Week 1: Primer Design and Preparation; (05.04.2025 - 11.04.2025)

• Retrieved the GAT1 gene sequence (YFL021W) from the Saccharomyces Genome Database (SGD).
• Designed primers with ~50 bp homology arms flanking the GAT1 open reading frame.

Del_GAT1_fwd:
ACATATATATAGGTGTGTGCCACTCCCGGCCCCGGTATTAGCATGCAGCTGAAGCTTCGTACGC

Del_GAT1_rev:
GCGGACATGGAAAGAAGCGAGTACTTTTTTTTTTTGGGGGATCTAGCATAGGCCACTAGTGGATCTG

(homologous flanking sequences are in bold letters)

• Ordered custom primers from a commercial supplier for disruption cassette amplification.
• Prepared competent E. coli DH5α cells for plasmid propagation and storage.
• Prepared SC–URA, SC–LEU, and YNB + ammonium sulfate media for yeast culture and selection.
• Autoclaved agar separately from YNB/ammonium sulfate to prevent precipitation.
• Extracted genomic DNA from S. cerevisiae CEN.PK1D for use as a PCR verification template.

Week 2: Disruption Cassette Construction & Yeast Transformation; (13.04.2025 - 18.04.2025)

• PCR-amplified loxP–URA3–loxP cassette from the pUG72 plasmid using the designed primers.
• Confirmed PCR amplification by agarose gel electrophoresis; observed a single, clear band of the expected size.
• Purified the PCR product using a gel extraction kit.
• Transformed S. cerevisiae CEN.PK1D with the linear loxP–URA3–loxP disruption cassette using the lithium acetate method.
• Plated transformed cells onto SC–URA plates for selection of positive transformants.
• Incubated plates at 30°C and monitored colony growth for 2–3 days.

Week 3: Verification of GAT1 Knockout; (20.04.2025 - 26.04.2025)

• Picked well-isolated colonies from SC–URA selection plates.
• Performed colony PCR using flanking primers to verify successful integration at the GAT1 locus.
• Analyzed PCR band sizes via agarose gel electrophoresis to confirm correct GAT1::URA3 replacement.
• Cultured confirmed knockout strains in SC–URA broth for propagation.
• Prepared glycerol stocks of verified transformants for long-term storage at –80°C.
• Propagated pBF3036 (Cre recombinase plasmid) in E. coli, isolated plasmid DNA for subsequent yeast transformation.

Week 4: URA3 Marker Excision; (28.04.2025 - 30.04.2025)

• Transformed GAT1::URA3 strains with pBF3036 (Cre recombinase plasmid).
• Selected transformants on SC–LEU plates to maintain plasmid selection.
• Induced Cre recombinase expression to excise the URA3 marker via loxP sites.
• Replica-plated transformants onto SC–URA plates to identify colonies that lost URA3.
• Colonies that failed to grow on SC–URA were identified as ΔGAT1 mutants.
• Validated URA3 excision and GAT1 deletion through PCR verification using external primers.

Week 5: Phenotypic Testing – Nitrogen Analysis; (02.05.2025 - 10.05.2025)

• Cultured both wild-type (WT) and delGAT1 strains overnight in SC–URA medium.
• Subcultured cells to an initial OD₆₀₀ = 0.05 and incubated until mid-log phase.
• Harvested cells by centrifugation for Kjeldahl nitrogen analysis.
• Conducted digestion, neutralization, and distillation steps.
• Performed UV Spectroscopy to measure OD 420 of the digested mixture.
• These steps were performed to determine total nitrogen content.
• Converted nitrogen percentage to crude protein using the standard factor of 6.25.
• Compared the total nitrogen and protein content between WT and ΔGAT1 strains.
• Observed reduced nitrogen and protein content in ΔGAT1 mutants, confirming GAT1’s regulatory role in nitrogen metabolism.

Week 1: Target Selection and Experimental Design; (19.05.2025 - 24.05.2025)

• Reviewed background on nitrogen assimilation in S. cerevisiae: ~85 % of nitrogen for amino acid biosynthesis originates from the amino group of glutamate, and ~15 % from the amide group of glutamine.
• Selected GDH1 (Systematic Name: YOR375C, SGD ID: SGD:S000005902) (glutamate dehydrogenase) and GLN1 (Systematic Name: YPR035W, SGD ID: SGD:S000006239) (glutamine synthetase) as target genes for overexpression to improve nitrogen uptake and protein synthesis.
• Designed primers and collected gene sequences for cloning.

