Overview

This section contains detailed protocols for all experimental procedures used in our project. The protocols are organized into two cycles: Cycle 1 focuses on GLP-1 production and characterization, while Cycle 2 covers the construction and validation of the temperature-sensitive kill switch system.

Cycle 1: GLP-1 Production

The following protocols were used to construct, express, and characterize GLP-1-producing bacterial strains.

1. Preparation of LB and M9 Media

1.1 LB Liquid Medium

• Weigh 12.5 g of LB broth powder.
• Transfer to a medium-sized bottle and add 500 mL of deionized water.
• Stir thoroughly until completely dissolved.
• Sterilize by autoclaving at 121°C for 20 minutes.
• Store at 4°C until use.

1.2 LB Solid Medium

• Weigh 12.5 g of LB broth powder and 7.5 g of agar.
• Transfer to a medium-sized bottle and add 500 mL of deionized water.
• Stir thoroughly and autoclave at 121°C for 20 minutes.
• Cool to approximately 50-55°C (touchable but warm).
• If needed, add antibiotics or other additives under sterile conditions.
• Pour ~20-25 mL per sterile Petri dish in a laminar flow hood.
• Allow plates to solidify at room temperature, then store inverted at 4°C.

1.3 M9 Solid Medium

• Weigh 6.3 g of M9 minimal medium powder and 7.5 g of agar.
• Transfer to a medium-sized bottle and add 500 mL of deionized water.
• Stir thoroughly and autoclave at 121°C for 20 minutes.
• Cool to approximately 50-55°C.
• If required, add sterile-filtered carbon source (e.g., 0.4% glucose), antibiotics, or other supplements.
• Pour into Petri dishes under sterile conditions.
• Solidify at room temperature and store at 4°C.

2. PCR

2.1 Reaction setup (on ice)

Mix by brief vortexing and quick spin-down.

2.2 Thermal cycling program

3. 1% Agarose Gel Electrophoresis

3.1 Gel preparation

• Agarose: 0.6 g
• 1× TAE buffer: 60 mL
• GelRed: add at 1:10,000 (e.g., 6 μL for 60 mL)

Procedure:

• Dilute 50× TAE to 1× with ddH₂O before use. Add agarose powder to 1× TAE in a flask.
• Microwave until fully dissolved. Cool slightly; add GelRed at 1:10,000.
• Mix thoroughly, pour into casting tray, insert comb, and let solidify (~15 min).

3.2 Running the gel

• Place the solidified gel in the electrophoresis chamber. Cover with 1× TAE (2–3 mm above gel).
• Carefully remove the comb.
• Sample prep: If using PCR products from the Dye Plus master mix, loading dye is already included. Otherwise, add appropriate loading buffer. Load a DNA ladder in one well.
• Loading volume: typically 5–10 μL per well (adjust to well size).
• Run at ~120 V for ~15 min (avoid overheating).
• Stop when the tracking dye is ~1 cm from the gel bottom.
• Visualize DNA bands with UV or blue-light imaging.

4. Heat Shock Transformation of E. coli

Strain: chemically competent, selective plates: LB + kanamycin (kan+)

• Prepare ice; thaw competent cells on ice.
• Clean the bench. UV-irradiate kan+ LB agar plates for 15–30 min.
• Pre-warm heating block or water bath to 42°C.
• Aliquot 50 μL competent E. coli into pre-chilled microtubes; label.
• Add 2–3 ng plasmid DNA into 50 μL cells. Mix gently by pipetting or flicking.
• Incubate on ice for 15–30 min.
• Heat shock at 42°C for 90 s; immediately place on ice.
• Chill on ice for an additional 2 min.
• Plate the entire transformation mixture onto kan+ LB agar. Spread evenly with a sterile tip.
• Incubate at 37°C for 12–14 h.
• Pick single colonies into LB liquid medium for growth.

5. Protein Induction, Expression, and Extraction

5.1 Transformation and starter culture

• Transform the expression plasmid into suitable competent cells.
• Incubate plates 12–16 h at 37°C.
• Next day, pick a single colony into 5 mL LB + kanamycin. Shake at 37°C, 220 rpm for ~6 h.

5.2 Inoculation and growth

• Inoculate 1:100 into fresh selective LB (e.g., 200 μL seed into 20 mL LB + kan).
• Grow at 37°C, 220 rpm, to OD₆₀₀=0.6–0.8.

5.3 IPTG induction

• Add IPTG to final concentration per your plasmid's recommendation (specify if known; otherwise common range is 0.1–1 mM).
• Induce for ~6 h with shaking. Monitor OD₆₀₀ 1–2 times to avoid overgrowth.

5.4 Harvest and washing

• Centrifuge at 10,000 rpm for 20 min. Discard supernatant.
• Wash cell pellet with 1× PBS 2–3 times.

5.5 Lysis

• Use WIP lysis buffer. Add PMSF to the lysis buffer immediately before use (10 μL PMSF per 1 mL lysis buffer; confirm stock concentration per supplier).
• Add 600–800 μL lysis buffer to the washed cell pellet; pipette up/down to resuspend thoroughly.

5.6 Clarification and sample prep

• Centrifuge at 10,000 rpm, 4°C, 25 min.
• Transfer supernatant to a fresh 1.5 mL tube (soluble fraction).
• Add 5× protein loading buffer to sample, mix well.
• Boil at 98–100°C for 10 min.
• Proceed immediately to SDS-PAGE or store at −20°C.

6. SDS-PAGE

6.1 Gel casting

• Resolving gel (Lower gel): Mix 2.7 mL resolving gel solution with 2.7 mL resolving gel buffer; add 60 μL modified accelerator; mix gently.
• Pour resolving gel to a level such that the distance between the gel surface and the top of the short plate is ~0.5 cm longer than the comb teeth. Overlay with ethanol to level.
• After polymerization (~15 min), decant ethanol.
• Stacking gel (Upper gel): Mix 0.75 mL stacking gel solution with 0.75 mL colored stacking buffer; add 15 μL modified accelerator; mix gently.
• Pour stacking gel and insert the comb.
• After polymerization (~15 min), remove the comb.

6.2 Running buffer

• Dissolve 1 pouch of Tris–Gly powder in water to 1 L total; mix.

6.3 Electrophoresis

• Load samples and run according to gel percentage and desired separation. Record voltage/current settings used by your apparatus.

7. Rapid Coomassie Brilliant Blue Staining

• After electrophoresis, remove the gel, rinse with ddH₂O to reduce background; discard rinse.
• Add sufficient Coomassie rapid stain to cover the gel. Stain on a shaker at room temperature for ~15 min.
• Recover stain solution. Wash gel with ddH₂O until background is acceptable.

8. RNA Extraction

Kit: SteadyPure RNA Extraction Kit (Code AG21024)

8.1 Cell collection and lysis

• Harvest an appropriate amount of bacteria. Centrifuge at 12,000 rpm, RT, 2 min. Discard supernatant.
• Optional lysozyme step for higher yield.
• Add appropriate volume of AG RNAexPro Reagent. Pipette up/down until thoroughly lysed.
• Incubate at room temperature for 5 min.

