1. Preparation of LB (Luria-Bertani) Medium

​ a. Preparation of LB Liquid Medium according to the following table:

Table. LB Liquid Mediu

Reagent	Weight（g/L）
Tryptone	10
Yeast extract	5
NaCl	10
ddH20	Add to 1 L

b. LB Solid Medium (containing Agar)

Add 15 g/L agar powder to the liquid LB medium formula for plate preparation.

Preparation Procedure:

Weighing: Weigh each component proportionally (e.g., halve all amounts for 500 mL) and dissolve completely using a magnetic stirrer.

Sterilization: Autoclave at 121 °C for 20 minutes.

Pouring Plates (Solid Medium): Cool to approximately 50 °C, add the appropriate antibiotic(s), pour into sterile Petri dishes, and allow to solidify before use.

2．L1 Vector Construction

The reaction system and procedure for L1 vector assembly are as follows:

3．Transformation of L1 Vector into E. coli Competent Cells DH5α

​ a) 10 μl of the L1 ligation product was added to thawed E. coli DH5α competent cells kept on an ice-water mixture.

​ b) The mixture was gently mixed by pipetting and incubated on ice for 25 minutes.

​ c) A heat shock was performed in a 42°C water bath for 90 seconds, followed by immediate placement on ice for 5 minutes.

​ d) 500 μl of LB medium without antibiotics was added.

​ e) The cells were incubated at 37°C with shaking for 1 hour for recovery.

​ f) The culture was centrifuged at 5000 rpm for 3 minutes.

​ g) Approximately 500 μl of supernatant was discarded, and the remaining supernatant was used to resuspend the cell pellet.

​ h) The resuspended cells were spread onto LB solid medium containing ampicillin (50 mg/L) using the two-half uneven spreading method.

​ i) Plates were incubated inverted at 37°C overnight.

4. Colony PCR Identification of L1 Vector

​ a) Single colonies were picked the next day into 200 μl of LB liquid medium containing ampicillin and incubated at 37°C with shaking for 3 hours.

​ b) Colony PCR was performed to amplify the target gene.

​ c) Clones identified as correct by preliminary PCR screening were selected.

​ d) 100 μl of bacterial culture from each positive clone was submitted for sequencing.

​ e) Sequencing was performed by Sangon Biotech.

5．Plasmid Extraction of L1 Vector

A sequenced-verified positive clone was inoculated into 500 μl of LB liquid medium containing ampicillin and cultured overnight. Plasmid DNA was subsequently extracted using the TIANprep Mini Plasmid Kit (Tiangen Biotech). The extracted L1 plasmid was used for the subsequent construction of the L2 vector.

The plasmid extraction procedure was performed as follows:

(1) Column Equilibrium: Add 500 μl of Balance Solution BL to the adsorption column CP3 (placed in a collection tube). Centrifuge at 12,000 rpm (~13,400×g) for 1 min. Discard the flow-through and reassemble the column with the collection tube. Note: Use columns processed on the same day.

(2) Harvest Cells: Transfer 1-5 ml of overnight bacterial culture to a microcentrifuge tube. Pellet the cells by centrifugation at 12,000 rpm (~13,400×g) for 1 min and carefully aspirate the supernatant. Note: For larger culture volumes, repeat centrifugation to collect all pellets into one tube.

(3) Resuspend Pellet: Add 250 μl of Solution P1 (ensure RNase A has been added) to the cell pellet. Resuspend the pellet completely by pipetting or vortexing. Note: Incomplete resuspension will reduce yield and purity.

(4) Lysate Cells: Add 250 μl of Solution P2 to the tube. Mix gently by inverting the tube 6-8 times until the solution becomes clear and viscous. Note: Mix gently to avoid shearing genomic DNA. Do not exceed 5 minutes for this step. Incomplete clearing indicates insufficient lysis; use less starting material.

(5) Neutralize Lysate: Add 350 μl of Solution P3 to the tube. Mix immediately by inverting 6-8 times. A white precipitate will form. Centrifuge at 12,000 rpm (~13,400×g) for 10 min. Note: Mix immediately after adding P3. If precipitate remains, centrifuge again before proceeding.

