Experiments

I. Preparation of Escherichia coli Competent Cells and Transformation of Plasmid DNA

1. Experimental Objectives:
By preparing Escherichia coli competent cells and transferring the recombinant plasmid into them, the replication and amplification of plasmid DNA can be achieved, facilitating the extraction of plasmid DNA for subsequent experiments.

2. Experimental Principles:
The state in which bacteria are receptive to absorbing exogenous DNA is called competence. Transformation refers to the process of introducing plasmid DNA or its vector-constructed recombinant into bacteria. The principle is that bacteria are in a 0°C, low-salt hypotonic solution environment, and the cells expand and become spherical. The DNA in the transformation mixture forms a hydroxyl-calcium-phosphate DNA complex that adheres to the cell surface. After a short heat shock at 42°C, the cells absorb the DNA complex. The bacteria are placed in a non-selective medium and incubated for a period of time to allow the new phenotype acquired during the transformation process to be expressed. Then, the bacterial culture is spread on a selective medium.

3. Instruments, Materials and Reagents:
Instruments: Ultra-clean bench, low-temperature centrifuge, constant temperature shaker, water bath with water jacket, constant temperature water bath, autoclave;
Materials: Escherichia coli, plasmid DNA, CaCl2, peptone, yeast extract, NaCl, NaOH, agar, ampicillin, kanamycin, 50 mL centrifuge tube, test tube, petri dish, beaker, etc.;
Reagents: 0.1 mol/L CaCl2 solution, LB liquid medium, LB solid medium.

4. Experimental Protocols:
(1) Take 100 μL of competent Escherichia coli from the -80°C refrigerator and place it on ice to rapidly thaw. Add 10 μL of recombinant plasmid DNA within 8 minutes and gently tap the bottom of the centrifuge tube to mix (avoid up-and-down shaking). Incubate at 4°C for 25 minutes.
(2) Perform a 42-second heat shock at 42°C, then place the cells back on ice for 5 minutes.
(3) Add 700 μL of sterile LB medium without antibiotics to the tube, gently mix, and incubate at 37°C, 200 rpm shaker for 60 minutes to restore.
(4) Take 100 μL of the bacterial suspension and spread it on LB medium containing ampicillin and LB medium containing kanamycin (for low-concentration cultivation); centrifuge at 5000 rpm for 1 minute to collect the bacteria, retain about 100 μL of the supernatant, gently tap to resuspend the bacteria, and spread it on LB medium containing ampicillin and LB medium containing kanamycin (for high-concentration cultivation).
(5) Invert the plates and incubate in a 37°C incubator overnight, with a total incubation time of at least 15 hours at 37°C.
(6) Take 200 μL of competent cells and mix with 2 μL of plasmid DNA on ice for 30 minutes.
(7) Place the tube in a 42°C water bath for 90 seconds.
(8) Place on ice for 2 minutes.
(9) Add 800 μL of LB liquid medium to each tube, incubate at 37°C shaker at 150 r/min for 1 hour.
(10) Spread 100 μL of the recovered cells on LB petri dishes containing ampicillin and normal flat placement for 30 minutes. Similarly, spread 100 μL of the recovered cells on LB petri dishes containing kanamycin and normal flat placement for 30 minutes.
(11) Invert the plates and incubate at 37°C for 12-16 hours. Colony formation will occur.

II. Extraction of Plasmid DNA

1. Experimental Objectives:
To extract the replicated and amplified plasmid DNA from the bacterial cells for the construction of recombinant plasmids.

2. Experimental Principles:
The alkaline lysis method for plasmid extraction is based on the topological differences between covalently closed circular plasmid DNA and linear chromosomal DNA. Within the narrow pH range of 12.0-12.5, the double helix structure of linear DNA unwinds and denatures. Although the hydrogen bonds of covalently closed circular plasmid DNA are broken under such conditions, the two complementary strands remain tightly intertwined. When pH 4.8 potassium acetate high-salt buffer is added to restore the pH to neutral, the covalently closed circular plasmid DNA rapidly and accurately renatures due to the two complementary strands remaining together, while the linear chromosomal DNA, with its two complementary strands completely separated, renatures less rapidly and accurately, entangling to form a network structure. Through centrifugation, the chromosomal DNA, along with unstable large-molecule RNA, protein-SDS complexes, etc., precipitates and is removed.

3. Instruments, Materials and Reagents:
Instruments: Constant temperature shaker, benchtop centrifuge, autoclave, vortex oscillator;
Materials: E. coli containing plasmids, Tris, EDTA, glucose, NaOH, SDS, KAc, HAc, HCl, Tris-saturated phenol, chloroform, isopropanol, ethanol, RNase A, kanamycin, ampicillin, sucrose
Reagents: Solution I (50 mM glucose, 25 mM Tris-HCl, 10 mM EDTA), Solution II (0.4 M NaOH and 2% SDS mixed in equal volume before use), Solution III (5 M KAc 60 mL, 11.5 mL HAc,28.5 mL water), TE buffer (10 mM Tris-HCl, 1 mM EDTA), 0.5 M EDTA, chloroform-isopropanol, Tris-saturated phenol-chloroform-isopropanol, 70% ethanol, RNase A.

4. Experimental Protocols:
(1) Add 3 μL of antibiotic (final concentration 50 μg/mL) to 3 mL of LB liquid medium, then inoculate a single colony of E. coli containing plasmids and shake at 37°C overnight.
(2) Transfer the overnight culture to a 1.5 mL centrifuge tube, centrifuge at 4000 r/min for 1 min, and remove the culture medium thoroughly (otherwise, it may affect the enzymatic digestion reaction). Collect all the bacterial cells in a small tube.
(3) Add 100 μL of Solution I to the centrifuge tube containing the bacterial cells, vortex to suspend the bacterial pellet, and incubate at room temperature for 10 min.
(4) Add 200 μL of Solution II, gently mix the contents, and when the solution becomes clear, add Solution III (do not use a vortex oscillator; the lysis time should not exceed 5 min).
(5) Add 150 μL of Solution III (pre-cooled on ice), tightly close the tube, and gently mix several times. Place on ice for 15 min to allow the plasmid DNA to renature (do not use a vortex oscillator).
(6) Centrifuge at 12000 r/min for 10 min, and transfer the supernatant to another 1.5 mL centrifuge tube.
(7) Add an equal volume of phenol-chloroform-isopropanol to the supernatant to remove proteins and lipids, vortex to mix, and centrifuge at 12000 r/min for 5 min. Transfer the supernatant to another 1.5 mL centrifuge tube.
(8) Add an equal volume of chloroform-isopropanol to the supernatant to remove trace phenol and lipids, vortex to mix, and centrifuge at 12000 r/min for 5 min. Transfer the supernatant to another 1.5 mL centrifuge tube.
(9) Add two volumes of absolute ethanol to the supernatant, vortex to mix, and incubate at room temperature for 30 min (to precipitate the DNA). Centrifuge at 12000 r/min for 10 minutes and discard the supernatant.
(10) Wash the plasmid DNA precipitate twice with 1 mL of 70% ethanol (vigorously shake to mix well and centrifuge at 12000 r/min for 5 minutes each time), discard the supernatant and air dry.
(11) Add 20 μL of RTE (TE buffer containing 20 μg/mL pancreatic RNAse to degrade RNA) to completely dissolve the plasmid DNA and store at -20°C.

