The DBTL Engineering Cycle: A Framework for Engineering Success
The Design-Build-Test-Learn (DBTL) cycle is the cornerstone of synthetic biology and a fundamental methodology for successful iGEM projects.
DESIGN: Every cycle begins with a clear objective and a rational plan. Based on a specific hypothesis or the learnings from a previous cycle, this phase involves designing the biological system. This includes selecting genetic parts (e.g., promoters, RBS, coding sequences), assembling them into functional circuits or devices using standardized methods, and defining the precise experimental protocols and metrics that will be used to assess success.
BUILD: In the build phase, the theoretical design is translated into a physical, biological reality. This is the hands-on part of the cycle, involving molecular biology techniques such as DNA synthesis, plasmid cloning, and transformation of the engineered constructs into a host organism.
TEST: This phase is centered on robust data collection through quantitative measurements. Various assays are performed to characterize the behavior of the engineered system—for example, measuring fluorescence to quantify gene expression, performing microscopy to observe cellular changes, or conducting biochemical assays to measure the output of a metabolic pathway.
LEARN: This is arguably the most critical phase of the cycle. The data gathered during the test phase is analyzed and interpreted. Did the design work as expected? If so, what principles were confirmed? If not, why did it fail? The insights gained here, whether from success or failure, are invaluable. This new knowledge directly informs the next “Design” phase, leading to improved hypotheses, refined designs, and more targeted experiments in the subsequent cycle.
The Power of Iteration
The true strength of the DBTL framework lies in its iterative nature. A complex synthetic biology project rarely succeeds on the first attempt. Instead, progress is made through multiple, sequential cycles.
Cycle 1: Proof of Concept. A first cycle might test a broad hypothesis or screen multiple candidates to see if an idea is viable.
Cycle 2: Optimization. Based on the results of the first cycle, a second cycle might focus on optimizing the best-performing component or refining the system for better efficiency.
Cycle 3: Characterization. A third cycle could further characterize the system’s performance under various conditions and optimize for real-world applications.
Figure 1. DBTL Engineering Cycle
Engineering Success Overview
Our project successfully engineered a biological system to identify and validate a novel anti-adipogenic protein from Lactobacillus rhamnosus.
Our engineering approach was guided by the Design-Build-Test-Learn (DBTL) cycle, allowing us to systematically narrow down the active component from the whole bacterium to a single, purified protein.
Figure 2. Engineering Success of the project Lacto-Bexo
DBTL 1 (Raw Bacteria)
DBTL Cycle 1: Effect of Raw Lactobacillus Bacteria
Design: Designed to test the hypothesis that direct contact with Lactobacillus could inhibit adipogenesis.[1] The plan was to co-culture six different Lactobacillus strains with 3T3-L1 preadipocytes during their differentiation process.
Build: Six bacterial strains were cultured, and a 7-day protocol for inducing adipogenesis in 3T3-L1 cells was established. The experiment involved treating the cells with bacteria at various Multiplicities of Infection (MOI).
Test: Lipid accumulation was measured using Oil Red O staining.
Learn: We learned that most of the tested strains, particularly L. delbrueckii, L. casei, L. crispatus, L. rhamnosus, and L. gasseri, inhibited lipid accumulation by 20-30%. This confirmed that the bacteria have an anti-adipogenic effect and prompted us to investigate the mechanism.
Design 1
Figure 3. Raw bacteria is treated with MOI 1,10,100 during each media phase. After 24hours of bacteria treatment, gentamycin is treated to kill excessive growth of bacteria. Rest of media and protocol is the same as previous
The initial cycle was designed to determine if direct contact with various Lactobacillus species could inhibit lipid accumulation in adipocytes. The experiment involved co-culturing 3T3-L1 cells with six different strains of Lactobacillus during their differentiation into fat cells. Treatment was planned at three different multiplicities of infection (MOI): 1, 10, and 100. MOI stands for the multiplicity of infections, indicating the ratio of agents (e.g. bacteria) to infection targets (e.g. 3T3-L1 cells).
Build 1
Figure 4. Six different strain of Lactobacillus spp. are cultured bought from KCTC
Six distinct Lactobacillus strains were cultured on plates. A protocol for inducing adipogenesis in 3T3-L1 cells over 7 days was established. The experimental procedure involved adding the raw bacteria during media changes, followed by gentamycin treatment after 24 hours to prevent excessive bacterial growth.
Test 1
Figure 5. The effect on lipid accumulation when DMI induced adipocytes co-cultured with six different Lactobacillus strains. Most strains except the Lactobacillus acidophilus significantly reduced lipid accumulation compared to the control group. (ns p≥0.05, * p<0.5, ** p<0.01, *** p<0.001, **** p<0.0001).
