DBTL-1

Design:

The GAT1 gene (Systematic Name: YFL021W, SGD ID: SGD: S000001873) was selected as a target. The goal of this engineering cycle is to demonstrate whether its deletion optimizes nitrogen metabolism to maximize amino acid and protein production from urea, supporting our goal of creating a sustainable single-cell protein source for astronauts. The GAT1 gene was deleted to simplify nitrogen catabolite repression control and evaluate the contribution of GAT1-dependent regulation in urea utilization.

In S. cerevisiae, nitrogen metabolism is regulated by Nitrogen Catabolite Repression (NCR), which enables preferential use of easily assimilable nitrogen sources like glutamine and ammonia. The GATA transcription factors Gln3p and Gat1p activate, while Dal80p and Nil2p repress NCR-sensitive genes. Under nitrogen-rich conditions, Ure2p sequesters Gln3p in the cytoplasm, but during nitrogen scarcity, it relocates to the nucleus to activate key assimilation genes such as GDH2 and GLN1. The TOR pathway modulates this process by controlling Gln3p and Gat1p localization in response to nitrogen availability.

Two enzymes, glutamate dehydrogenase (Gdh1p) and glutamine synthetase (Gln1p), play central roles in assimilating ammonium into glutamate and glutamine. Their activities rise under nitrogen-limited conditions and are inhibited by intracellular glutamine when nitrogen is abundant, maintaining metabolic balance. Thus, it was hypothesised that if the genes controlling these enzymes are overexpressed, in addition to the deletion of the GAT1 gene, the intracellular protein content would increase without having limit control.[1]

Build:

The GAT1 gene (Systematic Name: YFL021W, SGD ID: SGD: S000001873) [10] in S. cerevisiae (strain CENPK1D) was disrupted using a homology-based gene knockout strategy to enable precise replacement of the target locus. This approach employed the URA3 selection marker derived from the pUG72 plasmid, flanked by loxP recombination sites. To generate the disruption cassette, the loxP–URA3–loxP sequence was PCR-amplified using primers containing approximately 50 base pairs of homology to the genomic regions immediately upstream and downstream of the GAT1 open reading frame.

Primers used for amplification:

Del_GAT1_fwd: ACATATATATAGGTGTGTGCCACTCCCGGCCCCGGTATTAGCATGCAGCTGAAGCTTCGTACGC

Del_GAT1_rev: GCGGACATGGAAAGAAGCGAGTACTTTTTTTTTTTGGGGGATCTAGCATAGGCCACTAGTGGATCTG

(homologous flanking sequences are in bold letters)

These homology arms facilitated targeted integration of the cassette into the yeast genome via homologous recombination, effectively replacing the native GAT1 gene with the URA3 marker.

The linear PCR product was introduced into yeast cells using the lithium acetate transformation method. Successful transformants were selected on synthetic complete (SC) media lacking uracil (SC–Ura), confirming URA3 integration at the GAT1 locus. This strategy enabled efficient, targeted gene disruption, making it well-suited for downstream functional genomic studies. To excise the URA3 selection marker following its integration at the GAT1 locus, the knockout strain was co-transformed with plasmid pBF3036, which carries an inducible Cre recombinase gene. Cre recombinase catalyzes site-specific recombination between the loxP sites flanking the URA3 cassette, leading to its excision from the genome.

Transformants were selected on synthetic complete (SC) media supplemented with leucine to maintain the Cre-expressing plasmid. Induction of Cre expression was followed by replica plating of the colonies onto SC–Ura medium to screen for URA3 loss. Colonies that failed to grow on SC–Ura were indicative of successful marker excision. These colonies were considered confirmed GAT1 deletion mutants, in which the target gene had been disrupted and the URA3 marker subsequently removed.

Test:

S. cerevisiae strain CEN.PK1D (Parent) and del GAT1 strain were initially cultured overnight in yeast minimal media [synthetic complete medium lacking uracil (SC–Ura)].

The overnight cultures were subcultured, and the optical density at 600 nm (OD₆₀₀) was measured. This OD was correlated to the dry cell weight using experimentally observed correlations. Cell pellets from both the mutant and control strains were harvested and analyzed for total nitrogen content using Kjeldahl digestion followed by the micro-Kjeldahl method. The measured nitrogen percentage was then converted to crude protein content using a conversion factor of 6.25.

Learn:

Overall deletion of GAT1 caused an increase in the protein content as hypothesised.