(6) Bind DNA: Transfer the supernatant from step (5) to the pre-equilibrated CP3 column. Centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec. Discard the flow-through and reassemble the column.

(7) Optional Wash: Add 500 μl of Protein Removal Solution PD to the column. Centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec. Discard the flow-through and reassemble the column.

(8) Wash Column: Add 600 μl of Wash Solution PW (ensure ethanol has been added) to the column. Centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec. Discard the flow-through and reassemble the column.

(9) Repeat Wash: Repeat step (8).

(10) Dry Column: Centrifuge the empty column at 12,000 rpm (~13,400×g) for 2 min to remove residual ethanol. Note: Residual ethanol may inhibit downstream enzymatic reactions. Air-dry the column for 2-5 min with the lid open.

(11) Elute DNA: Place the CP3 column in a clean microcentrifuge tube. Add 50-100 μl of Elution Buffer EB to the center of the membrane. Let it stand at room temperature for 2 min, then centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the plasmid DNA. The plasmid concentration was determined using a Nanodrop 2000 spectrophotometer.

6．L2 Vector Construction

The reaction system for L2 vector construction is listed in the table below:

Table. Reaction System for L2 Vector Construction

The assembly procedure for the L2 vector was identical to that used for the L1 vector.

​ a) 10 µL of the L2 ligation product was added to thawed E. coli DH5α competent cells on an ice-water mixture. The mixture was gently pipetted to mix and placed on ice for 30 minutes.

​ b) A heat shock was applied in a 42°C water bath for 90 seconds, followed by immediate transfer to ice for 2 minutes.

​ c) 500 µL of LB medium without antibiotics was added, and the cells were incubated at 37°C with shaking for 45 minutes for recovery.

​ d) The culture was centrifuged at 5000 rpm for 5 minutes. Approximately 500 µL of supernatant was discarded, and the remaining medium was used to resuspend the cell pellet.

​ e) The resuspended cells were spread onto LB solid medium containing kanamycin (50 mg/L) using the two-half uneven spreading method.

​ f) Plates were incubated inverted at 37°C overnight.

​ g) The following day, single colonies were picked into 200 µL of LB liquid medium containing kanamycin (50 mg/L) and incubated at 37°C with shaking for 3 hours.

​ h) Colony PCR was performed for verification.

​ i) 100 µL of bacterial culture from PCR-positive clones was submitted for sequencing, which was performed by Sangon Biotech and Tsingke Biotech.

​ j) Following sequence verification, positive clones were expanded for culture. Subsequently, glycerol stocks were prepared, and plasmid DNA was extracted using the TIANprep Mini Plasmid Kit (Tiangen Biotech) as described previously.

​ k) The extracted L2 plasmid was used for subsequent Agrobacterium transformation.

7．Electroporation of Agrobacterium tumefaciens Ar.1193

​ 1) Competent A. tumefaciens Ar.1193 cells, stored at -80°C, were thawed on ice.

​ 2) 1 µL of L2 plasmid (200 ng/µL) was added to the cells, mixed gently by pipetting, and the mixture was immediately returned to ice for 2 minutes.

​ 3) The mixture was transferred to a 1 mm electroporation cuvette.

​ 4) Electroporation was performed at 1.5 kV.

​ 5) Immediately after pulsing, the cuvette was placed on ice for 5 minutes.

​ 6) The cell suspension was transferred to a sterile tube using a pipette.

​ 7) 500 µL of TY medium containing 10 mM CaCl₂ was added, and the cells were incubated at 28°C with shaking for 2 hours for recovery.

​ 8) The culture was centrifuged at 6000 rpm for 1 minute. Approximately 500 µL of supernatant was discarded, and the pellet was resuspended in the remaining medium.

​ 9) The suspension was spread onto TY solid medium containing kanamycin (25 mg/L), streptomycin (15 mg/L), rifampicin (20 mg/L), and 10 mM CaCl₂.