Lipid accumulation was visualized and quantified using Oil Red O staining. Statistical significance was tested between the negative control (NC) and adipocytes treated with bacteria at different MOIs. Detailed results for each strain are provided in the Proof of Concept section.
Learn 1
We found that most of the tested strains—particularly L. delbrueckii, L. casei, L. crispatus, L. rhamnosus, and L. gasseri—inhibited lipid accumulation by 20–30%. These results demonstrate that Lactobacillus strains have potential as anti-adipogenic agents. However, to further investigate the lipid-reducing capability of each strain, we examined the effects of bacterial extracellular components on adipocytes rather than using coculture.
DBTL 2 (Supernatant)
DBTL Cycle 2: Effect of Bacterial Supernatant
Design: Designed to determine if the effect was caused by secreted extracellular substances.[2] An experiment was designed to treat 3T3-L1 cells with the filtered supernatant from the bacterial culture.
Build: Supernatant was collected from all six strains and applied to the adipogenesis assay at concentrations of 25%, 50%, and 75%.
Test: Lipid accumulation was quantified by oil red o staining.
Learn: The results were very specific. Only the supernatant from Lactobacillus rhamnosus showed a significant and concentration-dependent inhibition of lipid accumulation (up to 45%).
This crucial discovery narrowed our focus to the extracellular components of this specific strain.
Design 2
Figure 6. Supernatant is treated to cells with 25%,50%,75% of total volume of well
Learning that the bacteria could inhibit fat accumulation, the second cycle was designed to investigate whether extracellular substances secreted by the bacteria were responsible for this effect. The experiment involved treating differentiating 3T3-L1 cells with the culture supernatant from the six Lactobacillus strains at concentrations of 25%, 50%, and 75%
Build 2
Figure 7. Extract and filter 0.22um the supernatant of six Lactobacillus spp.
The supernatant was collected from each of the six bacterial cultures. The established 7-day adipogenesis protocol was used, with the bacterial supernatant being added to the cell culture medium at the specified concentrations.
Test 2
Figure 8. Effect of supernatant treatment from six different Lactobacillus strains. Only the supernatant from L. rhamnosus significantly inhibited lipid accumulation. In contrast, some strains, including L. acidophilus and L. crispatus, unexpectedly increased lipid content. (ns p≥0.05, * p<0.5, ** p<0.01, *** p<0.001, **** p<0.0001).
The effect of each supernatant on adipogenesis was measured by quantifying lipid accumulation via Oil Red O staining. Detailed results for each strain are provided in the Proof of Concept section.
Learn 2
The results were specific to one strain. Only the supernatant from Lactobacillus rhamnosus showed a significant, dose-dependent inhibition of lipid accumulation, with a 45% reduction at the highest concentration. Supernatants from other strains either had no effect or unexpectedly increased lipid accumulation.
This led to the conclusion that specific extracellular materials from Lactobacillus rhamnosus contain the active substance for regulating fat accumulation.
DBTL 3 (Exosome)
DBTL Cycle 3: Effect of Bacterial Exosomes
Design: To isolate the active component within the L. rhamnosus supernatant, we hypothesized that exosomes might be the carriers of the active molecule. We planned to isolate exosomes and test their effect.
Build: Exosomes were isolated from the supernatant of each Lactobacillus strain using centrifugation and an Amicon tube with a 100k MWCO filter.[3][4][5] We followed widely used Amicon-based EV protocols.[6][7] The 3T3-L1 cells were then treated with these exosomes at concentrations of 2, 5, and 10 x10⁷ nanoparticles/ml.
Test: We measured lipid accumulation and analyzed the expression of key adipogenesis-related genes (Ppary, C/ebpa) and the master energy regulator, AMPK.
Learn: The exosomes from L. rhamnosus showed a remarkable 80% reduction in lipid accumulation, whereas other exosomes had no effect or even increased it. We discovered that these exosomes down-regulate Ppary and C/ebpa and up-regulate AMPK.
This confirmed that an active substance within the L. rhamnosus exosome exerts its effect through the AMPK pathway.
Design 3
Figure 9. Exosome is treated to cells with 2x10⁷, 5x10⁷, 10x10⁷ nanoparticles/ml
To identify the specific component within the L. rhamnosus supernatant, this cycle was designed to test the hypothesis that exosomes (extracellular vesicles) were the active agent. The experiment involved isolating exosomes from all six strains and treating 3T3-L1 cells with varying concentrations of these nanoparticles during adipogenesis.
