Cartoon Scientist Cartoon Scientist with Microscope Friendly Bacteria DNA Helix

Our experiments are designed to be replicable, providing detailed protocols, materials, and conditions. Each section below outlines the purpose, materials, and step-by-step procedures to ensure clarity and reproducibility for future iGEM teams. Explore the wet lab and hardware experiments to understand our methodology, including detailed protocols for cloning, culturing, functional assays, and hardware testing.

Wet Lab Experiments

Purpose: To clone chromoprotein genes into pUC19 plasmids for expression in E. coli, enabling visual detection of successful cloning.

pUC19 Vector Preparation - Transformation

Materials:
  • pUC19 positive control DNA (Invitrogen)
  • One Shot™ TOP10 Chemically Competent E. coli (ThermoFisher, Cat# C404003) or DH5α Competent Cells (HKABE, CUHK)
  • S.O.C Medium (ThermoFisher, Cat# 15544-034)
  • LB agar plates with ampicillin (ThermoFisher, Cat# 22700-025; Gibco™, Cat# 11593027)
Procedures:
  1. Mix 10 μL of pUC19 DNA with 1 mL of competent cells in a polypropylene tube stored at -80°C.
  2. Incubate on ice for at least 10 minutes.
  3. Heat shock at 42°C for 45 seconds.
  4. Return to ice for 2 minutes.
  5. Add 1 mL of pre-warmed S.O.C medium.
  6. Incubate at 37°C for 10 minutes for recovery.
  7. Spread 100-200 μL on an ampicillin LB agar plate.
  8. Incubate at 37°C overnight.

Purification of pUC19 Plasmids

Materials:
  • PureLink™ Quick Plasmid Miniprep Kit (ThermoFisher, Cat# K210010)
Procedures:

Follow the manufacturer’s manual. Use 50 μL of elution buffer for all preparations.

Restriction Digestion of pUC19

Materials:
  • EcoRI-HF (NEB, Cat# R3101S)
  • rCutSmart™ Buffer (NEB, Cat# B6004S)
Procedures:
Component 50 µL Reaction (µL)
DNA20 / 10
rCutSmart™ Buffer5
EcoRI-HF2
Nuclease-free Water23 / 33
  1. Incubate at 37°C for 30 minutes to 2 hours.
  2. Heat inactivate at 65°C for 20 minutes.

Gel Purification of Digested pUC19

Materials:
  • PureLink™ Quick Gel Extraction Kit (ThermoFisher, Cat# K210012)
Procedures:

Follow the manufacturer’s manual. Use 50 μL of elution buffer for all preparations.

HiFi Assembly

Materials:
  • NEBuilder® HiFi DNA Assembly Master Mix (NEB, Cat# E2621S)
Procedures:
Component Chromoproteins (μL) Negative Control (μL) Positive Control (μL)
Vector21010
Insert6--
HiFi Master Mix101010
Nuclease-free Water2--
Total Volume202020

Incubate at 50°C for 2 hours.

Colony PCR

Materials:
  • M13 forward and reverse primers (100 μM, Tech Dragon)
  • OneTaq® 2X Master Mix with Standard Buffer (NEB, Cat# M0482S)
Primers:
Primers Sequence
M13 forwardTGTAAAACGACGGCCAGT
M13 reverseCAGGAAACAGCTATGACCATG
Procedures:

Prepare master mix as follows:

Components X1 (µL)
Forward M130.5
Reverse M130.5
TemplateColonies
2X OneTaq12.5
H2O11.5
Total25

Run PCR for 30 cycles with:

Stage Temperature (°C) Time (s)
Initial Denaturation9430
Denaturation9420
Annealing5540
Extension6860
Final Extension68300

Gel Electrophoresis

Materials:
  • The MiniOne Electrophoresis System (MiniOne Systems, Cat# M1000)
  • Gel Loading Dye Purple (6X) (NEB, Cat# B7024S)
  • UltraPure™ Agarose (Invitrogen, Cat# 16500500)
  • TAE Buffer (Tris-acetate-EDTA, 50X) (ThermoFisher, Cat# B49)
  • Quick-Load® Purple 1kb Plus DNA Ladder (NEB, Cat# N0550S)
  • GelGreen™ DNA Stain 50 µL (MiniOne Systems, Cat# M3113)
Procedures:
  1. Add 5 μL of loading dye to each DNA tube.
  2. Add 25 μL distilled water and 5 μL loading dye to a new tube (negative control).
  3. Set up gel tank:
    • Prepare 1X TAE buffer for gel and tank.
    • Prepare 1% agarose gel with 1X TAE buffer.
    • Microwave gel for 1 minute to dissolve agarose.
    • Cool flask with running water.
    • Add 2 μL GelGreen™ DNA Stain per 20 mL gel.
    • Transfer formed gel to tank and cover with buffer.
  4. Add DNA samples and ladder to wells.