​ 10) Plates were incubated inverted at 28°C overnight.

​ 11) Single colonies were picked into 200 µL of TY liquid medium containing the same antibiotics as the solid medium and incubated overnight at 28°C with shaking.

​ 12) Colony PCR was performed for verification. Positive cultures were used to create glycerol stocks.

8．Induction of Tobacco Hairy Roots

​ 1) A verified positive culture of A. tumefaciens Ar.1193 was scaled up.

​ 2) 10 µL of this culture was inoculated into 5 mL of liquid medium and grown overnight until the OD value reached approximately 0.8.

​ 3) The cells were harvested by centrifugation at 4000 rpm for 10 minutes, and the supernatant was discarded.

​ 4) The pellet was resuspended in an equal volume of MS liquid medium containing 100 µM acetosyringone (AS) by shaking.

​ 5) The suspension was aliquoted into three 1.5 mL centrifuge tubes.

​ 6) Sterile tobacco seedlings with healthy leaves were selected.

​ 7) A blade was dipped into the bacterial suspension and used to wound the leaf veins and petioles.

​ 8) The wounded leaves were placed on MS solid medium containing 100 µM AS and co-cultivated in the dark for 3 days. Filter paper was placed on the medium to prevent overgrowth of Agrobacterium.

​ 9) After co-cultivation, the leaves were transferred to MS medium containing 200 mg/L Cefotaxime (Cef).

​ 10) Upon emergence of hairy roots from the leaf sites, GFP fluorescence signals were observed under a laser lamp.

​ 11) Hairy roots exhibiting GFP fluorescence were individually excised and cultured separately.

​ 12) When the hairy root biomass was sufficient, a portion of the root tissue was placed on MS solid medium supplemented with Cef for further growth or analysis.

9．Scale-up Culture of Hairy Roots in Liquid Medium

​ 1) Positive hairy roots were transferred to a 100 mL conical flask containing 20 mL of MS liquid medium supplemented with Cef (200 mg/L) and cultured in the dark for three weeks.

​ 2) The volume of liquid medium was subsequently increased to 50 mL.

​ 3) After an additional 7 days of culture, when the hairy root biomass was sufficient, the medium was replaced with fresh MS liquid medium containing Cef (200 mg/L), β-estradiol (0.1% v/v), and the relevant substrate(s). The cultures were then transferred to light conditions.

​ 4) On the third day after adding the inducer and substrate, the medium was replaced again with fresh MS + Cef (200 mg/L) medium containing the same concentrations of β-estradiol and substrate.

​ 5) Sampling was performed at 120 hours after the initial addition of the substrate and inducer.

​ 6) The harvested samples were divided into two parts: one for quantifying the production of the target compound, leonurine, and the other for analyzing the expression of related genes via Q-PCR.

10．Total RNA Extraction from Tobacco Hairy Roots

​ 1) Harvested hairy roots were blot-dried, rapidly frozen with liquid nitrogen, and ground into a fine powder. Approximately 10 mg of powdered tissue was transferred to a microcentrifuge tube. 1 ml of TRIzol reagent was added, and the mixture was vortexed thoroughly and incubated on ice for 3 minutes.

​ 2) 0.5 ml of chloroform was added, and the tube was shaken vigorously. The mixture was centrifuged at 12,000 rpm for 10 minutes at 4°C.

​ 3) The upper aqueous phase (approximately 0.5 ml) was carefully transferred to a new tube. 1 ml of pre-cooled isopropanol was added, and the tube was inverted several times to mix. The RNA was precipitated at -20°C for 1-2 hours.

​ 4) The sample was centrifuged at 12,000 rpm for 10 minutes at 4°C to pellet the RNA. The supernatant was discarded.

​ 5) The RNA pellet was washed by adding 1 ml of 70% ethanol (prepared with DEPC-treated water) and centrifuging at 12,000 rpm for 1 minute at 4°C. The ethanol was discarded.

​ 6) The wash step (5) was repeated once.