8.2 Purification

• Add an equal volume of 70% ethanol to the lysate. Mix thoroughly. If viscous or precipitated, pipette repeatedly to break up clumps.
• Transfer all mixture to an RNA Mini Column. Spin 12,000 rpm, RT, 1 min. Discard flow-through.
• Add 600 μL Buffer RW1. Spin 12,000 rpm, RT, 1 min. Discard flow-through.
• Add 650 μL Buffer RW2. Spin 12,000 rpm, RT, 1 min. Discard flow-through. Note: Ensure the specified volume of absolute ethanol has been added to Buffer RW2 per kit instructions.
• Add another 650 μL Buffer RW2. Spin 12,000 rpm, RT, 1 min. Discard flow-through.
• Place the column in a new 2.0 mL collection tube and spin 12,000 rpm, RT, 2 min to dry the membrane. Avoid touching the membrane tip to tube walls. Use a fresh tube to maximize purity.
• Place the column in a new RNase-free tube. Apply 50–200 μL RNase-free water to the center of the membrane, incubate at RT for 5 min, and elute by spinning 12,000 rpm, RT, 2 min.
• Use RNA immediately or store at −80°C.

9. Reverse Transcription (cDNA Synthesis)

Kit: Evo M-MLV RT Mix Kit with gDNA Clean for qPCR Ver.2 (AG11728)

9.1 gDNA removal

Prepare on ice. For each reaction:

Reaction: 42°C for 2 min; then hold at 4°C.

9.2 Reverse transcription reaction

Step 1 mix (typical 20 μL total):

• Add 5× Evo M-MLV RT Reaction Mix Ver.2: 4 μL

Thermal program:

10. RT-qPCR (SYBR Green)

Kit: SYBR Green Premix Pro Taq HS qPCR Kit (AG11701)

10.1 Reaction setup

10.2 Cycling conditions (two-step qPCR)

• Step 1: 95°C, 30 s, 1 cycle
• Step 2: 95°C, 5 s; 60°C, 30 s, 40 cycles total
• Melt curve (Dissociation Stage): per instrument manual

Cycle 2: Kill Switch System

The following protocols were used to construct and validate the temperature-sensitive kill switch.

1. PCR Product Gel Extraction

1. Cut target bands, place gel pieces in 1.5 mL EP tubes, add XP2 buffer until the XP2 buffer is completely submerged in the gel pieces, and heat in a 60°C metal bath until the gel completely melts.
2. Add melted gel to the HiBind DNA Mini Column in the collection tube, centrifuge at 12,000g for 1 minute, and repeat twice. Discard the liquid in the collection tube.
3. Add 200 μL of SPW buffer to the HiBind DNA Mini Column.
4. Centrifuge at 12,000g for 1 minute. Discard the liquid in the collection tube.
5. Repeat steps 3 to 4 once.
6. Centrifuge empty HiBind DNA Mini Column at 12,000g for 2 minutes.
7. Insert the HiBind DNA Mini Column into the clean EP tube, and heat in a 62°C metal bath for 8 minutes.
8. Add 20 μL water to the HiBind DNA Mini Column, and centrifuge at 15,000g for minutes. Discard the HiBind DNA Mini Column, and collect the DNA sample in an EP tube.

2. Restriction Endonuclease Enzymatic Shearing of DNA

1. Add the following reagent to a clean microcentrifuge tube, make sure to process under a 0°C environment.

Reaction system (50 μL)

2. Invert the PCR tube several times and centrifuge it for 20 seconds to ensure the solution is well mixed.
3. Put the microcentrifuge tube into a preheated water bath, 37°C for 2-3 hours.

3. Overlap Connection

1. Add the following reagent to a clean PCR tube, make sure to process under 0°C environment.

Overlap Connection System (50 μL)

2. Invert the PCR tube several times and centrifuge it for 20 seconds to ensure the solution is well mixed.
3. Put the PCR tube into a thermocycler. Create a thermocycle to finish the PCR process.

4. Gibson Assemble

1. Add the following reagent to a clean PCR tube.

2. 2-3 fragments recombination reaction, 50°C, 15 min.

5. 1% Agarose Gel Electrophoresis

1. Using an electronic balance, weigh 0.8 g of agarose powder.
2. Weigh 80 mL of TAE buffer (you can add an extra 10 mL to compensate for evaporation loss during boiling).
3. Add the diluted agarose solution to a microwave-safe container and heat in the microwave until boiling (stir until the solution is clear and transparent).
4. Add 8 μL of Gold View (nucleic acid stain) to the flask and mix well.
5. Pour the solution into a gel casting tray with the comb already inserted.
6. Add loading buffer to the PCR product, then use a pipette to transfer it into the wells of the agarose gel.
7. In adjacent wells, add a 2000 bp / 1 kb marker.
8. Set the electrophoresis apparatus to 150 V and run the gel for 25 minutes.

6. 2% Agarose Gel Electrophoresis

1. Using an electronic balance, weigh 1.6 g of agarose powder.
2. Weigh 80 mL of TAE buffer (you can add an extra 10 mL to compensate for evaporation loss during boiling).
3. Add the diluted agarose solution to a microwave-safe container and heat in the microwave until boiling (stir until the solution is clear and transparent).
4. Add 8 μL of Gold View (nucleic acid stain) to the flask and mix well.
5. Pour the solution into a gel casting tray with the comb already inserted.
6. Add loading buffer to the PCR product, then use a pipette to transfer it into the wells of the agarose gel.
7. In adjacent wells, add a 2000 bp / 1 kb marker.
8. Set the electrophoresis apparatus to 150 V and run the gel for 25 minutes.

7. Plasmids Extraction

1. Place the bacteria into the bottom of the EP tube.
2. Put the EP tube into centrifuge (10,000g, 1 min) for enrichment, repeated three times.
3. Add solution I to 250 μL.
4. Break down the cell membrane by adding solution II with 250 μL and shake it upside down.
5. 350 μL solution III, creating white flocculent precipitation as E. coli genomic DNA and protein, and the supernatant was plasmids.
6. Centrifuge at 10,000g for 10 minutes at room temperature.
7. Insert a HiBind DNA Mini Column in a 2 mL Collection Tube.
8. Transfer the sample to the HiBind DNA Mini Column.
9. Discard the filtrate and reuse the collection tube. Add 600 μL HBC buffer into HiBind DNA Mini Column.
10. Discard the filtrate and reuse the collection tube. Add 700 μL DNA wash Buffer into HiBind DNA Mini Column. Centrifuge at maximum speed (>13,000×g) for 1 minute at room temperature.
11. Centrifuge at maximum speed (>13,000×g) for 1 minute at room temperature.
12. Discard the filtrate and reuse collection tube.
13. Repeat Steps 11-12 for a second wash step.
14. Centrifuge the empty HiBind DNA Mini Column for 2 minutes at maximum speed to dry the column matrix.
15. Transfer the HiBind DNA Mini Column to a clean 1.5 mL microcentrifuge tube.
16. Add 15-30 μL Elution Buffer or deionized water directly to the center of the column membrane.
17. Let sit at room temperature for 2 minutes.
18. Centrifuge at maximum speed for 2 minutes.