(Restriction sites are underlined)

Primers for GDH1;
Fwd_GDH1_BamHI: CGCGGATCCATGTCAGAGCCAGAATTTC
Rev_GDH1_Xhol: CCGCTCGAGTTAAAATACATCACCTTGGTC

Primers for GLN1; Fwd GLN1_BamHI: CGCGGATCCATGGCTGAAGCAAGCATC Rev_GLN1 Xhol: CCGCTCGAGTTATGAAGATTCTCTTTCAAATTCC

• Prepared competent S. cerevisiae ΔGAT1 (CEN.PK 1D) cells for transformation.
• Set up plasmid maps and expression constructs under suitable promoters.

Week 2: Plasmid Construction and Yeast Transformation; (25.05.2025 - 30.05.2025)

• Constructed recombinant plasmids carrying the GDH1 and GLN1 genes.
• Verified constructs by restriction digestion and agarose gel electrophoresis.
• Transformed S. cerevisiae ΔGAT1 cells with GDH1 and GLN1 plasmids separately.
• Performed selection on the URA dropout minimal medium to isolate transformants.
• Confirmed positive colonies by colony PCR and stored glycerol stocks for both transformants and control (ΔGAT1).
• Began pre-cultures for growth and expression analysis.

Week 3: Culture Inoculation and Expression Verification; (01.06.2025 - 07.06.2025)

• Inoculated triplicate cultures of delGAT1, delGAT1 + GDH1, and delGAT1 + GLN1 in synthetic URA dropout minimal medium for comparative growth studies.
• Monitored OD₆₀₀ values at regular intervals to track growth kinetics.
• Extracted total RNA and verified GDH1 and GLN1 expression by PCR amplification; observed clear bands on agarose gel, confirming successful overexpression.
• Prepared cultures for biochemical assays and stored aliquots for nitrogen estimation.

Week 4: Nitrogen and Protein Analysis; (09.06.2025 - 16.06.2025)

• Harvested all three strains at mid-log phase for nitrogen and protein analysis.
• Performed the Kjeldahl method for total nitrogen determination:
  • Step 1 – Digestion with concentrated H₂SO₄ to convert organic N → NH₄⁺.
  • Step 2 – Neutralization with NaOH and distillation.
  • Step 3 – Performed UV Spectroscopy to measure OD 420 of the digested mixture.
• Calculated nitrogen (%) and converted to protein content using the factor 6.25.
• Recorded OD₆₀₀ and dry cell weight for biomass comparison.

Week 1: Engineering Yeast for Nitrogen Recycling; (18.06.2025 - 24.06.2025)

• Modified S. cerevisiae strains were designed to recycle nitrogenous waste into usable protein forms, contributing to a circular bioeconomy framework. This approach has potential applications in addressing global protein deficiency and sustaining closed environments such as the International Space Station (ISS), where efficient waste utilization and nutrient recovery are vital for astronaut health and muscle mass maintenance.
• Recombinant plasmids containing the GDH1 and GLN1 genes were successfully constructed and introduced into both the wild-type S. cerevisiae and the ΔGAT1 mutant strain. Transformants were screened and confirmed using selective media, setting the foundation for comparing nitrogen metabolism in the presence and absence of GAT1, a key transcriptional regulator.

Week 2: Preliminary Assessment of Nitrogen Assimilation; (28.06.2025 - 04.07.2025)

• Both modified and unmodified yeast strains were grown in urea-based minimal medium to assess their growth performance and nitrogen assimilation efficiency. Early results suggested promising outcomes, particularly in the GDH1+ΔGAT1 strain, which exhibited enhanced nitrogen utilization compared to the unmodified parent strain.
• However, the results remain preliminary, as time constraints prevented repeat trials. Further testing and data validation are planned post–wiki freeze to confirm the observed improvements and ensure experimental reliability.

