersTUB2_1_FGTGGTGAGGCAATTGGAGTGForward primer for Tub2
PrimersTUB2_1_RGCTCGGAAGGTTAAAGGTTGTReverse primer for Tub2
PrimersTUB2_2_FAGTGAAGTAGTGGTGAGGCAForward primer for Tub2
PrimersTUB2_2_RTGTTTATTTTGCTCCAAGTGCTReverse primer for Tub2
Primers for testing in-fusion results
Table 8. Primers for testing in-fusion results.
TypeNameSequenceDescription
PrimerstADH1-RGAGCGACCTCATGCTATACCTGAGReverse primer on terminator ADH1
PrimerstCYC1-RCGTACACGCGTCTGTACAGReverse primer on terminator CYC1
PrimersmCherry-FCGGCGAGTTCATCTACAAGGTCAAGForward primer on mCherry
PrimerspGAP-FTCATTATCAATACTCGCCATTTCAAAGAATACGForward primer on pGAP
PrimersH1-RAGATGAAAGCGGCCATAATGAACCReverse primer for hH1R
PrimersH2-RCGGTACACAAAGGCGGTAAAGTAAGReverse primer for hH2R
PrimersH3-RATGATCATCAGCAGGGTGTAAGGReverse primer for hH3R
PrimersH4-RCGAAAACTCCCAACAGGATCGCReverse primer for hH4R
PrimersGpa-RCGGCACCTAATAGTAACAGTTTTATTTCATTCTReverse primer for Gpai/s/q
PrimersMFM-FGAGAGGCTGAAGCTATGGAACAG(Should be neglected)Forward primer on MFαs
PrimersMF-FATCCTCCGCATTAGCTGCTCForward primer on MFαs
PrimersP2A-RGTCACCCGCCAACTTAAGGAReverse primer on P2A