Build 3
Figure 10. Schematic figure of isolating exosome by Amicon tube
Figure 11. Isolate the exosome from each Lactobacillus spp’s supernatant by using Amicon tube 100k MWCO
Exosomes were isolated from the supernatant of each Lactobacillus strain using centrifugation and an Amicon tube with a 100k MWCO filter. The 3T3-L1 cells were then treated with these exosomes at concentrations of 2, 5, and 10 x10⁷nanoparticles/ml.
Test 3
Figure 12. Effect of exosome treatment from six different Lactobacillus strains. Only exosomes from L. rhamnosus significantly inhibited lipid accumulation, showing up to an 80% reduction in a dose-dependent manner. (ns p≥0.05, * p<0.5, ** p<0.01, *** p<0.001, **** p<0.0001).
The effects of exosomes from the six Lactobacillus strains on lipid accumulation were quantified. To further elucidate the mechanism of lipid reduction by L. rhamnosus exosomes, the expression of key adipogenesis regulators (PPARγ, C/EBPα) and the energy-regulating protein AMPK were analyzed at both the mRNA and protein levels.
Learn 3
Figure 13. L. rhamnosus exosomes dramatically reduced lipid accumulation in 3T3-L1 cells by up to 80%.
Figure 14. Adipogenesis master regulator genes, PPARγ and C/EBPα showed significantly reduced mRNA expression levels when adipocytes were treated with exosomes from L. rhamnosus. Furthermore, a clear dose-dependent decrease in the expression of both adipogenic genes was observed.
Figure 15. Western blot analysis demonstrating that the adipogenesis master regulators PPARγ and C/EBPα were significantly downregulated at the protein level by L. rhamonosus exosome treatment. β-Actin was used as a housekeeping protein, and the relatively consistent β-Actin band intensities indicate that the observed changes in PPARγ and C/EBPα expression were not due to unequal protein loading in SDS-PAGE.
The exosome isolated from Lactobacillus rhamnosus showed a remarkable 80% reduction in lipid accumulation (Figure 13), while exosomes from other strains did not. It was discovered that these specific exosomes down-regulate the adipogenesis genes C/ebpa and Ppary in mRNA and protein level (Figure 14,15).
This provided strong evidence that a substance within the exosome of L. rhamnosus specifically regulates lipid accumulation.
To investigate the specific substance down-regulating adipogenesis genes leading to inhibiting lipid accumulation, we performed proteomic analysis of the exosome content from Lactobacillus rhamnosus.
Figure 16. Proteomic analysis of exosome from Lactobacillus rhamnosus
Proteomic analysis of exosome isolated from Lactobacillus rhamnosus shows that exosome specific filtering reveal that hisF proteins are more abundant about 64-fold than control filtering.
Figure 17. Schematic representation of hisF-mediated upregulation of AMP-activated protein kinase (AMPK) via 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). AICAR is a known AMPK activator and may regulate adipogenic activity in biological systems
hisF(Imidazole glycerol phosphate synthase subunit) related to histidine biosynthesis which produce AICAR and ImGP[8], AICAR induce AMPK which finally leads to inhibit of adipogenesis genes.[9] AMPKs are master regulator of energy expenditure process such as starving, exercise, or etc.[10]
Therefore, we assumed that hisF from exosome might trigger AMPK of the 3T3-L1 cell during differentiation. Before, getting into hisF, we checked out that whether exosome itself could trigger AMPK genes.
So, we measured the mRNA and protein level of AMPK genes from exosome treated 3T3-L1 differentiation process samples.
mRNA expression levels of the energy expenditure regulator genes AMPK1 and AMPK2 were significantly upregulated following treatment with exosomes from Lactobacillus rhamnosus. A dose-dependent increase in expression was observed, particularly for AMPK1 compared to AMPK2.
Figure 19. Western blot analysis demonstrating that the AMPK1 gene is significantly upregulated at the protein level by L. rhamonosus exosome treatment. β-Actin was used as a housekeeping protein, and the relatively consistent β-Actin band intensities indicate that the observed changes in AMPK1 expression were not due to unequal protein loading in SDS-PAGE.
As a result, we learned that exosomes from Lactobacillus rhamnosus reduce fat accumulation by upregulating AMPK, a master regulator of energy expenditure, which is followed by downregulation of adipogenic genes such as PPARγ and C/EBPα.[11]
Considering the 64-fold increase of hisF protein observed in the proteomic analysis (Figure 16), we hypothesized that hisF plays a pivotal role in the upregulation of AMPK upon L. rhamnosus exosome treatment. Consequently, our final engineering cycle focused on synthesizing the hisF protein from L. rhamnosus and demonstrating a causal relationship between hisF and the inhibition of lipid accumulation via AMPK activation.