Week 1: Melanin Biosynthesis and Biopolymer Fabrication; (03.08.2025 - 13.08.2025)

• While studying amino acid utilization in P. vulgaris, a serendipitous observation was made — cultures grown with L-tyrosine produced eumelanin through the dopamine (catecholamine) biosynthetic pathway. Recognizing its UV-shielding potential, this pathway was integrated into our radiation protection design.
• After evaluating several coating strategies, we finalized the idea of embedding eumelanin in a PVA matrix. PVA was selected for being lightweight, porous, and chemically inert to NaOH, aiding both payload reduction and thermal stability.
• During the week, P. vulgaris was cultured for seven days, progressively darkening to black, confirming melanin synthesis. The pigment was extracted, purified, and dried, then dissolved in NaOH and mixed with 10 w/v % PVA to yield 0.05 w/v % eumelanin–PVA solution. After sonication, the mixture was cast and dried into uniform biopolymer sheets for testing.

Week 2: UV-Shielding Evaluation and Yeast Survival Testing; (15.08.2025 - 21.08.2025)

• Initial UV-shielding tests were performed using a transilluminator. The PVA + melanin sheet visibly blocked more UV light compared to the PVA + NaOH control, confirming its optical protective properties.
• For quantitative testing, S. cerevisiae spread plates (10⁴ dilution) were exposed to UV for 1 h inside a LAF hood:
  • PVA + melanin sheet: 1.85 × 10⁴ CFUs
  • PVA + NaOH control: negligible CFUs Uncovered control (outside LAF): 1.17 × 10⁴ CFUs
• The melanin-coated plate showed higher yeast survival and no visible damage, while the control sheet exhibited burning and edge deformation.
• Plans were made to collaborate with Dr. Joe Ninan (TIFR) for high-altitude balloon testing to simulate upper-atmosphere radiation.

Week 1: Rad51 Cloning and PCR Optimization; (21.09.2025 - 28.09.2025)

• The Rad51 sequence was retrieved from the SGD database. A pRS426 high-copy plasmid was chosen for gene expression, along with a GPD constitutive promoter and a CYC1 terminator. The GPD promoter ensures continuous expression of Rad51, which is critical for radiation resistance in space, while the CYC1 terminator prevents downstream gene expression interference. GFP was included as a screening marker to confirm Rad51 expression.
• Primers were designed for PCR amplification of Rad51:

Forward Primer (Fwd_RAD_BamHI): GCGGGATCCATGTCTCAAGTTCAAGAACAAC
Reverse Primer (Rev_RAD_HindIII): GCGAAGCTTCTACTCGTCTTCTTCTCTGG

• Genomic DNA was extracted from wild-type yeast and quantified using a Nanodrop. Initial PCR attempts produced dimers and low yield despite repeated genomic DNA extractions and 9 PCR cycles. After further optimization, a successful amplification of Rad51 was obtained.

Week 2: Preliminary Functional Assay and Future Planning; (29.09.2025 - 04.10.2025)

• A spread plate assay was set up to compare wild-type yeast and yeast with overexpressed Rad51 on YPD agar. While the test is ongoing in the wet lab, data collection and validation will continue after the wiki freeze.
• Lessons from this work suggest that future teams could achieve Rad51 overexpression more efficiently by:
  • Using a synthesized gene sequence instead of genomic amplification.
  • Modifying the native promoter in the genome to directly upregulate Rad51 expression.

Week 1: Week 1 ; (21.09.2025 - 29.09.2025)

• Based on the literature and BBa_K2195000 from the iGEM registry, DSUP has been reported to improve host organism survival under radiation, even in non-native systems. The DSUP sequence was codon-optimized for Saccharomyces cerevisiae and synthesized by Twist Biosciences. A GPD constitutive promoter was chosen to ensure continuous expression in space conditions, and a CYC1 terminator was included downstream.
• Clonal plasmids containing DSUP with XbaI and XhoI restriction sites were transformed into E. coli DH5α competent cells. After incubation, plasmid prep was performed. Simultaneously, a blank pRS426 plasmid was cultured in LB + Amp media and isolated after 16 hours at 37 °C. Both the DSUP-containing plasmids and the pRS426 plasmid were digested with XbaI and XhoI in Tango buffer for 4.5 hours, and the DSUP insert was separated using gel electrophoresis.
• The insert was purified and stored at –20 °C, while challenges with pRS426 digestion were addressed by switching to FD (Fast Digested) buffer after one week of iteration.

Week 2; (30.09.2025 - 04.10.2025)

• Due to time constraints, only the ligation of the DSUP insert into the pRS426GPD backbone was completed by the wiki freeze. Transformation of this plasmid into S. cerevisiae will be performed post-wiki freeze.
• For future functional testing, a UV facility is available to evaluate growth under controlled radiation conditions, in compliance with iGEM containment rules.