III. Detection of DNA by Agarose Gel Electrophoresis

1. Experimental Objectives:
To detect the status of the target DNA fragment through agarose gel electrophoresis.

2. Experimental Principles:
When DNA molecules move in agarose gel, there are both electrostatic effects and molecular sieving effects. DNA molecules carry a negative charge in a pH solution higher than their isoelectric point and move towards the positive electrode in an electric field. Due to the repetitive nature of the sugar-phosphate backbone in structure, double-stranded DNA molecules of the same quantity carry almost the same amount of electrostatic charge and thus move towards the positive electrode at the same rate. Under a certain electric field intensity, the migration rate of DNA molecules depends on the molecular sieving effect, that is, the size and configuration of the DNA molecules themselves. DNA fragments with different relative molecular masses have different migration rates and can be separated. The migration rate of DNA molecules is inversely proportional to the logarithm of their relative molecular mass. Agarose gel electrophoresis can not only separate DNA with different relative molecular masses but also separate DNA molecules with the same relative molecular mass but different configurations, such as supercoiled covalently closed circular plasmid DNA, open circular plasmid DNA, and linear plasmid DNA. These three have different migration rates in agarose gel electrophoresis, so after electrophoresis, they may appear as three bands: supercoiled plasmid DNA migrates the fastest, followed by linear plasmid DNA, and then open circular plasmid DNA.

3. Instruments, Materials and Reagents:
Instruments: Agarose gel electrophoresis system, ultraviolet transilluminator;
Materials: Plasmid DNA or DNA fragments, agarose, boric acid, Tris, EDTA, bromophenol blue, sucrose, GoldView™;
Reagents: 1×TAE, 6×Loading buffer.

4. Experimental Protocols:
(1) Dissolve 1 g of agarose in 100 mL of 1×TAE buffer in a conical flask to prepare the agarose gel.
(2) Heat the mixture in a microwave until the agarose is completely dissolved. After boiling, gently shake the conical flask to ensure uniform dissolution. When the solution cools slightly, add 10 μL of GoldView™ nucleic acid dye.
(3) Pour the agarose solution into the gel preparation plate and let it solidify at room temperature.
(4) After solidification, carefully remove the comb, and place the gel (together with the preparation plate) into the electrophoresis tank. Add 1×TAE buffer to the electrophoresis tank until it covers the gel.
(5) Add 10 μL of 6×loading buffer to each sample. Load the samples into the gel, and add 5000 bp DNA standard as a size reference.
(6) Run the gel at 80 - 120 volts. After electrophoresis, observe the gel under ultraviolet light and take a picture of the result.

5. Reflection and Optimization:
According to the size of the DNA to be separated, we explored the appropriate percentage of agarose in the gel:

Agarose gel concentration/%	Effective separation range of linear DNA/kb
0.3	5-60
0.6	1-20
0.7	0.8-10
0.9	0.5-7
1.2	0.4-6
1.5	0.2-4
2.0	0.1-3

IV. PCR Gene Amplification and Product Recovery

1. Experimental Objectives:
To amplify the target gene fragment using PCR and recover it to provide materials for the construction of recombinant plasmids.

2. Experimental Principles:
The principle of polymerase chain reaction (PCR) is similar to the natural replication process of DNA. By using a pair of oligonucleotide primers complementary to the two sides of the DNA fragment to be amplified, after several cycles of denaturation, annealing and extension, the DNA is amplified 2n times. A typical PCR reaction system includes: DNA template, reaction buffer, dNTP, MgCl2, a pair of synthetic DNA primers, and Taq enzyme. Denaturation: Heating the template DNA at high temperature to break the hydrogen bonds between the two strands, forming two single strands, which is the denaturation stage. Annealing: Lowering the solution temperature to 50-60°C, allowing the template DNA to bind to the primers according to the principle of base complementarity, which is the annealing stage. Extension: Raising the reaction temperature, Taq enzyme uses the single-stranded DNA as a template and, guided by the primers, replicates the complementary DNA in the 5'→3' direction using the four dNTPs in the reaction mixture, which is the extension stage. The above three steps constitute one cycle, namely the high-temperature denaturation, low-temperature annealing, and medium-temperature extension stages. Theoretically, within a certain number of cycles, the amount of DNA in the sample should double after each cycle, and the newly formed strands can serve as templates for the next round of cycles. After 25-30 cycles, the DNA can be amplified 106-109 times. Subsequently, the PCR products are recovered using a PCR product rapid gel recovery kit.

3. Instruments, Materials and Reagents:
Instruments: PCR thermal cycler, agarose gel electrophoresis system, ultraviolet transilluminator;
Materials: DNA template, dNTP mixture, primer pair, Taq enzyme, PCR tubes, pipette tips, centrifuge tubes, agarose, HAc, Tris, EDTA, bromophenol blue, sucrose, GoldView™, ethanol, PCR product rapid gel recovery kit;
Reagents: dNTP mixture, Taq enzyme, DNA template, primer pair, 1×TAE, 6×Loading buffer, PCR buffer.
Target gene and primer sequences:

Target Gene	Sequence of Target Gene	Primer (F)	Primer (R)
pcT	ATGAGAAAAGTAGAAATCATTACAGCTGAACAAGCAGCTCAGCTCGTAAAAGACAACGACACGATTACGTCTATCGGCTTTGTCAGCAGCGCCCATCCGGAAGCACTGACCAAAGCTTTGGAAAAACGGTTCCTGGACACGAACACCCCGCAGAACTTGACCTACATCTATGCAGGCTCTCAGGGCAAACGCGATGGCCGTGCCGCTGAACATCTGGCACACACAGGCCTTTTGAAACGCGCCATCATCGGTCACTGGCAGACTGTACCGGCTATCGGTAAACTGGCTGTCGAAAACAAGATTGAAGCTTACAACTTCTCGCAGGGCACGTTGGTCCACTGGTTCCGCGCCTTGGCAGGTCATAAGCTCGGCGTCTTCACCGACATCGGTCTGGAAACTTTCCTCGATCCCCGTCAGCTCGGCGGCAAGCTCAATGACGTAACCAAAGAAGACCTCGTCAAACTGATCGAAGTCGATGGTCATGAACAGCTTTTCTACCCGACCTTCCCGGTCAACGTAGCTTTCCTCCGCGGTACGTATGCTGATGAATCCGGCAATATCACCATGGACGAAGAAATCGGGCCTTTCGAAAGCACTTCCGTAGCCCAGGCCGTTCACAACTGTGGCGGTAAAGTCGTCGTCCAGGTCAAAGACGTCGTCGCTCACGGCAGCCTCGACCCGCGCATGGTCAAGATCCCTGGCATCTATGTCGACTACGTCGTCGTAGCAGCTCCGGAAGACCATCAGCAGACGTATGACTGCGAATACGATCCGTCCCTCAGCGGTGAACATCGTGCTCCTGAAGGCGCTACCGATGCAGCTCTCCCCATGAGCGCTAAGAAAATCATCGGCCGCCGCGGCGCTTTGGAATTGACTGAAAACGCTGTCGTCAACCTCGGCGTCGGTGCTCCGGAATACGTTGCTTCTGTTGCCGGTGAAGAAGGTATCGCCGATACCATTACCCTGACCGTCGAAGGTGGCGCCATCGGTGGCGTACCGCAGGGCGGTGCCCGCTTCGGTTCGTCCCGCAATGCCGATGCCATCATCGACCACACCTATCAGTTCGACTTCTACGATGGCGGCGGTCTGGACATCGCTTACCTCGGCCTGGCCCAGTGCGATGGCTCGGGCAACATCAACGTCAGCAAGTTCGGTACTAACGTTGCCGGCTGCGGCGGTTTCCCCAACATTTCCCAGCAGACACCGAATGTTTACTTCTGCGGCACCTTCACGGCTGGCGGCTTGAAAATCGCTGTCGAAGACGGCAAAGTCAAGATCCTCCAGGAAGGCAAAGCCAAGAAGTTCATCAAAGCTGTCGACCAGATCACTTTCAACGGTTCCTATGCAGCCCGCAACGGCAAACACGTTCTCTACATCACAGAACGCTGCGTATTTGAACTGACCAAAGAAGGCTTGAAACTCATCGAAGTCGCACCGGGCATCGATATTGAAAAAGATATCCTCGCTCACATGGACTTCAAGCCGATCATTGATAATCCGAAACTCATGGATGCCCGCCTCTTCCAGGACGGTCCCATGGGACTGAAAAAATAA	TGGTGGTGGTGGTGCTCGAGATGAGAAAAGTAGAAATCATTACAGCTGAACAAG	CGTCGACAAGCTTGCGGCCGCTTATTTTTTCAGTCCCATGGGACCG
phaA	CTACACACGCTCAATAGCAAAAGCCGTACCGCCGCCAGTACCATGACACAAAGCCGCCAGCCCCAAACTCTTATCGTGTTGTTCCAAAGCATTAAGTAAAGTCACAACAATGCGGGAACCGGAAGCGCCAATAGGGTGTCCGAGAGCGATCGCCCCACCATTAACATTCAACTTATCTTGAGAGACCCCCAACATTGTATCAAATAACAAGGTACTAACTGCAAAAGCCTCGTTATTTTCAAACAAATCGAAATCATTAACCGACATTTTCAGGCGACCCAGTAACTTCTGAGTAGCCAAAATCGGCACTTCTGGAAACCGCCAACTCTCACCACCAGCCCAAGCGCCGCCCAGCACTTTAGCCAGAGGTTTCAAACCATACTTTTGTACAGCAGCCTCACTAGCCAAAATAATCGCCGCCGCACCATCAGAAATTTGGGAACTATTCCCAGCAGTTAAGACCCCATCTTTCTGAAAAGCCGGACGCAACTTAGCCAAACTTTCCAAAGTAGTCTCAGCGCGGATACCCTCATCAGTATCAATCACCTGAGTTCCCTTACGGCTAGACACCTCAATGGGGGAGATTTCATTTTTAAACAATCCTTTTTCCGTAGCTTCCGCCGCGCGTTTTTGGGAGTAAAAAGCCACCTCGTCCAAAGCCTGACGACTGAAACCATGTTCAGCCGCCAAACGTTCAGTTTCATCCCCCATACCGTCTCCGGTAGTAGAGTCTGTTAAACCATCATACAGCAGAATATCCATCAACTGTTCTGGGGCTCCCATAAGGAACTTATAACCCCATCTAGCGCGGTGAGACAAAAAGAACCCTGTTTGCGACATACACTCAGTCCCTCCTGCCAGCACTAGATCAGCCTCTCCAGCCTTAATAGTGTAGCAGCCATTAATCAGACTCATCATAGCAGAAGAACAAACCATATCAATGGCATATCCATCGACTGTGGCGGGTATACCTGCTTTCAAAGCCGCTTGACGGGGTATTAGCTGTCCGTGTCCTGCTCGCAACACATTTCCAAAAATATAAAGATCCAGATTTTCACCGGAAACCCCAGCTTTCGCCAATGCTGCTTTCATAGCATGAGCGCCTAGGTCAGCCGGAGAAAACCCAGATAACCCCCCCCCAAACCTACCTAGGGGGGTGCGTGTTGCGGAGACGATATAAACTTCTGTCAT	TGGTGGTGGTGGTGCTCGAGATGACAGAAGTTTATATCGTCTCCGC	CGTCGACAAGCTTGCGGCCGCCTACACACGCTCAATAGCAAAAGC
phaB	TCAGCCCATATGCAGGCCGCCGTTGAGCGAGAAGTCGGCGCCGGTCGAGAAACCGGACTCCTCCGACGACAACCAGGCGCAGATCGAGGCGATCTCTTCCGGCAGGCCCAGGCGCTTGACCGGGATCGTCGCGACGATCTTGTCGAGCACGTCCTGGCGGATCGCCTTGACCATGTCGGTGGCGATATAGCCCGGAGAGACCGTGTTGACGGTCACGCCCTTGGTCGCCACTTCCTGCGCCAGTGCCATGGTGAAGCCATGCAGGCCGGCCTTGGCGGTGGAGTAGTTGGTCTGGCCGAACTGGCCCTTCTGCCCGTTCACCGACGAGATGTTGACGATGCGGCCCCAGCCACGGTCGGCCATGCCGTCGATCACCTGCTTGGTGACGTTGAACAGCGAGGTCAGGTTGGTGTCGATCACCGCATCCCAGTCGGCGCGGGTCATCTTGCGGAACACCACGTCGCGGGTGATACCGGCGTTGTTGATCAGCACATCAACCTCGCCGACCTCGGACTTGACCTTGTCGAATGCGGTCTTGGTCGAGTCCCAGTCAGCCACATTGCCTTCCGAGGCAATGAAATCGAAGCCCAGGGCCTTCTGCTGCTCCAGCCACTTTTCGCGGCGCGGCGAGTTGGGGCCGCAACCGGCCACCACACGAAAGCCATCCTTGGCCAGCCGCTGGCAAATGGCGGTTCCGATACCACCCATGCCGCCGGTCACATACGCAATGCGCTGAGTCAT	TGGTGGTGGTGGTGCTCGAGATGACTCAGCGCATTGCG	CGTCGACAAGCTTGCGGCCGCTCAGCCCATATGCAGGCCGC
rplO	ATGCGTTTAAATACTCTGTCTCCGGCCGAAGGCTCCAAAAAGGCGGGTAAACGCCTGGGTCGTGGTATCGGTTCTGGCCTCGGTAAAACCGGTGGTCGTGGTCACAAAGGTCAGAAGTCTCGTTCTGGCGGTGGCGTACGTCGCGGTTTCGAGGGTGGTCAGATGCCTCTGTACCGTCGTCTGCCGAAATTCGGCTTCACTTCTCGTAAAGCAGCGATTACAGCCGAAATTCGTCTGTCTGACCTGGCTAAAGTAGAAGGCGGTGTAGTAGACCTGAACACGCTGAAAGCGGCTAACATTATCGGTATCCAGATCGAGTTCGCGAAAGTGATCCTGGCTGGCGAAGTAACGACTCCGGTAACTGTTCGTGGCCTGCGTGTTACTAAAGGCGCTCGTGCTGCTATCGAAGCTGCTGGCGGTAAAATCGAGGAATAA	CATCACCACAGCCAGGATCCATGCGTTTAAATACTCTGTCTCCGG	CAGGCGCGCCGAGCTCTTATTCCTCGATTTTACCGCCAGCA
SUMO-Tag	TCGGACTCAGAAGTCAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGAGATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAAAAGACAGGGTAAGGAAATGGACTCCTTAAGATTCTTGTACGACGGTATTAGAATTCAAGCTGATCAGACCCCTGAAGATTTGGACATGGAGGATAACGATATTATTGAGGCTCACAGAGAACAGATTGGT	CTTGTCGACGGAGCTCTCGGACTCAGAAGTCAATCAAGAAGC	AGCAAATGGGTCGCGGATCCACCAATCTGTTCTCTGTGAGCC