8. Heat Shock Transformation of E. coli

1. Take Chemically Competent Cells out from -80°C and thaw them on ice.
2. Add a certain amount of target DNA fragments (such as 10 ng-100 ng) and component cells into the sterile centrifuge tube. The centrifuge tube was placed on ice for 30 minutes to adsorb target DNA to the surface of receptive cells.
3. Heat the centrifuge tube in a 42°C water bath for 90 seconds, and then quickly return to the ice to cool for 2-3 minutes.
4. Add a certain volume of LB medium (such as 600 μL), mix it well and place it in a 37°C shaker at low speed for 1 hour to restore the growth of receptive cells.
5. Spread the solution on a culture plate with specific antibiotics.

9. Electroporation of E. coli

1. Take 100 μL of competent cells, add more than 500 ng of targeting fragment and more than 300 ng of pEc-gRNA plasmid, and incubate on ice for 10–30 minutes.
2. Place a cleaned and dried 1 mm electroporation cuvette in a biosafety cabinet for 20 minutes of UV sterilization, then pre-cool it on ice. Quickly transfer the aforementioned competent cells into the electroporation cuvette, ensuring the cells settle at the bottom of the cuvette.
3. Wipe the outer wall of the cuvette dry. For a 1 mm cuvette, use the electroporation program Ec1; for a 2 mm cuvette, use the program Ec2 (with the time controlled between 4.8–5.2 seconds).
4. Immediately after electroporation, add 900–1000 μL of LB liquid medium pre-warmed to 37°C, gently pipette to mix, then transfer the mixture to a 1.5 mL centrifuge tube. Incubate in a 37°C shaker at 200 rpm for 45–60 minutes, then take an appropriate amount of the culture to spread on a Kana⁺Str double-antibiotic plate.

10. Plasmid Curing

1. Take the correctly verified clones and culture them at 37°C. Add 10 mM rhamnose during the cultural process.
2. After culturing for 2-3 hours, streak to isolate single colonies.
3. Verify each single colony for the presence of Str resistance; those without Str resistance are the clones eliminated.
4. The pEc-Cas9 plasmid can be activated by culturing at 37°C for 2-3 hours, then streak onto agar plates containing 10 g/L sucrose.

11. Overnight Bacterial Culture

1. When ready to grow the culture, add liquid LB to a tube or flask and add the appropriate antibiotic to the correct concentration.
2. Using a sterile pipette tip, select a single colony from your LB agar plate.
3. Drop the tip into the liquid LB with antibiotics.
4. Incubate bacterial culture at 37°C for 12-18 h in a shaking incubator.

12. Colony PCR

1. Take the overnight incubator out of the LB agar plate that contains target plasmid.
2. Pick up to 10 E. coli colonies.
3. Add the following reagent to a clean PCR tube, make sure to process under 0°C environment. (Note: This operation works on a clean bench)

4. Transfer PCR mix into 10 PCR tubes. Each tube contains 10 μL PCR mix.
5. Place the PCR machine and set the program.

Other

1. Experiment on the mass change of Popping Boba during acid leaching
   1. Before the acid soaking, the samples were soaked in a 3% calcium chloride (CaCl₂) solution and then in pure water, each for more than 30 minutes. This ensured thorough cross-linking and reduced the effect of swelling on the experimental outcome.
   2. Four small dishes were filled with an equal amount of hydrochloric acid solution at pH 2 and labeled 1, 2, 3, and 4. The mass of each empty dish was recorded. Five Popping Bobas were added to each dish, and the starting total mass was recorded. The final total mass was then measured and recorded at time intervals of 10, 30, 60, and 120 minutes.

Overview

This notebook documents our experimental journey from June to August, organized into two main iterations. The first iteration focuses on GLP-1 gene construction, expression optimization, and validation. The second iteration addresses biosafety through the development of a temperature-sensitive kill switch system.

Cycle1

Week 1 (6.03-6.09)

Experiment 1: Construct the GCG-pET plasmid

Objective: Retrieve the nucleotide sequence of the GLP-1 gene from a public database and construct the GCG-pET plasmid.

Contents:

1. Access the NCBI nucleotide database and search for "GLP-1 gene" in the target species.
2. Identify the canonical transcript and coding sequence (CDS), and record the sequence accession number.
3. The sequence information was verified, and the human gene GCG, which corresponds to "GLP-1", was selected.
4. The GCG-pET plasmid was constructed by cloning a synthesized GCG fragment (provided by Zhongchen Medical) into the pET-28a(+) vector, based on the designed plasmid map.

Outcomes:

Week 2 (6.23-6.29)

Experiment 1: Preparation of Laboratory Solutions and Media

Objective: To prepare and sterilize the necessary solutions and culture media, including kanamycin and IPTG stock solutions, as well as LB liquid and solid media, for subsequent molecular biology experiments.

Contents:

1. Preparation of Kanamycin Stock Solution (50 mg/mL):
   Weigh 0.5 g of kanamycin powder using an analytical balance, add sterile ddH₂O to a total volume of 10 mL to obtain a 50 mg/mL stock solution. Filter-sterilize the solution, aliquot into 1 mL tubes, and store at -20°C. For use, dilute the stock 1:1000 to obtain a working concentration of 50 µg/mL.
2. Preparation of IPTG Stock Solution (100 mM):
   Prepare a 100 mM stock solution by weighing 0.5 g of IPTG powder, adding sterile ddH₂O to a total volume of 21 mL, and filter-sterilizing. Aliquot into 1 mL tubes and store at -20°C. Dilute as needed before use.
3. Preparation of LB Medium:
   LB Liquid Medium: Add 12.5 g of LB Broth (premixed powder) to ddH₂O and bring to a total volume of 500 mL. Autoclave to sterilize.
   LB Solid Medium: Add 12.5 g of LB Broth (premixed powder) and 7.5 g of agar to ddH₂O and bring to a total volume of 500 mL. Autoclave to sterilize.
   After sterilization, add antibiotics as required according to the experimental design.
   Sterile LB solid medium was poured into Petri dishes to prepare agar plates. All media are stored at 4°C.

Experiment 2: Verify the GCG gene fragment

Objective: verify the GCG gene fragment.

Contents:

1. PCR amplification of the GCG fragment
2. Agarose Gel Electrophoresis
   Prepare 1X TAE Buffer:
   Mix 10 mL of 50X TAE buffer with 500 mL of ddH₂O.
   Result: You now have 1X TAE, a buffer that maintains pH and ion balance during electrophoresis.
   Prepare 1% Agarose Gel:
   Measure 0.6g of agarose powder.
   Add it to 60 mL of the 1X TAE solution.
   This creates a 1% agarose gel mixture.
   Dissolve Agarose:
   Heat the mixture until it becomes clear and transparent, indicating the agarose has -completely dissolved.
   Add nucleic acid stain (GelRed):
   Once the gel is cool enough (but still liquid), add 6µL of GelRed.
   GelRed is a fluorescent dye that binds to DNA, allowing visualization under UV or blue light.
   Pour the Gel:
   Pour the mixture into a gel casting tray.
   Insert a comb to form wells for DNA samples.
   Solidify:
   Let the gel cool and solidify (usually takes ~30 minutes).
   Once solid, it's ready for use in electrophoresis.
3. Load samples and run agarose gel electrophoresis.

Outcomes:

Experiment 3: Transformation of GCG-pET Plasmid into E. coli BL21(DE3)

Objective: To transform E. coli BL21(DE3) with the GCG-pET plasmid and select transformants on kanamycin plates.