DBTL-2

Iteration 1

Design:

In S. cerevisiae, the majority of nitrogen used for amino acid biosynthesis is derived from glutamate and glutamine. Approximately 85% of the cellular nitrogen originates from the amino group of glutamate, while the remaining 15% is contributed by the amide group of glutamine. These two amino acids serve as central nitrogen donors, playing a crucial role in maintaining nitrogen balance and supporting protein synthesis within the cell. In the present study, we sought to increase nitrogen content in the Del GAT1 + S. cerevisiae CENPK.1D by overexpressing enzymes involved in nitrogen metabolism. Through strategic overexpression of key nitrogen metabolism genes GDH1 and GLN1, the modified strains are expected to exhibit improved growth and biomass production, thereby boosting the potential of these yeasts as Single Cell Protein (SCP) sources.[1]

Build:

Recombinant plasmids containing the GDH1 (Systematic Name: YOR375C, SGD ID: SGD:S000005902) BBa_25TI69KR[10] and GLN1 (Systematic Name: YPR035W, SGD ID: SGD:S000006239) BBa_25GT9CLB [11] genes were initially isolated from S. cerevisiae CEN.PK1D genomic DNA using the following primers.

Primers for GDH1:

Fwd_GDH1_BamHI: CGCGGATCCATGTCAGAGCCAGAATTTC

Rev_GDH1_Xhol: CCGCTCGAGTTAAAATACATCACCTTGGTC

Primers for GLN1:

Fwd_GDH1_BamHI: CGCGGATCCATGGCTGAAGCAAGCATC

Rev_GDH1_Xhol: CCGCTCGAGTTATGAAGATTCTCTTTCAAATTCC

PCR conditions for amplification included an annealing temperature of 57°C and an extension time of 2 minutes, optimized for the sizes of GDH1 (1362 bp) and GLN1 (1110 bp), respectively.

These isolated genes were separately recombined with pRS426-GPD with GPD promoter and CYC1 terminator using the plasmid backbone digested with restriction enzymes BamHI and Xhol.

Recombinant plasmids containing the GDH1 and GLN1 genes were successfully introduced into the delGAT1 mutant. Following the transformation, positive clones were identified through selection on appropriate media (minimal media).

This experimental setup allows a direct comparison of GDH1 and GLN1 activity in the presence of GAT1, a central transcriptional regulator involved in nitrogen metabolism, in comparison to the original S. cerevisiae strain.

Test:

By examining these strains side-by-side, we can better understand how GAT1 influences the cellular response to enhanced nitrogen assimilation. Targeted manipulation of key metabolic genes can significantly improve protein production, even in strains lacking native regulatory elements. To evaluate the impact of GDH1 and GLN1 overexpression on protein accumulation in del GAT1 strain S. cerevisiae, total nitrogen content was determined using the Kjeldahl method. The delGAT1 mutant strains were transformed with either GDH1, GLN1 and grown in triplicate in synthetic URA dropout minimal medium. Cultures were harvested at mid-log phase, and nitrogen content was converted to protein using a conversion factor of 6.25.

Learn:

Overexpression of GDH1 with the deleted GAT1 gene gave the most protein content, followed by the overexpressed GLN1 with the deleted GAT1 gene and the deleted GAT1 strain. This further reinforces our initial hypothesis.

Iteration 2

Design:

These results indicate that the modified S. cerevisiae strains have the potential to be utilized for nitrogenous waste recycling. Implementing this circular economy approach could contribute to addressing global protein deficiency challenges. Moreover, this principle holds particular promise for closed environments such as the International Space Station (ISS), where efficient resource recovery and waste utilization are of critical importance while also addressing the pressing issue of protein deficiency in astronauts, leading to a reduction in muscle mass.

Build:

Recombinant plasmids containing the GDH1 and GLN1 genes were successfully introduced into both the wild-type S. cerevisiae strain and the delGAT1 mutant. Following the transformation, positive clones were identified through selection on appropriate media. This experimental setup allows a direct comparison of GDH1 and GLN1 activity in the presence of GAT1, a central transcriptional regulator involved in nitrogen metabolism, in comparison to the original S. cerevisiae strain.

Test:

The same tests were carried out for the modified and unmodified strains, but in a urea medium.

Learn:

This shows us promising results, especially in the GDH1+delGAT1 strain when compared to the unmodified parent strain

There is a high possibility that the results of this experiment are erroneous; there was no opportunity to reperform this due to the time constraint. Further testing will be carried out post-wiki-freeze.