4.Experimental Protocols:
(1) Take a PCR tube (0.1 mL) and place it on ice. Preheat the PCR machine in advance.
(2) Mix the following reagents in the PCR tube on ice:
2×UKOD Master Mix: 25 μL
Forward primer: 1 μL
Reverse primer: 1 μL
Template DNA: 15 ng
Make up to 50 μl with double-distilled water.
(3) Briefly centrifuge the PCR tube to mix the reagents and remove any bubbles.
(4) Place the PCR tube in the PCR machine and set the following program:
98℃ for 3 minutes
98℃ for 10 seconds
68℃ for 15 seconds
68℃ for 5 seconds (30 cycles)
68℃ for 5 minutes
4℃ for an indefinite period
(5) Preheat the metal bath to 56℃.
(6) Under ultraviolet light, carefully cut out the gel slice containing the target DNA band with a clean surgical knife.
(7) Accurately weigh the gel slice and place it in a 2 mL microcentrifuge tube. Add 3 times the volume of solubilization buffer DD (if the gel weight is 100 mg, add 300 μL of solubilization buffer). If the gel concentration is greater than 2%, add 6 times the volume of DD.
(8) Incubate in a 56°C water bath for 10 minutes. Vortex every 2-3 minutes to accelerate dissolution.
(9) Add the solution obtained in the previous step to the adsorption column EC (place the adsorption column in a collection tube), and let it stand at room temperature for 1 minute. Centrifuge at 12,000 rpm for 30-60 seconds, and discard the waste liquid in the collection tube.
(10) Add 500 μL of washing buffer WB (already containing absolute ethanol), centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid. Repeat the operation.
(11) Place the adsorption column EC back into an empty collection tube and centrifuge at 12,000 rpm for 2 minutes to remove as much washing buffer as possible to avoid residual ethanol from the washing buffer inhibiting downstream reactions.
(12) Take out the adsorption column EC and place it in a clean centrifuge tube. Let it stand at room temperature for several minutes.
(13) Add elution buffer EB to the middle of the adsorption membrane, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 rpm for 1 minute. If a larger amount of DNA is needed, the obtained solution can be re-added to the adsorption column and centrifuged for 1 minute.

V. Linearized Plasmid Vectors

1. Experimental Objectives:
To linearize the circular vector plasmid DNA by double digestion with two different restriction endonucleases at specific sites, generating two distinct ends, to achieve directional cloning and ensure that the exogenous fragment is inserted into the vector in the correct orientation, and to prepare the backbone vector for subsequent recombination reactions.

2. Experimental Principles:
Two restriction endonucleases recognize specific sequences on the plasmid vector and cleave the DNA backbone. When both recognition sites are cut, the circular plasmid is converted into a linear molecule with different sticky or blunt ends at each end. This asymmetric end structure effectively prevents self-ligation of the vector and forces the exogenous insert fragment to be inserted into the vector in the preset direction when it has a matching end, thereby achieving directional cloning and significantly improving the accuracy rate of positive clones. Selecting two enzymes that can work efficiently in the same buffer system (compatible buffer) is one of the keys to the success of this experiment.

3. Instruments, Materials and Reagents:
Instruments: Water bath or metal bath, microcentrifuge, vortex mixer, agarose gel electrophoresis system;
Materials: Circular plasmid DNA, XhoI Restriction Enzyme, NotI Restriction Enzyme, BamHI Restriction Enzyme, SacI Restriction Enzyme, restriction digestion buffer, sterile PCR tubes, 1.5 mL centrifuge tubes, pipette tips, agarose gel DNA recovery kit;
Reagents: ddH2O, 1×TAE, 6×DNA Loading buffer, DNA marker.

4.Experimental protocols:
Restriction Enzyme Digestion of Gel-Purified Vector (pRSFDuet-1)
(1) Take a PCR tube (0.1 mL) and place it on ice. Set up the restriction digestion reaction as follows:
DNA: 1μg
10× Restriction Enzyme Buffer: 5μL
BamHI Restriction Enzyme: 1μL
SacI Restriction Enzyme: 1μL
ddH₂O: add to a final volume of 50μL
(2) Briefly centrifuge the mixture to remove any air bubbles.
(3) Incubate at 37℃ for 5 - 15 minutes.
(4) Incubate at 65℃ for 20 minutes for heat inactivation.
Restriction Enzyme Digestion of Gel-Purified Vector (pET-21a)
(1)Take a PCR tube (0.1 mL) and place it on ice. Set up the restriction digestion reaction as follows:
DNA: 1μg
10× Restriction Enzyme Buffer: 5μL
XhoI Restriction Enzyme: 1μL
NotI Restriction Enzyme: 1μL
ddH₂O: add to a final volume of 50μL
(2) Briefly centrifuge the mixture to remove any air bubbles.
(3) Incubate at 37℃ for 5 - 15 minutes.
(4) Incubate at 65℃ for 20 minutes for heat inactivation.

VI. DNA Recombination

1. Experimental Objectives:
To efficiently and precisely recombine the target DNA fragment into the linearized cloning vector through seamless cloning technology, construct the recombinant plasmid, and use it for subsequent transformation, amplification, and functional studies.

2. Experimental Principles:
Seamless cloning (also known as recombination cloning) is a cloning technique that does not rely on restriction endonucleases and ligases. Its principle is to utilize the exonuclease activity of DNA polymerase (such as Exnase II) to generate 15-25 bp complementary single-stranded ends at the termini of the cloning vector and the insert fragment. When the vector and the insert fragment are mixed in a certain ratio, these complementary single-stranded ends anneal to form a circular DNA molecule with a gap. Subsequently, this mixture is directly transformed into competent cells, and the repair mechanism within the cells automatically fills the gap to form a complete and biologically active recombinant plasmid. This method overcomes the limitations of the traditional enzyme digestion-ligation method, allowing any fragment to be inserted into any site of the vector as long as homologous arms are designed.

3.Experimental Design:
Use plasmids pRSFDuet-1 and pET-Duet-1 to ligate the rplO, phaA and phaB, and pcT gene fragments respectively, and construct recombinant plasmids. The plasmid and recombinant plasmid maps are as follows:

Figure 1.the map of two plasmid backbones and recombinant plasmids (a.pRSFDuet-1; b.pRSFDuet-1-rplO&phaA; c.pET-Duet-1; d.pET-Duet-1-pcT&phaB)

4. Instruments, Materials and Reagents:
Instruments: Constant temperature shaker, constant temperature water bath, water bath incubator, benchtop centrifuge, low-temperature centrifuge, laminar flow hood, ultraviolet transilluminator;
Materials: Biomed™ Seamless Cloning Kit CL116, linearized cloning vector, target gene DNA fragment, sterile PCR tubes, pipette tips, 1.5 mL centrifuge tubes, Escherichia coli DH5α competent cells;
Reagents: Components in the kit, sterile ultrapure water.