Contents:

1. Prepare ice; thaw competent cells on ice.
2. Clean the bench. UV-irradiate kan+ LB agar plates for 15–30 min.
3. Pre-warm heating block or ddH₂O bath to 42°C.
4. Aliquot 50 μL competent E. coli into pre-chilled microtubes; label.
5. Add 2–3 ng plasmid DNA into 50 μL cells. Mix gently by pipetting or flicking.
6. Incubate on ice for 15–30 min.
7. Heat shock at 42°C for 90 s; immediately place on ice.
8. Chill on ice for an additional 2 min.
9. Plate the entire transformation mixture onto kan+ LB agar. Spread evenly with a sterile tip.
10. Incubate at 37°C for 12–14 h.
11. Pick single colonies into LB liquid medium for growth.

Experiment 4: Analysis of Previous Transformation Efficiency

Objective: To evaluate the outcome of the prior transformation experiment and identify potential factors contributing to low colony yield.

Contents:

The results from the previous transformation experiment indicated a notably low number of colonies obtained. It is hypothesized that inadequate adherence to ice-cold conditions during critical steps of the transformation process may have compromised cell viability and transformation efficiency.

Outcomes:

Week 3 (6.30-7.06)

Experiment 1: The GCG-pET plasmid was transformed into the E. coli BL21(DE3) strain for the second time

Objective: To transform E. coli BL21(DE3) with the GCG-pET plasmid and select transformants on kanamycin plates.

Contents:

Transform the GCG-pET plasmid into E. coli BL21(DE3) competent cells and streak onto kanamycin-containing LB solid medium for culture.

Experiment 2: Small-Scale Culture and Induction of Recombinant Protein

Objective: To screen positive transformants and induce expression of the target protein using IPTG.

Contents:

1. Observing the results of yesterday's transformation experiment, we have successfully mastered the technique of plasmid transformation into competent cells and obtained monoclones of BL21(DE3) harboring the GCG-pET plasmid.
2. A single colony was picked and inoculated into 5 mL of LB liquid medium, followed by incubation in a shaker at 37°C for 6 hours. Then, 200 μL of the culture was transferred into 20 mL of LB liquid medium for scale-up cultivation. When the OD₆₀₀ reached 0.6–0.8, IPTG was added to induce protein expression.

Outcomes:

Experiment 3: Analysis of GCG Protein Expression

Objective: To analyze the expression of the recombinant GCG protein in E. coli BL21(DE3) cells following IPTG induction.

Contents:

1. Resolving gel (Lower gel): Mix 2.7 mL resolving gel solution with 2.7 mL resolving gel buffer; add 60 μL modified accelerator; mix gently.
2. Pour resolving gel to a level such that the distance between the gel surface and the top of the short plate is ~0.5 cm longer than the comb teeth. Overlay with ethanol to level.
3. After polymerization (~15 min), decant ethanol.
4. Stacking gel (Upper gel): Mix 0.75 mL stacking gel solution with 0.75 mL colored stacking buffer; add 15 μL modified accelerator; mix gently.
5. Pour stacking gel and insert the comb.
6. After polymerization (~15 min), remove the comb.
7. Dissolve 1 pouch of Tris–Gly powder in ddH₂O to 1 L total; mix.
8. Load samples and run according to gel percentage and desired separation. Record voltage/current settings used by your apparatus.
9. After electrophoresis, remove the gel, rinse with ddH₂O to reduce background; discard rinse.
10. Add sufficient Coomassie rapid stain to cover the gel. Stain on a shaker at room temperature for ~15 min.
11. Recover stain solution. Wash gel with ddH₂O until background is acceptable.

Outcomes:

Week 4 (7.07-7.13)

Experiment 1: Construction of the GLP-1(WT) Plasmid

Objective: To design and construct the recombinant plasmid GLP-1(WT) for subsequent protein expression studies.

Contents:

Designed the GLP-1(WT) plasmid, commissioned Genscript to synthesize the GLP-1(WT) gene fragment, and constructed the GLP-1(WT) plasmid.

Outcomes:

Experiment 2: Making Popping Boba

Objective: Attempt to create a Popping Boba that encapsulates engineered bacteria using sodium alginate.

Contents:

Preparation

1. Preparation of Calcium Chloride Solution: Weigh an appropriate amount of calcium chloride solid and transfer it into a beaker. Add ultrapure ddH₂O to prepare a 4% (w/v) calcium chloride solution, stirring continuously until the solid is completely dissolved.
2. Preparation of Sodium Alginate Solution: Weigh an appropriate amount of sodium alginate powder and gradually add it in small portions into a beaker containing ultrapure ddH₂O under continuous stirring. Continue stirring until the powder is fully dissolved.
3. Preparation of Apparatus: Cut silicone tubing of suitable inner diameter to a desired length. Rinse the tubing, single-phase extrusion needle, and coaxial extrusion needle with ultrapure ddH₂O, then dry and set aside.

Preparation of Single-Phase "Popping Boba"

1. Load a clean disposable syringe with a certain volume of sodium alginate solution and attach a single-phase extrusion needle. Gently and evenly push the syringe plunger to extrude droplets of sodium alginate solution in air, allowing them to naturally fall into a container filled with calcium chloride solution. The alginate droplets rapidly solidify upon contact, forming gel-like "popping beads."
2. Investigate the effects of different parameters on bead size by adjusting the inner diameter of the extrusion needle and the extrusion rate. Additionally, control the soaking time of the beads in the calcium chloride solution to study how crosslinking time influences the formation of "liquid-filled popping beads."

Preparation of Core–Shell "Stuffed Popping Boba"

1. Load one clean disposable syringe with sodium alginate solution and connect it via tubing (or directly) to the outer inlet of a coaxial extrusion needle. Load another syringe with colored pure ddH₂O or corn oil and connect it to the inner inlet of the coaxial extrusion needle.
2. Simultaneously and steadily push both plungers to extrude the alginate solution and the inner aqueous/oil phase through the coaxial needle, forming core–shell droplets in air. The droplets naturally fall into a container filled with calcium chloride solution, where the alginate shell rapidly solidifies, generating gel-like beads with a liquid-filled core.
3. Investigate the influence of extrusion flow rate ratio on the morphology and size of the core–shell beads. Furthermore, explore the effects of using different inner cores (e.g., ddH₂O vs. oil) on the formation and structural stability of the "stuffed popping beads."

Outcomes:

Week 5 (7.14-7.20)

Experiment 1: Verification of Plasmid Construction and Transformation

Objective: To confirm the correct size of the GLP-1(WT) insert and plasmid via PCR, and to transform the construct into the expression host E. coli BL21(DE3) for protein expression.

Contents:

1. The PCR verification of the GLP-1(WT) sequence was performed. The agarose gel electrophoresis results demonstrated that both the GLP-1(WT) sequence and the GLP-1(WT) plasmid were of the correct size.
2. The GLP-1(WT) plasmid was transformed into E. coli BL21(DE3) and streaked onto LB solid medium containing kanamycin for cultivation. Simultaneously, a control experiment was set up by transforming the PET plasmid into BL21(DE3).

Outcomes:

Experiment 2: Induction of Recombinant GLP-1(WT) Expression

Objective: To screen positive transformants and induce expression of the GLP-1(WT) protein under low-temperature conditions.