Rad51

Design:

We identified the sequence of RAD51 from the SGD. And planned to use pRS426 high copy plasmid along with GPD promoter and a CYC1 terminator. The GPD is a highly used strong constitutive promoter which will drive continuous expression of our target RAD51 gene and will not be dependent on external stimuli to regulate its expression. The logic behind using a constitutive promoter is that in space, the organism is always exposed to some type of harmful radiation so it will require continuous expression of the gene. While the CYC1 terminator will stop the expression of genes to the downstream of our target and GFP. The GFP will be used as a screening marker to confirm the expression of RAD51.(fig. 1.2)

Build:

The primers for RAD51 were designed for PCR amplification of the gene.

Forward Primer- Fwd_RAD_BamHI: GCGGGATCCATGTCTCAAGTTCAAGAACAAC

Reverse Primer- Rev_RAD_HindIII: GCGAAGCTTCTACTCGTCTTCTTCTCTGG

The genomic DNA of a wild type yeast was extracted for PCR amplification of RAD51. After the genomic dna extraction the concentration was confirmed by Nanodrop machine. (fig 1.3)

The initial iteration of PCR was successful but the yield was too low. So we adjusted the PCR conditions but it did not yield any results. The team performed 9 PCR cycles as well as 3 genomic DNA extractions.The PCR continuously yielded Dimers in amplification but after a few iterations, we got successful iteration. The Restriction Digestion and further steps of this cycle are ongoing but would not be complete until wiki freeze.

Test:

The modified strain was to be tested by performing a spread plate on a YPD+agar media plate, one streaked with the wild type yeast and one with overexpressed RAD51. It is being continued in the wet lab but the build would not be complete until wiki freeze.

Learn:

Future teams can try to overexpress RAD51 by various other means such as by using synthesized sequence of the gene or by directly changing the promoter in genomic DNA to upregulate its expression as a faster way to overexpress it.

DSUP

Design:

According to the literature survey and Part: BBa_K2195000 from iGEM registry, along with other references [1][2] we can confirm that DSUP has the ability to affect the survival rate in host organisms even while not being native to the organism. Hence we did the Codon optimization of the sequence of DSUP gene for Saccharomyces cerevisiae. This was then synthesized by Twist Biosciences.

We planned to use a GPD constitutive promoter since the logic behind using a constitutive promoter is that in space, the organism is always exposed to some type of harmful radiation so it will require continuous expression of the gene. DSUP is used along with CYC1 terminator.

Build:

The clonal plasmids had restriction sites Xba1 and Xho1. These clonal plasmids were transformed into E.coli DH5α competent cells. After incubating this transformed strain, plasmid prep was done for this Dh5α strain.

Simultaneously, a blank Dh5α containing pRS426 plasmid was inoculated in 7ml of of LB+Amp media.

After 16hours of incubation at 37 degree celsius, plasmid prep was done and the pRS426 plasmid was isolated.

The clonal plasmids containing DSUP insert along with pRS426 plasmid were digested along with Tango buffer and Restriction enzymes Xba1 and Xho1 for 4.5hrs. After digestion, the insert from clonal plasmid containing DSUP was separated using Gel Electrophoresis.

The insert was then purified and stored at -20 degrees celsius.

Until the wiki freeze we could only do the ligation. Transformation of this plasmid vector containing pRS426GPD backbone and DSUP gene insert into Saccharomyces cerevisiae will be done post wiki freeze. And the work will continue on this DBTL cycle even post wiki freeze.

Test:

Since there are strict rules from iGEM of containing strains within the lab even for testing, we have a UV facility in the lab to test its growth under radiation setup.

Learn:

The learnings of this part will help us understand if the hypothesis stands true for DSUP being expressed in Saccharomyces cerevisiae as well. If the system works, future teams working on Space village projects can take advantage of this system to use the modified Saccharomyces cerevisiae as a chassis for biomanufacturing in space.

Melanin Film

Design:

A serendipitous discovery made in our lab of melanin production was made while studying the nutritional requirements of different amino acids of P. vulgaris. When P. vulgaris was cultured in a medium in the presence of L-tyrosine, it gave eumelanin via the dopamine (catecholamine) biosynthetic pathway

To capitalise on this finding, we integrated this eumelanin production pathway into our design for radiation protection, leveraging the well-established UV-shielding properties of eumelanin to enhance the resilience of our chassis against space radiation. We decided to coat our bioreactor with a layer of eumelanin for additional radiation resistance. We ideated a system in which a eumelanin-suspended liquid could be circulated on the outside of the bioreactor, but this was soon discarded as setting up such a mechanism for eumelanin circulation would need to be extremely sophisticated and would not be payload-effective. Another method of dispersing the eumelanin in PMMA, painting it onto the bioreactor and allowing it to dry was hypothesised. This was discarded as we were unsure of getting an even coat of paint onto the bioreactor.