5. Experimental Protocols:
(1) Prepare the reaction system according to the table below (0.2 mL PCR tube):

Component	Volume
PCR product (50-100 ng/μL)	XμL
Linearized vector (50-100 ng/μL)	YμL
2×Seamless Cloning Mix	5μL
Make up to total volume with water	10μL

(2) Gently mix and centrifuge for a few seconds. Incubate at 50℃ for 15 minutes on a PCR instrument. After the reaction, place the tube on ice for transformation experiments.
(3) Take the ligation product and add it to freshly thawed competent cells, gently mix, and incubate on ice for 20-30 minutes.
(4) Heat shock at 42℃ for 90 seconds in a water bath without disturbing the water surface. Immediately place the tube in an ice bath for 2 minutes after heat shock.
(5) Add 500 μL of LB medium to the tube and incubate in a 37℃ shaking incubator at approximately 200 rpm for 60 minutes.
(6) Centrifuge at 4000 rpm for 1 minute, discard the supernatant, and retain 100-200 μL. Resuspend the bacterial pellet gently by pipetting. Take half of the bacterial suspension and spread it on an LB solid medium plate containing antibiotics. After the liquid is absorbed, invert the plate and incubate at 37℃ overnight.

6. Reflection and Optimization:
(1) The amount of vector is generally better at 50-100 ng. The molar ratio of vector to fragment is 1:1 to 1:3. When the fragment is less than 200 bp, the amount of fragment can be increased to five times that of the vector.
(2) The reaction time at 50℃ should not exceed 60 minutes.

VII. Colony PCR

1. Experimental Objectives:
To verify the presence of plasmids in bacterial colonies through colony PCR without the need for DNA purification.

2. Experimental Principles:
Colony PCR is based on the property of high-temperature lysis of bacterial cells to release DNA. By designing universal primers for the vector and specific primers for the insert, the target DNA sequence can be directly amplified. The universal primers for the vector bind to the conserved regions on both sides of the multiple cloning site of the plasmid, while the specific primers for the insert bind within the insert fragment. The combination of these two types of primers can verify the orientation and integrity of the insert. The high-temperature treatment step in the reaction system rapidly lyses the bacterial cells, and the released DNA is amplified under the action of Taq enzyme. When the target DNA is present, the distance between the primers on both sides of the vector will produce an expected size of amplification product due to the length of the insert fragment.

3. Experimental Design:
In addition to the treatment group, empty vector control and untransformed colony control are set up.

4. Instruments, Materials and Reagents:
Instruments: PCR instrument, agarose gel electrophoresis system, ultraviolet transilluminator, microcentrifuge, super-clean bench;
Materials: Colonies to be screened, sterile PCR tubes, sterile toothpicks, pipette tips with filters, Taq enzyme and the corresponding 2×PCR Master Mix, specific primers, sterile ultrapure water;
Reagents: 2×PCR Master Mix, Forward Primer, Reverse Primer, sterile ultrapure water, 1×TAE electrophoresis buffer, DNA marker.

5. Experimental Protocols:
(1) Based on the number of colonies picked, prepare corresponding 1.5 mL microcentrifuge tubes and add 500 μL of LB broth containing kanamycin (1:1000). Use a pipette tip to pick a single colony and place it into the microcentrifuge tube. Incubate at 37°C.
(2) PCR Setup: Replace 1 μL of water with the bacterial culture. PCR Mixture (for Colony/Bacterial PCR):

Components	Volume
ddH₂O	4μL
Forward Primer	0.5μL
Reverse Primer	0.5μL
Taq Enzyme	5μL

(3) Mix the solution system thoroughly. If droplets adhere to the tube wall, perform a quick centrifugation.
Place into the PCR Instrument: (35 cycles)
95°C for 3 minutes
95°C for 30 seconds
55°C for 30 seconds
72°C for 90 seconds
72°C for 10 minutes
(4) After PCR is completed, perform gel electrophoresis to detect the products, and extract plasmids from the correct colonies.

VIII. Quantitative Detection of BHB

1. Experimental Objectives:
To quantitatively detect the BHB concentration in the fermentation broth of engineered bacteria by enzyme kinetics methods to evaluate the metabolic engineering modification effect of the engineered bacteria.

2. Experimental Principles:
This experiment employs the specific reaction catalyzed by β-hydroxybutyric acid dehydrogenase. In a buffer environment with pH 8.5, BHB is oxidized by NAD+ to acetoacetic acid and NADH under the catalysis of β-hydroxybutyric acid dehydrogenase. The reaction equation is as follows: BHB+NAD+→acetoacetic acid+NADH+H+. The generated NADH has a characteristic absorption peak at 340nm. By dynamically monitoring the increase rate of absorbance (OD value) at 340nm with a microplate reader, this increase rate is directly proportional to the BHB concentration in the sample. By comparing the reaction rate of the standard solution, the accurate concentration of BHB in the sample can be calculated.

3. Instruments, Materials and Reagents:
Instruments: Microplate reader (with 340nm filter and constant temperature incubation function), micropipettes and associated tips, vortex mixer, timer, centrifuge, pH meter;
Materials: 96-well plates, 1.5mL/2mL centrifuge tubes;
Reagents: BHB detection buffer (containing Tris-HCl, pH ~8.5), NAD+ solution (high purity, ~30mM), β-hydroxybutyric acid dehydrogenase solution, BHB standard solution (concentration gradient, for example: 0, 0.5, 1.0, 2.0, 4.0, 8.0 mM), ddH2O.

4. Experimental Protocols:
(1) Sample pretreatment: Take the fermentation broth of the engineered bacteria, centrifuge at 12,000 rpm for 5 minutes, and take the supernatant. If the sample concentration is too high, it needs to be appropriately diluted with deionized water or PBS.
(2) Preparation of working solution: According to the number of samples to be tested and standards, mix BHB detection buffer, NAD+ solution and β-hydroxybutyric dehydrogenase solution in proportion to prepare the BHB detection working solution. It should be freshly prepared and used immediately, and kept on ice.
(3) Sample addition: Add samples in a 96-well plate according to the following scheme:

Composition within the hole	Volume (μL)
BHB detection working solution	90
BHB standard or sample	10
Total volume	100

Gently mix the solution.
(4) Kinetic Detection: Place the reaction plate in the microplate reader preheated to 37°C. Immediately start the kinetic monitoring program: Detection wavelength: 340nm (main wavelength), reference wavelength can be 410nm or not used. Detection mode: Kinetic Mode. Interval time: 10-30 seconds. Total monitoring time: 5-10 minutes. The microplate reader will automatically record the absorbance change curve at 340nm for each well over time.
(5) Data Calculation and Analysis: On the kinetic curve, select the linear growth phase (usually 1-5 minutes after the reaction starts). Calculate the change in absorbance per minute (ΔOD/min) for each well during this time period, which is the reaction rate. Plot a standard curve with the concentration of BHB standard as the x-axis (X) and the corresponding average ΔOD/min as the y-axis (Y). This curve is usually a straight line passing through the origin or can be fitted with a linear regression equation. Substitute the ΔOD/min value of the sample into the regression equation of the standard curve to calculate the concentration of BHB in the sample. If the sample has been diluted, multiply the calculated concentration by the corresponding dilution factor to obtain the actual BHB concentration in the original sample.