​ 7) A final centrifugation at 12,000 rpm for 1 minute at 4°C was performed. Residual ethanol was carefully removed using a pipette tip. The open tube was placed in a biosafety cabinet for 5-10 minutes to allow complete evaporation of any remaining ethanol.

​ 8) The RNA pellet was dissolved in 50 μl of RNase-free water by gently flicking the tube. RNA concentration and purity were determined using a Nanodrop 2000 spectrophotometer.

11．Reverse Transcription (cDNA Synthesis)

(1) Genomic DNA Removal Reaction

a. The reaction mixture was prepared according to the following table:

Table. gDNA Removal Reaction Mixture

Reagent	Volume
5× gDNA Eraser Buffer	2 μl
gDNA Eraser	1 μl
RNA	1 μg
RNase-free water	Add to 10 μl
Total	10 μl

b. Reaction Program: 42 °C for 2 min; hold at 4 °C.

(2) Reverse Transcription Reaction

a．The reaction mixture was prepared according to the table below:

Table. Reverse Transcription Reaction Mixture

Reagent	Volume (μl)
5×PrimeScript Buffer 2	4
PrimeScript RT Enzyme Mix I	1
Primer Mix	4
RNase-free water	1
Total	10

b．Reaction Program: 37 °C for 1 h → 85 °C for 5 s (this step inactivates the reverse transcriptase to prevent interference with subsequent reactions) → hold at 4 °C. The resulting product is cDNA.

12. q-PCR Analysis of UGT5 and SCPL12 Expression Levels

The obtained cDNA was diluted 20-fold prior to use in q-PCR.

The q-PCR reaction mixture is listed in the table below.

Table. q-PCR Reaction Mixture

Reagent	Volume (μl)
TB Green Premix Ex Taq II(Tli RNaseH Plus)（2×）	10
Forward primer（10 μM）	0.8
Reversed primer（10 μM）	0.8
ROX Reference Dye II（50X）	0.4
Template（cDNA）	8
Total	20

The q-PCR amplification program was as follows:

95 ℃, 5 min

40 cycles

95 ℃, 5 s,

60 ℃, 34 s

The Leonurus japonicus Tubulin (Tub) gene was used as the internal reference gene for normalization.

The primer sequences used for q-PCR are listed in the table below:

Table. Primers and Sequences for q-PCR

Primer name	Sequence
LjTUB-F	TCAACTATCAGCCACCCACTG
LjTUB-R	TCGAGAAGACCTCAGCAACAC
LjUGT-F	CCCAAGGCGGAGGAGATAAG
LjUGT-R	TCTTAGAAGAAGAACCGCCGA
LjSCPL-F	CAATTTCCAAAAGAATCCGCTCTACA
LjSCPL-R	GGCTCAACATTCACATAATTTCCA

The relative expression levels were calculated and analyzed using the 2^(-ΔΔCt) method based on the q-PCR results. The expression patterns were subsequently visualized in a graph.

13．Extraction of Leonurine from Hairy Roots

The extraction procedure was performed as follows:

(1) Hairy root samples stored at -80°C were ground to a fine powder using liquid nitrogen.

(2) The powdered samples were lyophilized. Note: All samples required for content determination and compositional analysis were processed identically.

(3) 10 mg of lyophilized powder was weighed into a microcentrifuge tube.

(4) 500 µL of 70% methanol was added to the tube.

(5) Extraction was conducted in an ice-water bath with ultrasonication for 2 hours.

(6) The mixture was centrifuged at 12,000 rpm for 5 minutes at 4°C.

(7) The supernatant was carefully transferred to a new microcentrifuge tube.

(8) The supernatant was filtered through a 0.22 µm membrane filter prior to LC-MS analysis.