Contents:

1. The results of yesterday's transformation experiment were observed, and single colonies of BL21(DE3) containing GLP-1(WT) were successfully obtained.
2. A single colony was then picked and inoculated into 5 mL of LB liquid medium, followed by cultivation in a shaker at 37°C for 6 hours. Subsequently, 200 μL of the culture was transferred to 20 mL of LB liquid medium for expansion. When the OD value reached 0.6-0.8, IPTG was added to induce expression in an 18°C incubator.

Outcomes:

Experiment 3: Bacterial RNA Extraction and cDNA Synthesis

Objective: To isolate total RNA from bacterial samples and synthesize complementary DNA (cDNA) for downstream gene expression analysis.

Contents:

1. Bacteria were collected and centrifuged at 4000 rpm for 20 minutes. The pellet was transferred to a 1.5 mL centrifuge tube and washed twice with PBS.
2. RNA extraction: Performed using SteadyPure RNA Extraction Kit (Code AG21024) according to the manufacturer's protocol.
3. RNA concentration measurement: RNA concentration was determined using a K5600 Ultra-micro UV spectrophotometer.
4. Reverse Transcription (cDNA Synthesis): cDNA was synthesized using Evo M-MLV RT Mix Kit with gDNA Clean for qPCR Ver.2 (AG11728). The synthesized cDNA was stored at -20°C.

Experiment 4: Quantitative PCR Analysis of GLP-1(WT) Expression

Objective: To quantify the expression level of GLP-1(WT) mRNA in recombinant E. coli BL21(DE3) strains using real-time quantitative PCR (qPCR).

Contents:

1. Samples included three replicates each of empty vector control (PET-1 to PET-3) and GLP-1(WT) transformants (GLP-1(WT)-1 to GLP-1(WT)-3).
2. qPCR reactions were prepared using SYBR Green Premix Pro Taq HS qPCR Kit (AG11701). The reaction mixtures were loaded into a qTower³G Real-Time PCR system, and cycling parameters were set according to experimental requirements.
3. After amplification, results were saved and analyzed using the ΔΔCt method to determine relative mRNA expression levels.

Outcomes:

Experiment 5: Construction of the GLP-1(WT)-GFP Fusion Plasmid

Objective: To construct a C-terminal GFP-tagged GLP-1(WT) expression plasmid for recombinant protein expression.

Contents:

The GFP green fluorescent protein was fused to the GLP-1(WT) plasmid to serve as an indicator for protein expression. The GLP-1(WT)-GFP plasmid was designed, and the GFP fragment was synthesized by commissioning Genscript, followed by the construction of the GLP-1(WT)-GFP plasmid.

Outcomes:

Week 6 (7.21-7.27)

Experiment 1: Verification of Plasmid Construction and Transformation

Objective: To confirm the correct fusion of GLP-1(WT) and GFP sequences and to transform the verified plasmid into the expression host E. coli BL21(DE3).

Contents:

1. Design the FP (Forward Primer) on GLP-1 and the RP (Reverse Primer) on GFP for verification, ensuring that GLP-1 is fused to GFP. Perform PCR to validate the GLP-1(WT)-GFP fragment.
2. Transform the GLP-1(WT)-GFP plasmid into E. coli BL21(DE3) cells, and transfer onto a LB solid medium containing kanamycin for streak plating.

Outcomes:

Experiment 2: Expression of GLP-1(WT)-GFP Fusion Protein

Objective: To induce the expression of the GLP-1(WT)-GFP fusion protein in E. coli BL21(DE3).

Contents:

1. On the next day, take out the LB plate transformed the previous day, pick a single colony, and inoculate it into 5 mL of LB liquid medium.
2. Incubate the culture in a shaker at 37°C for 6 hours. Afterwards, transfer 200 μL of this culture into 20 mL of fresh LB liquid medium for scale-up.
3. When the OD₆₀₀ value reaches 0.6-0.8, add IPTG to induce protein expression, and continue incubation in an 18°C incubator.

Experiment 3: Detection of GFP Fluorescence in Recombinant Bacteria

Objective: To qualitatively and quantitatively assess the fluorescence intensity of bacterial cells expressing the GLP-1(WT)-GFP fusion protein.

Contents:

1. After retrieving the induced bacterial culture, 10 μL was aspirated and dropped onto a glass slide, which was then covered with a coverslip.
2. Using an inverted fluorescence phase-contrast microscope (Keyence, BZ-X810), the fluorescence intensity of the bacteria was recorded. The mean fluorescence intensity of the bacteria was statistically analyzed and compared using ImageJ software.

Outcomes:

Experiment 4: Optimization of GLP-1 Gene

Objective: To enhance the expression level of GLP-1 in E. coli through codon optimization of the wild-type gene sequence.

Contents:

To obtain a large quantity of GLP-1, we performed codon optimization on the GLP-1(WT) gene sequence. In this study, codon optimization was applied to both the GLP-1(WT) and GLP-1(WT)-GFP plasmids.

Outcomes:

Week 7 (8.04-8.10)

Experiment 1: Verification of Codon-Optimized Constructs

Objective: To confirm the correct size of codon-optimized GLP-1 fragments and compare the transformation efficiency of wild-type versus optimized plasmids in the expression host.

Contents:

1. The GLP-1(OP) and GLP-1(OP)-GFP fragments were verified, and both sequences were confirmed to be of the correct size.
2. Transform the Blank, pET, and GLP-1(OP) plasmids into E. coli BL21(DE3) cells, and plate them onto a solid medium for cultivation. Use the pET plasmid transformation as the negative control.

Outcomes:

Experiment 2: Expression of Codon-Optimized GLP-1(OP) Protein

Objective: To express the codon-optimized GLP-1(OP) protein in E. coli BL21(DE3) and evaluate its production level.

Contents:

1. Retrieve the LB plate transformed the previous day, pick a single colony, and inoculate it into 5 mL of LB liquid medium. Incubate the culture in a shaker at 37°C for 6 hours.
2. Subsequently, transfer 200 μL of the culture into 20 mL of fresh LB liquid medium for scale-up cultivation. When the OD₆₀₀ value reaches 0.6-0.8, add IPTG to induce protein expression and continue incubation at 18°C.
3. Upon observation of the results from yesterday's transformation experiment, we successfully obtained single colonies of E. coli BL21(DE3) harboring the GLP-1(OP) plasmid.
4. A single colony was then inoculated into 5 mL of LB liquid medium and cultured in a shaker at 37°C for 6 hours. Subsequently, 200 μL of this culture was transferred into 20 mL of fresh LB liquid medium for scale-up cultivation. When the OD₆₀₀ value reached 0.6-0.8, IPTG was added to induce protein expression, followed by incubation at 18°C.

Outcomes:

Experiment 3: RNA Extraction and cDNA Synthesis from Recombinant E. coli

Objective: To isolate high-quality total RNA from recombinant E. coli strains and synthesize cDNA for quantitative gene expression analysis.