I. Preparation of Hydrogel Core and Bacterial Encapsulation

1. Experimental Objectives:
Prepare alginate core hydrogel beads encapsulated with Escherichia coli (E. coli) Nissle 1917, which will serve as the foundation for the subsequent multi-layer hydrogel structure and act as the inner nutrient layer.

2. Experimental Principles:
Sodium Alginate is a natural polysaccharide. When the G-units on its molecular chain come into contact with divalent cations (e.g., Ca²⁺), ionic cross-linking occurs, forming a "egg-box" gel with a three-dimensional network structure. This process is carried out under mild conditions, making it suitable for encapsulating viable bacteria without causing their death.

3. Instruments, Materials and Reagents:
Instruments: Ultra-clean workbench, Autoclave, Constant temperature shaker, Analytical balance, Pipette, Syringe, Petri dish, Erlenmeyer flask
Materials: Escherichia coli Nissle 1917 strain, Parafilm
Reagents: Tryptone, Yeast extract, Sodium chloride (NaCl), Sodium Alginate (SA), Calcium chloride (CaCl₂)

4. Experimental Protocols:
(1) Prepare 200 mL of LB liquid medium (without antibiotics) and sterilize it.
(2) Formulation: Dissolve 2 g of tryptone, 1 g of yeast extract, and 2 g of sodium chloride in deionized water, then bring the total volume to 200 mL.
(3) Weigh 2.5 g of sodium alginate and dissolve it in 47.5 mL of deionized water to prepare a 5 w.t.% sodium alginate solution. Sterilize it by autoclaving at 120°C for 20 minutes to ensure sterility.
(4) Weigh 5 g of calcium chloride and dissolve it in 100 mL of deionized water to prepare a 5 w.t.% CaCl₂ solution. Sterilize it by autoclaving at 120°C for 20 minutes to ensure sterility.
(5) Inoculate E. coli Nissle 1917 into the prepared medium, and incubate it in a constant temperature incubator at 37°C for 4–6 hours.
(6) Measure the absorbance value at 600 nm using a microplate reader. According to the standard that 1 OD contains 2×10⁸ CFU, take 1 OD of bacteria (2×10⁸ CFU).
(7) Inside the ultra-clean workbench, mix 20 mL of fresh bacterial culture with 20 mL of sodium alginate solution at a volume ratio of 1:1, resulting in a final sodium alginate concentration of 2.5 w.t.%.
(8) Inside the ultra-clean workbench, load the bacteria-sodium alginate pre-mixture into a syringe; transfer the CaCl₂ solution into a petri dish, ensuring the solution covers two-thirds of the dish.
(9) Drop the mixture from the syringe into the CaCl₂ solution and allow it to solidify for 15 minutes, forming bead-shaped droplets with a controllable diameter between 2.5 mm and 3 mm.
(10) Remove the solidified hydrogel cores from the CaCl₂ solution, place them in a new petri dish inside the ultra-clean workbench, seal the dish with parafilm, and store it in a refrigerator at 4℃.

5. Precautions and Reflections:
(1) All operations must be performed under sterile conditions to prevent contamination by miscellaneous bacteria.
(2) When dropping the mixture with a syringe, control the angle of the syringe needle to obtain hydrogel beads of uniform size and regular shape.
(3) The solidification time should not be too long; otherwise, the gel will become excessively hard, which affects subsequent coating, the diffusion of nutrients, and the overall preparation effect.

II. Preparation of the Middle Adhesive Layer of Hydrogel

1. Experimental Objectives:
Wrap the core hydrogel beads with a composite coating of polydopamine-sodium alginate-polyacrylamide, which has strong adhesiveness and can prevent the passage of large DNA molecules.

2. Experimental Principles:
(1) Polydopamine (PDA): Dopamine can undergo self-polymerization under weakly alkaline conditions to form polydopamine with strong adhesiveness. It can bind to the functional groups of sodium alginate through Michael addition or Schiff base reaction.
(2) Polyacrylamide (PAM): Acrylamide (AM) undergoes free radical polymerization under the action of cross-linking agents, initiators, and catalysts to form a stable network.
(3) Secondary Cross-Linking: Using a cross-linking agent can activate the carboxyl groups of sodium alginate, forming more stable covalent bonds with the hydrazide groups on the polyacrylamide network, thereby enhancing the mechanical strength and compactness of the middle layer.

3. Instruments, Materials and Reagents:
Instruments: Ice packs, Magnetic stirrer, Analytical balance, pH meter,
Materials: Prepared hydrogel cores, Petri dishes, Erlenmeyer flasks, Graduated cylinders, Pipettes
Reagents: Sodium Alginate (SA), Dopamine Hydrochloride (DA), Sodium Hydroxide (NaOH), Acrylamide (AM), MES Buffer, NaCl, Cross-linking agent, Initiator, Catalyst

4. Experimental Protocols:
(1) Weigh 1 g of sodium alginate and dissolve it in 49 mL of deionized water to prepare a 2 w.t.% sodium alginate solution.
(2) Measure the pH of the sodium alginate solution using a pH meter, adjust the solution to weakly alkaline with 2 mol/L NaOH solution, and sterilize it by autoclaving at 120°C for 20 minutes to ensure sterility.
(3) Add 0.6 g of dopamine hydrochloride (DA) to the sodium alginate solution and stir at room temperature for 24 hours to obtain the PDA-SA solution.
(4) Under an ice-water bath (approximately 4°C), sequentially add 8 g of acrylamide (AM) and 30 mg of cross-linking agent to the above solution, and stir thoroughly until uniform.
(5) Add 60 mg of initiator and 60 μL of catalyst to the mixed solution, and mix thoroughly until uniform.
(6)Pour the above mixed solution into a clean petri dish, and immerse the hydrogel cores in it to form a thin shell layer.
(7) Accurately measure 50 mL of 0.2 M MES buffer and pour it into a clean beaker. Weigh 2.922 g of solid NaCl, add it to the above beaker, then add 30 mL of pure water, stir until the NaCl is completely dissolved, and bring the total volume to 100 mL.
(8) Weigh the cross-linking agent and catalyst, sequentially add them to the MES buffer, and dissolve and mix thoroughly.
(9) Immerse the coated hydrogel cores in the prepared MES buffer containing the cross-linking agent and catalyst to form covalent bonds and reinforce the middle layer. Maintain this state for 3 hours.
(10) Remove the reinforced hydrogel beads from the buffer, place them in a clean petri dish, seal the dish with parafilm, and store it in a refrigerator at 4℃.

5. Precautions:
(1) Acrylamide monomer is neurotoxic; gloves must be worn during operation, and weighing should be conducted in a fume hood.
(2) The cross-linking agent is prone to decomposition, so it should be prepared immediately before use to ensure the cross-linking effect.
(3) The polymerization reaction starts rapidly after adding the catalyst, so subsequent operations should be completed as soon as possible.
(4) The hydrogel cores should not be soaked in the hydrogel precursor solution for too long; otherwise, excessive cross-linking will increase brittleness and impair mechanical properties.