DBTL 4 (hisF)
DBTL Cycle 4: Identification and Validation of the hisF Protein
Design: The final cycle aimed to identify the specific protein within the exosome, clone its gene, express it, and validate its function.
Build: Proteomic analysis of the L. rhamnosus exosome identified the Imidazole glycerol phosphate synthase subunit (hisF) as a highly abundant protein. We obtained the hisF gene sequence, optimized it for expression in E. coli, synthesized it, and then successfully cloned it into a pET28b expression vector. Subsequently, the hisF protein was expressed and purified.
Test: The purified hisF protein was applied to the 3T3-L1 adipogenesis assay.
Learn: The purified hisF protein successfully inhibited lipid accumulation in a concentration-dependent manner by up to 50%. This final test confirmed that hisF is the specific protein responsible for the observed anti-adipogenic effects.
Design 4A
We obtained hisF protein sequence of Lactobacillus rhamnosus from NCBI and insert to pUC-GW-AMP vector.
Figure 20. Schematic figure of pUC-GW-Amp vector map
We used pUC-GW-AMP as backbone plasmid to insert optimized Lactobacillus rhamnosus hisF protein sequence.
Build 4A
Based on original hisF sequence, sequence is optimized for E.coli expression system and insert into vector.
Figure 21. Sequence and GC content of hisF from Lactobacillus rhamnosus
We found the hisF sequence of Lactobacillus rhamnosus from NCBI and prepare to codon optimization for that of E.coli sequence.
Figure 22. The hisF gene sequence from Lactobacillus rhamnosus was codon-optimized for expression in an E. coli system. The GC content after optimization is also shown.
The optimized sequence was prepared for insertion into the pUC-GW-AMP vector. This step was necessary because certain codons are infrequently used in E. coli, meaning that achieving high-level protein expression requires modification of the original DNA sequence
Figure 23. Sequence alignment of original and optimized sequence
Optimized sequence for E.coli expression system and original Lactobacillus rhamnosus hisF gene sequence are aligned to compare consensus sequence.
Red is same consensus nucleotides and blue is different nucleotides.
Test 4A
Figure 24. The hisF sequence for insertion was amplified by PCR with the condition described above, and the amplified DNA length was verified using agarose gel electrophoresis. The PCR product showed a length of 759 bp, consistent with the hisF DNA sequence length shown in Figure 23.
Inserted hisF sequence is checked out by PCR amplification that confirm 759bp of product length.
Figure 25. The amplified hisF sequence for insertion was confirmed by Sanger sequencing.
To ensure that no sequence changes occurred during amplification, Sanger sequencing was performed. The results showed that the amplified DNA sequence perfectly matched the desired hisF sequence.
Learn 4A
| Sequence name | Cloning Vector | Insert Length |
|---|---|---|
| hisF | pUC_AMP | 759bp |
| Item | Specification | Results |
|---|---|---|
| Insert Sequence | Sequence results consistent with target | Pass |
| PCR amplification | Correct without non-specific bands | Pass |
| DNA Quantity and Quality |
Purity (A260/A280 = 1.8 ~2.0) Concentration Actual yield Matrix |
1.98 184ng/ul 3.68 ug Sterile water |
Table 1. Gene Synthesis Report
In summary, the hisF gene sequence from Lactobacillus rhamnosus was codonoptimized for expression in an E. coli protein expression system. The optimized hisF sequence was then amplified and verified to ensure no sequence changes occurred during amplification. Additionally, absorbance measurements of DNA (A260/A280) confirmed that high-purity DNA samples were obtained.
Design 4B
We inserted synthesized hisF sequence to pET28b expression vector at NdeI and XhoI restriction enzyme site. Then, transformed into E.coli top 10 strain with Kanamycin selection and check whether the sequence is well inserted by colony PCR and sequencing.
After cloning, hisF protein is expressed within E.coli_BL21(DE3) and Cell-free system,
Figure 26. Schematic figure of pET28b plasmid vector
| Category | Name |
|---|---|
| Vector | pET28b |
| Gene | hisF |
| Insert Oligo 1 | hisF-NdeI-F |
| CAGCGGCCTGGTGCCGCGCGGCAGCCATATGCTGACCAAACGCATTATTCCGT | |
| Insert Oligo 2 | hisF-XhoI-R |
| CTCAGTGGTGGTGGTGGTGGTGCTCGAGTTAGCCGATCGCCACTTTC | |
| Amplicon Size(bp) | 815 |
| Sequencing Primer 1 | T7 primer |
| TAATACGACTCACTATAGGG | |
| Sequencing Primer 2 | T7 terminator |
| CTCAGTGGTGGTGGTGGTGGTGCTCGAGTTAGCCGATCGCCACTTTC |
Table 2. Cloning Information
Build 4B
Figure 27. The same data from Figure 24 above, showing that hisF sequence for insertion was amplified and verified.