Contents:

1. Bacterial Harvesting and Washing: The bacterial cells were collected by centrifugation at 4,000 rpm for 20 minutes. The pellet was then transferred to a 1.5 mL microcentrifuge tube and washed twice with PBS buffer.
2. RNA Extraction: Total RNA was extracted using the SteadyPure Universal RNA Extraction Kit (Code: AG21024), strictly following the manufacturer's protocol.
3. RNA Concentration Measurement: The RNA concentration was quantified using a K5600 Ultra-micro UV-Vis Spectrophotometer.
4. Reverse Transcription (cDNA Synthesis): Complementary DNA (cDNA) was synthesized using the Evo M-MLV RT Mix Kit with gDNA Clean for qPCR Ver.2 (AG11728). The resulting cDNA was stored at -20°C for subsequent use.

Experiment 4: Quantitative PCR Analysis of GLP-1 （OP）Expression

Objective: To compare the relative mRNA expression levels of GLP-1 in wild-type and codon-optimized strains using real-time quantitative PCR.

Contents:

1. Sample Types: pET, GLP-1(WT), and GLP-1(OP)
2. Using the SYBR Green Premix Pro Taq HS qPCR Kit (AG11701), the reaction mixture was prepared and loaded into the qTower³G Real-Time Fluorescent Quantitative Gene Amplifier. The reaction parameters were set, and the run was initiated.
3. After completion, the results were saved. Statistical analysis using the ΔΔCt method revealed that following codon optimization of GLP-1, an increase in GLP-1 mRNA levels was detected.

Outcomes:

Experiment 5: Induced Expression of GFP-Tagged GLP-1(OP)

Objective: To induce and compare the expression levels of GFP-fused wild-type and codon-optimized GLP-1 proteins.

Contents:

1. A single colony was selected and inoculated into 5 mL of LB liquid medium, followed by incubation in a shaker at 37°C for 6 hours. Subsequently, 200 μL of the culture was transferred into 20 mL of fresh LB liquid medium for expansion. When the OD₆₀₀ value reached 0.6–0.8, IPTG was added to induce expression, and the culture was incubated at 18°C.
2. The plate was continuously incubated in an 18°C incubator.

Week 8 (8.11-8.17)

Experiment 1: Analysis of GFP-tagged GLP-1 Expression by Fluorescence Microscopy

Objective: To compare the fluorescence intensity of bacterial cultures expressing GFP-tagged GLP-1 variants and evaluate the effect of codon optimization on protein expression levels.

Contents:

1. Observe the agar plates and record the results.
2. The induced bacterial culture was sampled. 10 μl was aspirated and dropped onto a glass slide, which was then covered with a coverslip. The fluorescence intensity of the bacteria was recorded using an inverted fluorescence phase-contrast microscope (Keyence, BZ-X810). The average fluorescence intensity of the bacteria was statistically analyzed and compared using ImageJ software. The results indicated that the codon-optimized GLP-1(OP)-GFP exhibited stronger fluorescence.

Outcomes:

Experiment 2: Stability evaluation of sodium alginate beads under acidic conditions

Objective: By simulating the low-acid environment of gastric juice, the tolerance and structural stability of sodium alginate burst beads (Popping Boba) under acidic conditions were detected, and its feasibility as an intestinal targeted delivery system was evaluated.

Contents:

1. Pretreatment: Sodium alginate samples are successively immersed in 3% calcium chloride (CaCl₂) solution and pure water for more than 30 minutes each to ensure full cross-linking and reduce the impact of swelling on the experimental results.
2. Acid treatment mechanism: In an acidic environment, high-concentration hydrogen ions (H⁺) undergo competitive displacement with calcium ions (Ca²⁺) at the carboxyl-bound sodium alginate crosslinking sites, disrupting the crosslinking structure. Long-term acid immersion may also cause acidic hydrolysis of the alginic acid chain.
3. Observation indicators: Record the mass changes (wet weight) of the samples under different acid treatment times and the macroscopic morphological changes in the oil phase. This study demonstrates that after sodium alginate beads were soaked in an acidic environment with pH=2 for 120 minutes, the mass loss rate was only 17.4%.

Outcomes:

Cycle2

Week 1 (7.25-7.31)

Experiment 1: Amplification of DNA Fragments

Objective: To amplify two DNA fragments: 500 bp upstream of CysE, 500 bp downstream of CysE.

Contents:

1. E. coli Bw25113 was cultured in LB liquid medium at 37℃ for 1 hour.
2. Use 1μL of bacterial suspension as the PCR amplification template.
3. Use the following substrate template for amplification:

   Primer Name	Sequence	Template	Product
   CysE upstream 500bp-F	TTATTGCCATTGGTGCGGG	Ecoil	500 bp upstream of CysE
   CysE upstream 500bp-R	TCACAGGACATGCTTACTCCACACGATGAGATAATG
   CysE downstream 500bp-F	GGAGTAAGCATGTCCTGTGATCGTGCCG	Ecoil	500 bp downstream of CysE
   CysE downstream 500bp-R	TTTACGAACCAGAAATTCCGCC

4. Prepare the PCR reaction system according to the following composition.

   Component	Volume (µL)
   Template (Ecoil)	1
   Primer-F	2
   Primer-R	2
   2× Taq Plus Master Mix	25
   ddH2O (sterile)	20

   Amplification was performed using a high-fidelity polymerase, with the annealing temperature and extension time consistent with the instructions.
5. The amplified products of 500 bp upstream and downstream of CysE were detected and recovered using agarose gel electrophoresis.
6. Use a gel extraction kit to recover and purify the above DNA fragments, then determine the concentration and store them.

Outcomes: We successfully amplified and obtained the above two DNA fragments.

Experiment 2: Assembly of DNA Fragments

Objective: Use the overlap connection method to link the 500 bp upstream and downstream regions of CysE.

Contents:

1. According to the following connection system configuration.

   Component	Volume
   Connection Fragment 1	X μL (50-100 ng)
   Connection Fragment 2	X μL (50-100 ng)
   Fragment 1 Primer-F (10 μM)	2 μL
   Fragment 2 Primer-R (10 μM)	2 μL
   2 x Phanta Max Master Mix	25 μL
   ddH2O	up to 50μL

   Amplification was performed using a high-fidelity polymerase, with the annealing temperature and extension time consistent with the instructions.
2. The overlap connection products were detected and recovered by agarose gel electrophoresis.
3. Use a gel extraction kit to recover and purify the above DNA fragments, then determine the concentration and store them.

Outcomes: We successfully connected and amplified a DNA fragment using overlap.

Experiment 3: Amplification of DNA Fragments

Objective: Amplify the guide sgRNA plasmid pEc-gRNA-CysE using PCR.

Contents:

1. Cultivate pEc-gRNA/DH5α using LB liquid medium, 5 mL per tube, three tubes.
2. Use a plasmid extraction kit to extract plasmids from bacterial strains, three tubes.
3. Use the following substrate template for amplification:

   Primer Name	Sequence	Template	Product
   CysE-gRNA-F	gtCCAGGTTTCTGTGACGTTCCgttttagagctagaaatagcaagttaaaataag	pEc-gRNA	pEc-gRNA-CysE
   CysE-gRNA-R	acGGAACGTCACAGAAACCTGGactagtattatacctaggactgagctag

4. Prepare the PCR reaction system according to the following composition.

   Component	Volume (µL)
   Template (pEc-gRNA)	1
   Primer-F	2
   Primer-R	2
   2× Taq Plus Master Mix	25
   ddH2O (sterile)	20

   Amplification was performed using a high-fidelity polymerase, with the annealing temperature and extension time consistent with the instructions.
5. Agarose gel electrophoresis was used to detect and recover the amplified products plasmid pEc-gRNA-CysE.
6. Use a gel extraction kit to recover and purify the above DNA fragments, then determine the concentration and store them.