III. Bacterial Viability and Biocompatibility Test (Determination of Growth Curve)

1. Experimental Objectives:
To verify that the components of each layer of the hydrogel and the preparation process have no negative impact on the activity of encapsulated Escherichia coli, and to demonstrate the biocompatibility of the materials.

2. Experimental Principles:
The hydrogel is broken by mechanical homogenization to release internal bacteria, and then a microplate reader is used to continuously monitor the absorbance of the culture at a wavelength of 600nm (OD₆₀₀). OD₆₀₀ is proportional to the bacterial concentration. By plotting the growth curve, the growth of bacteria in different treatment groups can be compared.

3. Instruments, Materials and Reagents:
Instruments: Microplate reader, tissue grinder, spectrophotometer, 96-well plate, centrifuge tube.
Materials: Hydrogel samples of each group (core, with middle layer), sterile LB medium.
Reagents: Stainless steel grinding beads, sodium alginate and other materials used for preparing hydrogels.

4. Experimental Proctocols:
(1) Put hydrogel samples of different groups into centrifuge tubes containing LB medium, add grinding beads for homogenization.
(2) Measure the OD₆₀₀ of the homogenate and adjust to the same initial concentration.
(3) Add 200μL samples into 96-well plates according to groups (A-L), with 5 replicate wells in each group.
The systems of each group are as follows:
Group A: LB medium
Group B: LB medium + 5% SA (1:1 mixture)
Group C: LB medium + 5% SA + CaCl₂ (curing agent) (system: 5mL LB + 5mL SA + 0.1mL CaCl₂)
Group D: LB medium + 5% SA + PDA solution (system: 5mL LB + 4.5mL SA + 0.5mL PDA)
Group E: LB medium + 5% SA + PDA solution + initiator (system: 5mL LB + 4.5mL SA + 0.5mL PDA + 10μL initiator)
Group F: LB medium + EcN
Group G: LB medium + 5% SA + EcN
Group H: LB medium + 5% SA + CaCl₂ (curing agent) + EcN
Group I: LB medium + 5% SA + PDA + EcN
Group J: LB medium + 5% SA + PDA solution + initiator + EcN
Group K: LB medium + inner core
Group L: LB medium + hydrogel beads after coating with middle layer
(4) Place the 96-well plate in a microplate reader, culture with continuous shaking at 37°C for 24 hours, and automatically measure OD₆₀₀ at intervals.
(5) For data processing, eliminate the maximum and minimum values, take the average, and draw the growth curve.

5. Precautions:
(1) The homogenization conditions must be consistent, and the grinding must be sufficient to ensure complete release of bacteria.
(2) The edge wells of the 96-well plate have a strong evaporation effect, so do not place our samples in them; fill them with PBS or sterile water instead.
(3) Sufficient control groups must be set up in the experiment (such as medium without bacteria, bacterial solution without materials, etc.) to accurately evaluate the impact.

IV. Verification of Middle Layer Adhesion Performance

1. Experimental Objectives:
Quantitatively evaluate the adhesion ability of the hydrogel's middle layer coating to colorectal cancer cells (Caco-2 cells) and simulate the effect of the hydrogel adhering to and colonizing the intestinal tract.

2. Experimental Principles:
A monolayer of in vitro cultured Caco-2 cells is used to simulate the intestinal epithelium. Hydrogel beads are placed on the cell surface; under the shear force provided by a shaker, the adhesion strength is quantified by recording the number of gel beads that remain adhered at each time point under different shaking speeds. The stronger the adhesion, the less likely the beads are to move under shear force.

3. Instruments, Materials and Reagents:
Instruments：CO₂ incubator, Inverted microscope, Horizontal shaker, Digital camera
Materials: Culture flasks with a monolayer of Caco-2 cells, Empty culture flasks, Hydrogel cores (control group), Hydrogel beads coated with the middle layer
Reagents: Cell culture medium (high-glucose DMEM), PBS (Phosphate-Buffered Saline), Trypsin, etc.

4. Experimental Protocols:
(1) Culture and passage Caco-2 cells until a dense monolayer is formed at the bottom of the culture flask.
(2) Aspirate and discard the culture medium, then add 100 hydrogel cores and 100 hydrogel beads coated with the middle layer into two culture flasks with cell monolayers and one empty culture flask (control group), respectively.
(3) Invert the culture flasks on the shaker and take photos to record the initial position and state of all beads.
(4) Start the shaker (e.g., 50 rpm), take photos for recording every 5 minutes, and continue for 40 minutes.
(5) Change to different shaking speeds (e.g., 100 rpm, 150 rpm) and repeat the experiment.
(6) Analyze the photos: count the number of hydrogels still adhering to the cell layer at each time point (0, 5, 10, ..., 40 min) and calculate the adhesion ratio.
(7) Repeat the above experiment, calculate the average value, and evaluate the hydrogel's adhesion performance.

5. Precautions:
(1) When passaging Caco-2 cells, pipette and mix them evenly to avoid cell clumping, which may affect the flatness required for the experiment.
(2) Before the experiment, ensure that the cells are in good condition and the cell monolayer is intact.

V. Preparation of the Hydrogel Outer Layer (pH-Responsive Layer)

1. Experimental Objectives:
Construct a calcium alginate film on the outermost layer. This layer can rapidly swell and rupture in the weakly alkaline environment of the intestinal tract, thereby exposing the adhesive middle layer.

2. Experimental Principles:
The "freeze-crosslinking" method is adopted. First, the gel beads coated with the middle layer are frozen to turn the internal water into ice crystals, which destroys part of the gel structure and increases pores. Then, the beads are immersed in a CaCl₂ solution for secondary crosslinking to form a denser calcium alginate outer layer. This layer is stable in the acidic gastric juice; in the weakly alkaline intestinal juice (pH 7.4), the carboxyl groups of the alginate become ionized, generating electrostatic repulsion. This causes the gel network to absorb water, swell, and eventually rupture.

3. Instruments, Materials and Reagents:
Instruments: -20°C refrigerator, magnetic stirrer.
Materials: Hydrogel beads coated with the middle layer.
Reagents: Calcium chloride (CaCl₂), sodium alginate (SA).

4. Experimental Protocols:
(1) Place the hydrogel beads with the middle layer in a -20°C environment for freezing for 5 hours.
(2) Quickly immerse the frozen samples in a 3 w.t.% CaCl₂ solution and stir at a low speed for 20 minutes.
(3) Take out the samples and rinse them with deionized water.
(4) Immerse the samples in a 1 w.t.% SA solution again and soak for 15 minutes to form a complete calcium alginate film on the surface.
(5) Take out the finished hydrogel, rinse it with PBS buffer, and store it in a humid environment for later use.

5. Notes:
(1) Ensure sufficient freezing time to completely freeze the interior of the beads.
(2) Maintain gentle stirring during the crosslinking and film-forming processes to ensure uniform reaction.
(3) The final product should be stored in a humid environment for at least 3 hours to prevent drying and water loss, and to facilitate better crosslinking of the outer layer.

VI. Verification of the pH-Responsive Performance of the Outer Layer

1. Experimental Objectives:
Verify the swelling behavior of the hydrogel outer layer in environments with different pH values (simulated gastric juice and intestinal juice), and confirm that it possesses intestinal pH-responsive properties.