Figure 28. The pET28b plasmid vector was digested with NdeI and XhoI restriction endonucleases, and conversion from circular (uncut) to linear plasmid was verified using agarose gel electrophoresis.
In summary, the hisF gene for insertion and the digested pET28b plasmid were successfully prepared for the subsequent recombinant plasmid ligation step.
Figure 29. Conditions and reagent amounts used for the insertion of the amplified hisF gene into the digested pET28b vector. T4 DNA ligase was employed to ligate the two DNA fragments, generating circular recombinant plasmid DNA.
Figure 30. E. coli successfully transformed were screened with antibiotic kanamycin.
The recombinant plasmids generated by combining the hisF PCR products with the pET28b vector were used to transform competent E. coli cells. Colonies exhibiting kanamycin resistance were obtained (Figure 31), indicating that the initial cloning was successful. However, further verification was required to confirm that the recombinant plasmids had been correctly introduced into the E. coli protein expression system.
Figure 31. PCR conditions used for colony PCR of selected kanamycin resistant E. coli colonies.
Figure 32. Sanger sequencing results of plasmids obtained from kanamycin-resistant E. coli colonies. The sequenced plasmids were compared with the desired hisF sequence, confirming that no sequence changes occurred during transformation.
Selected E.coli colonies’ plasmid are multiplied by colony PCR and sequenced to confirm whether cloning are successful.
Test 4B
| Category | Name |
|---|---|
| Sample | hisF |
| Vector | pET28b |
| Expression System | E.coli_BL21(DE3) |
| Promotor | T7 |
| Antibiotics | Kanamycin |
| Tagging | His tag |
| Expression Protein Size | 28.9kDa |
Table 3. Protein expression sample Information
Figure 33. Schematic representation of the E. coli protein expression system with IPTG induction.
If hisF protein expression is successful following IPTG induction in the E. coli BL21(DE3) system, a protein of approximately 29 kDa would be observed on SDS-PAGE. The recombinant plasmids prepared as described above were used to transform E. coli, and large-scale batch cultures were conducted. After IPTG induction, the cells were fractionated and analyzed by SDS-PAGE to confirm expression of the target hisF protein.
Figure 34. Summarized growth conditions and cell density data of protein expression E. coli BL21(DE3).
Figure 35. SDS-PAGE analysis of the E. coli protein expression system. The target hisF protein, with a molecular weight of 28.9 kDa, was detected in both total lysates and insoluble pellets of samples induced with 0.2 mM and 1 mM IPTG. The gel was prepared using 15% Tris-Glycine and visualized with Coomassie blue staining.
As shown in Figure 35, the target hisF protein was successfully synthesized in the E. coli protein expression system following IPTG induction.
Figure 36. Schematic figures of cell-free protein expression system.
hisF protein is expressed by cell-free system to validate the protein’s attributes are not depended on cell expression system. Reacted products are fractionized and separated by SDS- PAGE if the target proteins are expressed.
Figure 37. Experimental conditions and protocols of cell-free protein synthesis system.
Figure 38. SDS-PAGE analysis of the cell-free protein expression system. The target hisF protein, with a molecular weight of 28.9 kDa, was detected in both total lysates and insoluble pellets. The gel was prepared using 15% Tris-Glycine and visualized with Coomassie blue staining.
In conclusion, the 28.9 kDa hisF protein was observed in both the E. coli protein expression system and the cell-free expression system, suggesting that expression in E. coli did not alter the structure of the target protein.
Learn 4B
We successfully synthesized the hisF gene from Lactobacillus rhamnosus and cloned it into the pET28b expression vector. The plasmid was expressed using two approaches: a conventional cell-based expression system and a cell-free expression system. Both methods produced adequate amounts of protein, though primarily in the insoluble fraction, confirming that our engineering strategy functioned as intended. Due to the insolubility, we did not proceed with further purification. Instead, we lysed the expressed cells by sonication, exchanged the buffer to PBS, and quantified protein concentration using a BCA assay. The resulting lysate was then applied to the 3T3-L1 adipogenesis model at concentrations of 20, 100, and 500 ppm to validate our proof of concept.
Figure 39. BCA assay of the hisF-expressed cell lysates. Fourteen wells on the left side showing increasing purple intensity from left to right were used to construct the protein concentration standard curve, while the four wells highlighted in the red box on the right were used to measure the protein concentration of the cell lysates.