Outcomes: We successfully amplified and obtained the above plasmid pEc-gRNA-CysE.

Experiment 4: Knockout gene CysE

Objective: Knock out the CysE gene in Escherichia coli BW25113.

Contents:

1. Take 100 μL of competent cells Bw25113, add more than 500 ng of the targeting fragment and more than 300 ng of the pEc-gRNA-CysE plasmid, and incubate on ice for 10–30 minutes.
2. Place a clean and dry 1 mm electroporation cuvette into a biosafety cabinet for 20 minutes of UV sterilization, then pre-chill it on ice. Quickly transfer the above-mentioned competent cells into the electroporation cuvette, ensuring that the cells settle to the bottom of the cuvette.
3. Dry the outer wall of the electroporation cuvette. Use a 1 mm electroporation cuvette and apply the electroporation protocol Ec1; (keep the time within 4.8–5.2 seconds).
4. Immediately after electroporation, add 900–1000 μL of LB liquid medium pre-warmed to 37°C, gently pipette to mix, then transfer the mixture to a 1.5 mL centrifuge tube. Incubate in a 37°C shaker at 200 rpm for 45–60 minutes, then take an appropriate amount of the culture to spread on a Kana⁺Str double-antibiotic plate.
5. Place the Petri dish in a 37°C incubator overnight (approximately 12 hours) for cultivation.

Outcomes: After incubation at 37°C for 12 hours, single colonies carrying the successfully transformed plasmid pEc-gRNA-CysE grew on the plate.

Experiment 5: Colony PCR verification of successful knockout of gene CysE

Objective: Verify whether the gene CysE was successfully knocked out

Contents:

1. Prepare the colony PCR reaction system according to the following composition

   Component	Volume (µL)
   Template (single colony)	-
   Primer-F (CysE upstream 500bp-F)	0.4
   Primer-R (CysE downstream 500bp-R)	0.4
   2× Taq Plus Master Mix	5
   ddH2O (sterile)	4.2

   Amplification was performed using a high-fidelity polymerase, with the annealing temperature and extension time consistent with the instructions.
2. Select one-third of 10 appropriately sized single colonies on the plate as templates for colony PCR.
3. Detection of colony PCR products using agarose gel electrophoresis

Outcomes: Compared with the wild-type Bw25113 control group, it can be seen that we have successfully knocked out the CysE gene.

Week 2 (8.01-8.07)

Experiment 1: Amplification of DNA Fragments

Objective: To amplify two DNA fragments: pSB1c-I38、CysE.

Contents:

1. Cultivate pSB1c-I38/DH5α using LB liquid medium, 5 mL per tube, three tubes.
2. Use a plasmid extraction kit to extract plasmids from bacterial strains, three tubes.
3. Use the following substrate template for amplification:

   Primer Name	Sequence	Template	Product
   pSB1c-V-F	ctcgagggtagatctggt	pSB1c-I38 (The original laboratory)	pSB1c-I38
   pSB1c-V-R	TCCAGTTCTTCACACGACATAATTCCCTCCTTAATTTTTAAC
   CysE-F	ATGTCGTGTGAAGAACTGG	Ecoil	CysE
   CysE-R	gtaccagatctaccctcgagTTAGATCCCATCCCCATAC

4. Prepare the PCR reaction system according to the following composition.

   Component	Volume (µL)
   Template (pSB1c-I38/Ecoil)	1
   Primer-F	2
   Primer-R	2
   2× Taq Plus Master Mix	25
   ddH2O (sterile)	20

   Amplification was performed using a high-fidelity polymerase, with the annealing temperature and extension time consistent with the instructions.
5. Agarose gel electrophoresis was used to detect and recover the amplified products pSB1c-I38、CysE.
6. Use a gel extraction kit to recover and purify the above DNA fragments, then determine the concentration and store them.

Outcomes: We successfully amplified and obtained the above two DNA fragments.

Experiment 2: Assembly of DNA Fragments

Objective: Construct recombinant plasmid pSB1c-I38-CysE using Gibson assembly technique.

Contents:

1. Set up the Gibson isothermal assembly reaction according to the following system.

   Component	Volume (µL)
   2x CE Mix	5.0
   pSB1c-I38 insert fragment (96.8ng/µL)	1.0
   CysE insert fragment (16.8 ng/µL)	0.3
   ddH2O (sterile)	3.7

2. Incubated the PCR tube at 50℃ for 15 minutes to allow the fragments to assemble.
3. Added the reaction mixture (about 10 µL) to 100 µL of DH5α competent cells for transformation.
4. Place the mixture in a 42 °C heat machine for 45 seconds, then let it rest at room temperature for 2 minutes.
5. Pipette 600 μL of LB liquid medium and add it to the competent cells.
6. Place in a shaking incubator at 200 rpm for 1 hour.
7. Centrifuge the competent cells (after recovery) and plasmid at 4200 rpm for 5 minutes to pellet the cells.
8. Discarded the supernatant and resuspended the cell pellet in the remaining liquid.
9. Spread the entire cell solution evenly onto an LB agar plate containing Chloramphenicol.
10. Placed the plate in an incubator at 37°C to grow overnight (about 12 hours).

Outcomes: The plate culture should select for E. coli that contain the successfully assembled plasmid. We observed colonies on the plate the next day.

Experiment 3: Colony PCR verification of recombinant plasmid

Objective: Verify the successful construction of the recombinant plasmid pSB1c-I38-CysE through colony PCR

Contents:

1. Prepare the colony PCR reaction system according to the following composition.

   Component	Volume (µL)
   Template (single colony)	-
   Primer-F (pSB1c-F)	0.4
   Primer-R (CysE-R)	0.4
   2× Taq Plus Master Mix	5
   ddH2O (sterile)	4.2

   Amplification was performed using a high-fidelity polymerase, with the annealing temperature and extension time consistent with the instructions.
2. Select one-third of 10 appropriately sized single colonies on the plate as templates for colony PCR.
3. Detection of colony PCR products using agarose gel electrophoresis

Outcomes: As can be seen from the figure, the actual bands of colony PCR match the ideal PCR bands we designed, and the validation was successful.

Experiment 4: Enzymatic validation of recombinant plasmid

Objective: Verify the successful construction of the recombinant plasmid pSB1c-I38-CysE through Enzymatic validation

Contents:

1. Three single colonies that tested positive by colony PCR were inoculated into 5 mL of LB liquid medium and cultured overnight at 37°C.
2. Use a plasmid extraction kit to extract plasmids from bacterial strains, two tubes.
3. Prepare the enzyme digestion system according to the following composition.

   Component	Volume
   Restriction endonuclease Kpn1	0.2μl
   Restriction endonuclease Pst1	0.2μl
   rCurtsmart	1μl
   pSB1c-I38-CysE (140ng/μl)	1.5μl
   ddH2O (sterile)	7.1μl

   The enzymatic reaction was carried out at 37 degrees Celsius for 2 hours.
4. Verify the enzymatic digestion products using agarose gel electrophoresis
5. Send the plasmid that has been successfully verified by enzyme digestion to the company for gene detection, and finally confirm that the plasmid construction is successful.