14．Quantification of Leonurine Content

Quantitative analysis of metabolites was performed using an LC-MS system (AB SCIEX 6500+) coupled with SCIEX OS software (v.1.7). Sample separation was achieved using an ACQUITY UPLC HSS T3 column (1.8 µm, 2.1 × 100 mm) maintained at 40°C. The mobile phase consisted of water with 0.1% formic acid (phase A) and acetonitrile (phase B), employing a binary gradient elution program. Detection was carried out using electrospray ionization (ESI) in either positive or negative ion mode, with optimized multiple reaction monitoring (MRM) transitions. The column temperature was set at 40°C, and the flow rate ranged from 0.2 to 0.4 mL/min. The ion source temperature was maintained at 150°C, with a cone voltage of 100 V, desolvation gas flow of 800 L/h, desolvation temperature of 400°C, and collision energy of 35–55 V. Based on the LC-MS results, total ion chromatogram (TIC) plots and compound quantification charts were generated.

15. PCR Amplification of Target Genes

a．The PCR reaction mixture was prepared according to the following table:

Table. PCR Reaction Mixture

Reagent	Volume（μl）
10×KOD plus buffer	5
MgSO4（25 mM）	3
dNTPs（2 mM）	5
Forward primer（10 μM）	3
Reversed primer（10 μM）	3
Template	2
KOD plus	1.5
ddH2O	27.5
Total	50

b．Reaction procedures：

94 ℃, 5 min

98 ℃, 15 s

28 cycles

58 ℃, 35 s

68 ℃, 2 min

68 ℃, 10 min

​ 10 ℃, hold.

16. Electrophoretic Analysis of PCR Products

(1) While the PCR was in progress, an agarose gel was prepared: 1.2 g of agarose was weighed and added to 100 ml of 1× TAE buffer. The mixture was heated in a microwave oven until the agarose was completely dissolved. 5 μl of Gel-Red nucleic acid dye was added. The solution was poured into a gel tray, and a comb was inserted.

(2) After the PCR was completed, 5 μl of 10× loading buffer was added to the PCR product and mixed. The mixture was loaded into the gel wells for electrophoresis. The results were visualized and photographed under UV light.

17. Gel Extraction and Purification of PCR Products

(1) The target DNA band was excised under UV light and transferred to a clean microcentrifuge tube. The gel slice's mass was recorded. A volume of DE-A solution equivalent to three times the gel mass (e.g., 0.3 ml for a 0.1 g gel slice) was added. The tube was incubated at 75°C until the gel slice was completely dissolved, then cooled to room temperature. A volume of DE-B solution equal to half the volume of DE-A used was added. (Note: The solution color changes from red to yellow after adding DE-B).

(2) The mixture was transferred to a spin column and centrifuged at 12,000 × g for 1 minute. The flow-through was discarded.

(3) 0.5 ml of W1 buffer was added to the column, followed by centrifugation at 12,000 × g for 30 seconds. The flow-through was discarded.

(4) 0.7 ml of W2 buffer was added to the column, followed by centrifugation at 12,000 × g for 30 seconds. The flow-through was discarded.

(5) Step (4) was repeated once.

(6) The empty column was centrifuged at 12,000 × g for 1 minute to remove residual ethanol.

(7) The column cap was opened, and the column was air-dried at room temperature for about 5 minutes to allow complete ethanol evaporation. 30 μl of Elution Buffer was added directly to the center of the membrane. After standing for 1 minute, the column was centrifuged at 12,000 × g for 1 minute to elute the DNA.

(8) The concentration of the purified PCR product was determined and stored at -20°C.

18. Construction of Bacterial Expression Vectors

(1) Concurrently with the PCR amplification described above, the vectors pRSF-Duet-M6 and pETDuet-MBP were subjected to double restriction enzyme digestion. pRSF-Duet-M6 was digested with KpnI and HindIII, while pETDuet-MBP was digested with BamHI and HindIII. The double digestion reaction mixture was set up as follows:

Digestion conditions: 37 °C for 3 hours.

(2) The PCR products and the digestion products from step (1) were purified using the AxyPrep DNA Gel Extraction Kit according to the manufacturer's instructions. Their concentrations were measured.

(3) The target genes were ligated into the respective vectors via homologous recombination using the ClonExpress Ultra One Step Cloning Kit (Vazyme, C116-01).

Reaction conditions: 55 °C for 20 minutes.