2. Experimental Principles:
Hydrogels absorb water and swell in solutions. Their swelling ratio is related to the crosslinking density of the gel network, hydrophilicity-hydrophobicity, and the environmental pH. By placing the hydrogel in PBS buffers with different pH values, periodically weighing its weight change, and calculating the swelling ratio, the pH-responsive properties of the hydrogel can be characterized. The formula is: Swelling Ratio = (Wₛ - W₀) / W₀ × 100%, where Wₛ is the weight after swelling and W₀ is the initial dry weight.

3. Instruments, Materials and Reagents:
Instruments: Analytical balance, constant temperature incubator, beakers, filter paper.
Materials: Complete three-layer structured hydrogel beads.
Reagents: PBS buffers (with pH values of 1.29, 3.64, 5.70, 7.06, 9.77, and 11.10 respectively).

4. Experimental Protocols:
(1) Dry the prepared hydrogel at room temperature for 3 hours, then weigh it to obtain the initial weight W₀.
(2) Immerse the samples in PBS buffers with pH values of 1.29, 3.64, 5.70, 7.06, 9.77, and 11.10 respectively.
(3) Place the samples in a 37°C constant temperature incubator. Take out the samples every 10 minutes, quickly blot the surface moisture with filter paper, then weigh them and record the weight as Wₛ.
(4) Continue the measurement until the weight remains basically unchanged (approximately 80 minutes).
(5) Calculate the swelling ratio at each time point according to the formula, and plot a swelling ratio-time curve.

5. Notes:
(1) When blotting the surface moisture, the operation should be quick and consistent to avoid human error.
(2) After each weighing, the solution should be replaced or its volume should be ensured to be sufficiently large to prevent the pH from changing due to leachables.
(3) The experimental environment (temperature, humidity) must be strictly controlled to ensure the repeatability of the results.

VII. Assessment of Baseline Gene Leakage from Engineered Bacteria-Hydrogel System

1. Experimental Objectives:
To quantitatively evaluate whether the hydrogel encapsulation system exhibits baseline leakage of plasmid DNA from the engineered bacteria under static, simulated intestinal conditions, in the absence of external stressors.

2. Experimental Principles:
The hydrogel beads encapsulating engineered bacteria are incubated in Simulated Intestinal Fluid (SIF) under anaerobic conditions at 37°C. Any genetic material leaking from the beads into the surrounding fluid is collected by filtration (0.22 µm) to remove intact cells. The filtrate is then analyzed using absolute quantitative PCR (qPCR) targeting a specific gene on the plasmid, allowing for the detection and quantification of even low levels of free-floating DNA, indicating leakage.

3. Instruments, Materials and Reagents
Instruments: Anaerobic jar with gas exchange system、37°C Constant Temperature Incubator、Microcentrifuge、Vortex Mixer、qPCR Instrument、Biosafety Cabinet、0.22 µm Syringe Filters (sterile)
Materials:
Experimental Group: Hydrogel beads encapsulated with engineered bacteria.
Negative Control Group: Hydrogel beads without bacteria (blank).
Sterile 1.5 mL & 2 mL Microcentrifuge Tubes
Sterile Pipette Tips (with filter)
Reagents:
· Simulated Intestinal Fluid (SIF), pH 6.8:
· 6.8 g/L KH₂PO₄
· Adjusted with NaOH
· 0.5% (w/v) Porcine Bile Salts
· 1.0% (w/v) Pancreatin
· (Sterilized by autoclaving, enzymes and bile salts added aseptically before use)
· DNA Extraction Kit (suitable for environmental samples/body fluids)
· qPCR Master Mix
· Forward and Reverse Primers (specific to the target gene on the plasmid, e.g., antibiotic resistance gene)
· Plasmid DNA Standard (for absolute quantification)
· Nuclease-Free Water

4. Experimental Protocols:
Preparation and Incubation
(1) Prepare the SIF and ensure it is at room temperature.
(2) Aseptically aliquot 5 mL of SIF into sterile tubes.
(3) Gently add 10 hydrogel beads to each tube. Designate tubes as Experimental (with bacteria) and Negative Control (blank beads).
(4) Place all tubes (caps loosened) into an anaerobic jar. Create an anaerobic atmosphere according to the manufacturer's instructions.
(5) Place the sealed anaerobic jar in a 37°C incubator for static culture.

Time-Point Sampling and Processing
(1) At each predetermined time point (Day 1, 3, and 7), remove the corresponding set of tubes from the incubator and anaerobic jar.
(2) Vortex each tube immediately at maximum speed for 10 seconds to ensure homogeneous suspension.
(3) Pipette 1 mL of the SIF incubation medium from each tube.
(4) Pass the 1 mL sample through a 0.22 µm sterile syringe filter into a new, sterile 1.5 mL microcentrifuge tube. Label the filtrate tubes clearly.
(5) Proceed directly to DNA extraction or store the filtrate at -80°C to prevent nucleic acid degradation.

qPCR Detection and Analysis
(1) Extract total DNA from 500 µL of each filtrate sample using the commercial DNA extraction kit, following the manufacturer's instructions. Elute the DNA in 50 µL of the provided elution buffer.
(2) Prepare a standard curve for absolute quantification by making a 10-fold serial dilution of the purified plasmid DNA standard (e.g., from 10⁸ copies/µL to 10¹ copies/µL).
(3) On ice, prepare the qPCR reaction mixtures in sterile PCR tubes or plates. For each 20 µL reaction:
*10 µL of qPCR Master Mix
*0.4 µL of Forward Primer (10 µM)
*0.4 µL of Reverse Primer (10 µM)
*2 µL of DNA template (from step (3).1) or standard
*Nuclease-Free Water to a final volume of 20 µL
(4) Include appropriate controls in the qPCR run: No-Template Control (NTC, water instead of DNA) and a filtrate sample from the Negative Control group.
(5) Place the reaction plate in the qPCR instrument and run the following program:
*Stage 1: 95°C for 5 minutes (Initial Denaturation)
*Stage 2: 40 cycles of:
*95°C for 15 seconds (Denaturation)
*60°C for 1 minute (Annealing/Extension)
(6) After the run, use the qPCR software to analyze the data. Generate a standard curve from the dilution series and allow the software to calculate the absolute copy number concentration for each sample.
(7) Express the final results as "Target Gene Copies per mL of SIF". Perform statistical analysis to compare the gene copy numbers between the Experimental group and the Negative Control group at each time point.

5. Precautions:
(1) Maintain strict aseptic technique throughout the procedure to prevent microbial contamination. Use nuclease-free consumables to avoid nucleic acid degradation.
(2) The 0.22 µm filtration step is critical. It must be performed correctly to ensure that only leaked genetic material, not intact bacteria, is present in the filtrate for qPCR analysis.
(3) Always include the Negative Control (blank beads) and a No-Template Control (NTC) in the qPCR setup. This is essential for identifying any background signal or contamination that could lead to false positives.
(4) Vortex the samples thoroughly before filtration to ensure any leaked material is uniformly suspended in the SIF, providing a representative sample.
(5) If the filtrate is used directly as qPCR template without DNA extraction, a test for PCR inhibition should be performed.