Outcomes: As shown in the figure, the band size after enzyme digestion is consistent with the ideal band we designed, indicating a successful verification.

The sequencing results are shown in the figure below, indicating that the recombinant plasmid pSB1c-I38-CysE was successfully constructed.

Week 3 (8.08-8.14)

Experiment 1: Test for cysteine auxotrophic strains

Objective: Verify the growth status of the CysE gene knockout strain.

Contents:

1. Prepare M9 liquid medium

   Component	Volume
   5×M9	2 mL
   Glucose	1 mL
   1mol/L MgSO4	20 μL
   1mol/L CaCl2	1 μL
   Antibiotic	10 μL
   DDH2O	Up to 10 mL

2. Add different concentrations of cysteine (0~0.8 mM) to the M9 liquid medium

Outcomes: As can be seen from the figure, with the increase of Cys concentration, the growth state of the strain improved. Moreover, in the absence of Cys, the strain died. Therefore, it can be concluded that this strain is a cysteine auxotrophic strain.

Experiment 2: 30°C, 37°C plate characterization

Objective: Transform the plasmid pSB1c-I38-CysE into the CysE gene knockout competent cells Bw25113 and verify its growth characteristics at different temperatures.

Contents:

1. Take the competent cells from -80°C and thaw them on ice;
2. Add 100 ng of plasmid pSB1c-I38-CysE and 100 μL of competent cells with the knockout gene CysE into a sterile centrifuge tube, and place the tube on ice for 30 minutes to allow the target DNA to adsorb onto the surface of the competent cells;
3. Heat shock the tube in a 42°C ddH₂O bath for 50 seconds, and then quickly return it to ice for cooling 2-3 minutes;
4. Add a certain volume of LB culture medium (e.g., 600 μL). After mixing evenly, place it in a shaker at 37°C for low-speed incubation for 1 hour to allow the competent cells to recover and grow;
5. Spread the solution onto M9 solid medium.
6. Place the coated plates into incubators set at 30°C and 37°C, respectively, for cultivation.

Outcomes: It can be clearly seen from the figure that the strain dies at 30°C and grows normally at 37°C.

Overview

Safety has been the paramount and continuously focused core dimension for Team QYZX-China throughout the entire iGEM project. Recognizing the inherent risks associated with microbial handling and various biological experiments involved in the project, the team is committed to mitigating potential hazards through systematic training for all members, strict adherence to safety protocols, and scientifically rigorous experimental design. Furthermore, we strictly comply with biosafety regulations and official iGEM safety guidelines, while actively incorporating expert advice from the field to ensure the comprehensive protection of team members, the ecological environment, and the broader community.

Biosafety Training

Biosafety has been taught in the pre-requisite courses, assignments are also made and completed to ensure that we recognize the importance of biosafety in our project.

To enhance students' awareness of biosafety, we offer a compulsory course before the experiment begins, systematically explaining the core principles of biosafety and the specific content of the official iGEM safety guidelines (such as the whitelist). Additionally, students and their guardians are required to jointly sign a confirmation form, explicitly acknowledging the potential risks and operational guidelines of the experiment. This ensures that students fully recognize the importance of biosafety from the very beginning of the experiment.

pre-requisite courses

consent form

Students and their guardians signed the Laboratory Safety Compliance Agreement:

• iGEM实验室安全规范责任书.pdf (Chinese version)
• Laboratory Safety Compliance Agreement.pdf (English version)

Lab Safety

All experiments in this project were conducted in a Biosafety Level 1 laboratory, strictly adhering to general biosafety guidelines relevant to synthetic biology research^[1]. The laboratory complies with all standard regulations regarding hygiene, fire safety, and workplace safety. The team established a comprehensive lab safety system through three key dimensions:

1. Pre-Experimental Biosafety Training: Before the project commenced, all team members underwent systematic training covering essential topics such as standard bacterial culture handling, safe use of chemical reagents, proper hygiene practices, emergency response procedures, and waste disposal protocols^[2,3]. Special emphasis was placed on the handling of genetically modified organisms (GMOs), including specific content on biocontainment measures and the prevention of potential environmental impacts.
2. Full-Process Personal Protection: During experiments, team members strictly followed protective protocols by consistently wearing lab coats, gloves, and safety goggles. This ensured not only personal safety but also effectively prevented sample contamination. All bacterial-related operations were performed inside a certified biosafety cabinet to minimize exposure risks and maintain a sterile working environment^[4].
3. Whole-Cycle Professional Supervision: All experimental designs and protocols were reviewed and approved by the principal investigator to eliminate biosafety risks at the source. Throughout the entire experimental process, professional supervision was implemented to ensure all safety measures were rigorously applied.

Safety Experiment Design

Chassis Organism

During the early design and construction phase of the project, we selected the BL21(DE3) strain. This strain features an efficient protein expression system and high ease of genetic manipulation, facilitating rapid functional validation of genetic circuits and providing strong technical support for the initial stages of project development.

As the project progressed to its final application stage, we switched to the EcN strain (Escherichia coli Nissle 1917)^[5]. As a recognized safe probiotic, EcN is not only widely used in scientific research and commercial products but, more importantly, possesses the natural ability to colonize the human intestine and perform functions, making it an ideal carrier for the oral delivery of GLP-1 (glucagon-like peptide-1).

It is worth emphasizing that both BL21(DE3) and EcN are classified as Biosafety Level 1 (BSL-1) microorganisms. Under standard laboratory operating conditions, they pose no harm to healthy individuals or the environment, fully complying with the biosafety requirements throughout the project^[6].

Gene and Products

The gene used in this project is derived from human chromosomes and is non-harmful^[7]. The vector employed is pET-28a(+), a commonly used laboratory plasmid that poses no risk to human health under standard experimental conditions^[8]. The successfully constructed GLP-1 protein originates from human intestinal L-cells and is non-toxic, non-infectious, and non-pathogenic^[9].

Preventing Engineered Strain Leakage

This project addresses the risk of gene leakage from engineered intestinal bacteria entering the environment via fecal excretion by developing a temperature-sensitive switch system based on an auxotrophic host^[10]. The system utilizes auxotrophic E. coli, which cannot survive in natural conditions, by expressing essential survival genes on a plasmid^[11] controlled by a temperature-sensitive promoter. This design allows precise control of bacterial survival through temperature regulation while eliminating the need for exogenous antibiotics, thereby reducing the risk of antimicrobial resistance.

Professional Advice

To conduct an in-depth assessment of the biosafety of this study, we specifically consulted Dr. Chen and Dr. Bo, both experts in the field of synthetic biology. The experts pointed out that the BL21(DE3) strain used in this project is classified as a Biosafety Level 1 (BSL-1) microorganism. Relevant studies indicate that such strains are considered non-pathogenic and lack ecological invasion potential due to their significantly reduced ability to survive and compete in natural environments^[12]. This conclusion provides critical biosafety justification for the subsequent experiments in the project.

Furthermore, to maximize biosafety assurance throughout the experimental process, the experts particularly emphasized that all experimental procedures must strictly adhere to standard operating protocols and be conducted under the supervision of qualified instructors to ensure compliance with biosafety management requirements at every step.