Finally, we arrived at the idea of dispersing melanin into a PVA sheet as:

1. PVA is well known to be lightweight and porous which would help us with payload reduction and heat dissipation(from the reactor)
2. PVA was chosen as it is inert to the NaOH needed to dissolve the eumelanin
3. A reusable PVA sheet seemed to be the most sustainable method for radiation protection in outer space settings

These sheets would be synthesized on earth and consequently be sent as replacements for the bioreactor in space when required.

Build:

Melanin was produced using the above-mentioned metabolic pathway present in P. vulgaris. P. vulgaris was cultured in a medium containing L-tyrosine and incubated for a week. The culture flask gradually turned darker until it became almost black, indicating the presence of eumelanin. This eumelanin was then extracted from the culture medium as documented in the protocols

The dried eumelanin powder was consequently used for making a biopolymer with PVA. The eumelanin was dissolved in a NaOH solution and added to the PVA solution(detailed in the lab notebook). This solution was then dried to make the biopolymer sheets of 10w/v% PVA and 0.05w/v% eumelanin. Further testing was done on the eumelanin itself, as well as the biopolymer sheet was carried out as detailed below.

Test:

A preliminary visual test was done to evaluate the effectiveness of this eumelanin-containing biopolymer in UV shielding by placing it on a transilluminator and comparing it with a control sheet.

This shows us that our biopolymer sheet is very effective at reflecting and absorbing UV, visible light. UV shielding ability quantification of the sheets spread plates of S. cerevisiae were made of dilution 10^4, 300 microlitres of diluted culture was plated onto an agar medium, exposed to UV light in a LAF for 1 hour. The first plate was covered with a sheet of PVA+melanin+NaOH The second plate was covered with a control sheet of PVA+NaOH Both of these were placed in the LAF for testing The third uncovered plate was placed outside the LAF as a control Subsequently, all three spread plates were incubated at 37degC for 2 days

Results obtained:

• Control Plate (uncovered, outside LAF): Showed normal growth, as it was not exposed to UV radiation. (1.17 x 104 CFUs)

• Control Plate (PVA + NaOH only): Showed reduced colony growth, indicating that PVA alone provides minimal UV shielding.(Negligible number of CFUs)

• Test Plate (PVA + melanin + NaOH): Displayed significantly higher colony survival under UV compared to the PVA-only sheet. Interestingly, the melanin-covered plate showed even more growth than the plate outside UV, suggesting that brief, shielded UV exposure enhanced yeast survival.(1.85 x 104 CFUs)

This observation is supported by previous findings that S. cerevisiae cells pre-exposed to low UV doses develop an epigenetically inherited resistance, resulting in enhanced survival upon subsequent UV exposure [2].

An important observation was made- after an hour of UV exposure, the control sheet showed visible burns and crumpling at the edges, while the PVA+melanin sheet showed no such damage

Our research will involve a collaboration with Dr. Jo Ninan from the Tata Institute of Fundamental Research (TIFR) to further test the efficiency of our newly synthesized PVA + melanin sheets. Due to time constraints, this phase of the experiment will be conducted at a later date.

In this planned experiment, we will utilize Dr. Ninan's expertise in balloon testing to evaluate our material's protective properties. Plates of S. cerevisiae ( baker’s yeast, not our lab strains) will be covered with the synthesized PVA + melanin sheets. These covered plates will then be attached to a high-altitude balloon and sent into the upper atmosphere.

The primary objective of this experiment is to assess the viability of the yeast on the plates after being exposed to the extreme environmental conditions of the upper atmosphere, such as low pressure, cold temperatures, and increased cosmic and ultraviolet radiation. We hypothesize that the melanin component in the sheets will provide significant protection, thereby preserving the viability of the S. cerevisiae. The results of this test will provide crucial data on the durability and protective efficiency of our novel material.

Learn

• An issue of uneven melanin distribution in the sheets was observed in the initial stages; for this reason, we sonicated the PVA+melanin solution before casting it for drying to ensure even distribution

• The higher CFU count in the irradiated sample shielded by the biopolymer might suggest some amount of encouragement in the growth of S. cerevisiae under a small amount of radiation

• The visible damage to the control sheet(caused by overheating due to UV radiation) in comparison to none in the sheet containing eumelanin in addition to the transilluminator, results clearly indicate a significant reflectance and absorption of UV radiation in these biopolymer sheets