(4) The ligation products were transformed into E. coli DH5α competent cells. The transformation mixture for LjUGT5-pRSF-Duet-M6 was spread onto LB agar plates containing kanamycin, and that for LjSCPL12-pETDuet-MBP was spread onto LB agar plates containing carbenicillin. Plates were incubated inverted at 37 °C overnight.

(5) Single colonies were picked for colony PCR verification using the 2× Taq Master Mix (Vazyme, P112-01).

(6) Positive colonies were inoculated into 5 mL of LB liquid medium containing the appropriate antibiotic and cultured overnight at 37 °C with shaking at 200 rpm. Plasmid DNA was extracted using the TIANprep Mini Plasmid Kit (Tiangen, DP103), and the concentration was measured. 5 μL of each plasmid was sent for sequencing.

19. Prokaryotic Expression and Purification of Target Proteins

(1) Sequence-verified plasmids were transformed into the protein expression E. coli strain BL21(DE3). The transformation mixture was spread onto LB agar plates containing the antibiotic corresponding to the plasmid plus chloramphenicol. Plates were incubated inverted at 37 °C overnight.

(2) Single colonies were selected for colony PCR identification.

(3) A colony PCR-positive single colony was inoculated into LB liquid medium containing chloramphenicol and the plasmid-specific antibiotic, and cultured overnight at 37 °C with shaking at 200 rpm.

(4) The overnight culture was diluted 1:100 into 200 mL of fresh LB liquid medium and incubated at 37 °C with shaking at 200 rpm until the OD₆₀₀ reached approximately 0.6 (approximately 2.5 hours).

(5) Protein expression was induced by adding IPTG to a final concentration of 0.4 mM. The culture was transferred to a 16 °C shaker and incubated with shaking at 120 rpm for 16 hours.

(6) Cells were harvested by centrifugation at 10,000 rpm for 10 minutes at 4 °C. The cell pellet was resuspended in 10 mL of Lysis Buffer and disrupted using a high-pressure homogenizer.

(7) The lysate was centrifuged at 10,000 rpm for 30 minutes at 4 °C to remove cell debris. The supernatant was collected and incubated with 0.5 mL of Ni-NTA resin at 4 °C for 2 hours with gentle mixing.

(8) The supernatant and resin mixture were loaded onto a chromatography column and allowed to settle by gravity.

(9) The resin was washed twice with 4 mL of Washing Buffer each time.

(10) The target protein was eluted with 300 μL of Elution Buffer. An equal volume of 80% glycerol was added to the eluted protein, mixed gently, and the protein was stored at -40 °C.

(11) 50 μL of the purified protein was mixed with an equal volume of 2× Loading Buffer and denatured at 95 °C for 10 minutes. SDS-PAGE analyzed 10 μL of the sample, and the purified protein was further identified by Western blotting.

20. In Vitro Enzymatic Production of Leonurine by LjUGT5 and LjSCPL12

The in vitro enzyme activity assay was performed using the reaction system outlined in the table below:

Reaction conditions: 28 °C for 16 hours.

21. Quantification of Leonurine Content

Quantitative analysis of metabolites was performed using an LC-MS system (AB SCIEX 6500+) coupled with SCIEX OS software (v.1.7). Sample separation was achieved using an ACQUITY UPLC HSS T3 column (1.8 μm, 2.1 × 100 mm) maintained at 40°C. The mobile phase consisted of water with 0.1% formic acid (phase A) and acetonitrile (phase B), employing a binary gradient elution program. Detection was carried out using electrospray ionization (ESI) in either positive or negative ion mode, with optimized multiple reaction monitoring (MRM) transitions. The column temperature was set at 40°C, and the flow rate ranged from 0.2 to 0.4 mL/min. The ion source temperature was maintained at 150°C, with a cone voltage of 100 V, desolvation gas flow of 800 L/h, desolvation temperature of 400°C, and collision energy of 35–55 V. Based on the LC-MS results, total ion chromatogram (TIC) plots and compound quantification charts were generated.