Purpose: To prepare and culture E. coli strains for downstream experiments.

E. coli Growth Media

Materials:
  • LB Broth Base (Lennox) (Invitrogen, Cat# 12780052)
  • LB Agar (Lennox L Agar), powder (Invitrogen, Cat# 22700025)
  • Ampicillin, sodium salt, irradiated (Gibco™, Cat# 11593027)
  • Kanamycin sulphate (Gibco™, Cat# 11815024)
Procedures:
  1. Prepare media per manufacturer’s instructions using distilled water.
  2. Sterilize using a pressure cooker (no autoclave available).
  3. Add ampicillin or kanamycin after cooling.
  4. Incubate cultures at 37°C, 180–200 rpm, unless otherwise noted.

Purpose: To test the functionality of biosensors and degradation systems for detecting and processing specific compounds.

Tetracycline Detection Assay

Materials:
  • Tetracycline hydrochloride, 96% (ThermoScientific, Cat# B21408.14)
  • Tetracycline stock solutions at 10 mg/mL, 1 mg/mL, 100 μg/mL
Procedures:
  1. Grow starter culture in 10 mL LB/Amp broth for ≥2 hours.
  2. Transfer 100 μL to 10 mL fresh LB/Amp broth, incubate ≥4 hours.
  3. Add tetracycline stock to desired concentration (e.g., 10 μL of 100 μg/mL for 100 ng/mL).
  4. Incubate ≥12 hours.
  5. Observe color change. Centrifuge at >8000 g for 1 minute if needed.

Tetracycline Bead Detection Assay

Materials:
  • Tetracycline hydrochloride, 96% (ThermoScientific, Cat# B21408.14)
  • Tetracycline stock solutions at 10 mg/mL, 1 mg/mL, 100 μg/mL
  • 2% Sodium alginate solution
  • 2% Calcium chloride solution
Procedures:
  1. Grow a starter culture of the cells in 10 mL fresh LB/Amp broth for at least 2 hours at 37°C, 180-200 rpm.
  2. Transfer 100 μL of the starter culture to fresh 10 mL LB/Amp broth and incubate for at least 4 hours at 37°C, 180-200 rpm.
  3. Mix the resulting culture with sodium alginate solution in a 1:1 volume ratio.
  4. Use a dropper to add the mixture to calcium chloride solution drop by drop to form alginate beads containing the cells.
  5. Prepare 10 mL LB/Amp culture medium with the desired concentration of tetracycline (e.g., 100 ng/mL).
  6. Add the beads to the culture medium containing tetracycline.
  7. Incubate for at least 12 hours at <30°C, 180-200 rpm.
  8. Observe the color change of the beads against a white background. For clearer observation, replace the culture medium with ddH₂O.

Salicylate Detection Assay

Materials:
  • Sodium salicylate, 99% (ThermoScientific, Cat# A17056.30)
  • Salicylate stock solution at 100 mM
Procedures:
  1. Grow starter culture in 10 mL LB/Amp broth for ≥2 hours.
  2. Transfer 100 μL to 10 mL fresh LB/Amp broth, incubate ≥4 hours.
  3. Add salicylate stock to desired concentration (e.g., 100 μL of 100 mM for 1 mM).
  4. Incubate ≥12 hours.
  5. Observe color change. Centrifuge at >8000 g for 1 minute if needed.

Tetracycline Degradation Assay

Materials:
  • Tetracycline hydrochloride, 96% (ThermoScientific, Cat# B21408.14)
  • Tetracycline stock solutions at 10 mg/mL, 1 mg/mL, 100 μg/mL
Procedures:
  1. Grow starter culture in 10 mL LB/Amp broth for ≥2 hours.
  2. Transfer 100 μL to 10 mL fresh LB/Amp broth, incubate ≥4 hours.
  3. Blank spectrophotometer with 3 mL LB/Amp at 360 nm.
  4. Add tetracycline stock to desired concentration (e.g., 50 μL of 1 mg/mL for 5 μg/mL).
  5. Mix and transfer 1.5 mL to two 1.5 mL tubes.
  6. Spin at 16,000 g for 5 minutes.
  7. Take 3 mL supernatant into a cuvette, avoiding pellet.
  8. Measure absorbance at 360 nm.
  9. Repeat the step 6-8 at designated time points.

Tetracycline Standard Curve

Materials:
  • Tetracycline hydrochloride, 96% (ThermoScientific, Cat# B21408.14)
  • Tetracycline stock solutions at 10 mg/mL, 1 mg/mL, 100 μg/mL
Procedures:
  1. Prepare tetracycline standards at 1, 2, 4, 6, 8, 10 μg/mL in LB/Amp.
  2. Blank spectrophotometer with 3 mL LB/Amp at 360 nm.
  3. Measure absorbance at 360 nm for each standard.
  4. Record absorbances and use Gemini AI for calibration equation and R² value.

SDS-PAGE of Protein Lysates

Materials:
  • 10X Bolt™ Sample Reducing Agent (Invitrogen™, Cat# B0009)
  • 4X Bolt™ LDS Sample Buffer (Invitrogen™, Cat# B0007)
  • 20X Bolt™ MES SDS Running Buffer (Invitrogen™, Cat# B0002)
  • Bolt™ Bis-Tris Plus Mini Protein Gels, 4-12%, 1.0 mm (Invitrogen™, Cat# NW04120BOX)
  • SeeBlue™ Plus2 Pre-stained Protein Standard (Invitrogen™, Cat# LC5925)
  • SimplyBlue™ SafeStain (Invitrogen™, Cat# LC6060)
  • Mini Gel Tank (Invitrogen™, Cat# A25977)
Procedures:
  1. Harvest 500 μL overnight culture, spin at 12,000 g for 1 minute.
  2. Discard supernatant, resuspend pellet in 26 μL ddH2O.
  3. Mix 400 μL reducing agent with 1 mL LDS sample buffer.
  4. Add 14 μL of the above buffer to sample, mix gently.
  5. Heat at 95°C for 10 minutes.
  6. Add 360 μL ddH2O, heat at 95°C for 10 minutes.
  7. Place on ice for 5 minutes.
  8. Prepare 1X MES SDS running buffer.
  9. Set up gel system and pre-cast gel per manual.
  10. Load 8 μL protein reference and 10 μL samples into wells.
  11. Run gel at 150V for ~20 minutes.
  12. Stain with SimplyBlue SafeStain, shake at 50 rpm for 20 minutes.
  13. Destain in ddH2O until bands are visible, changing water if needed.

Hardware Experiments

Purpose: To optimize conditions for forming alginate beads to encapsulate bacteria for biosensing applications.

Materials:

  • Lead (II) Nitrate
  • LB Broth
  • Sodium Alginate
  • Calcium Chloride

Procedures:

  1. Prepare various concentrations of sodium alginate and calcium chloride solutions.
  2. Mix 10 mL LB solution with sodium alginate solution in a 1:1 ratio.
  3. Add LB–alginate solution to calcium chloride solution to form beads.
  4. Test the following combinations:
    5. Conc. of NaAlg(aq) Conc. of CaCl(aq)
    1:301:50
    1:301:10
    1:601:50
    1:601:10
  5. Examine formed alginate beads.

Purpose: To evaluate the functionality of lead-sensitive bacteria encapsulated in alginate beads for lead detection.

Materials:

  • Lead (II) Nitrate
  • LB Broth
  • Ampicillin
  • PbrR-pPbr lead biosensor (BBa_K5152004)
  • Sodium Alginate
  • Calcium Chloride

Procedures:

  1. Grow PbrR-pPbr lead biosensor in 10 mL LB broth with ampicillin for 18 hours.
  2. Mix 10 mL LB solution with a 1:60 sodium alginate solution.
  3. Add bacterial–alginate solution to a 1:10 calcium chloride solution to form beads.
  4. Extract formed alginate beads.
  5. Add beads to 10 mL LB broth with ampicillin containing 0 mM, 0.01 mM, 0.1 mM, 1 mM, 10 mM Lead (II) Nitrate.
  6. Incubate at 37°C in a shaking incubator for 24 hours.
  7. Extract beads and observe color change.