Experiments

Detailed experimental design, materials, methods, and protocols used throughout our project

1. Introduction

With syntcoLAB, our goal is to provide a novel platform to produce HMOs. As a reminder, HMOs are Human Milk Oligosaccharides. Since their production in the industry, through several processes, is very difficult, we thought about using consortia of lactic acid bacteria. This is a big project that we had to divide into different parts. 

First, the controlled aggregation of our bacteria (Streptococcus thermophilus), then the metabolic interdependence of our different strains and lastly the labour division and production of HMOs. 

This year, our research mainly focused on the aggregation of our bacteria, while we also explored the other related aspects.

2. Materials

2.1 Strains

Bacterial strains and oligonucleotides used in this project are listed are in the table 1 and ??? (list of primers), respectively.

Strain Description Origin
LMD-9 WT S. thermophilus Soumillion lab collection
LMD-9 mScarlet LMD9 tRNAthr::P32-hlpA-mScarlet-spec This study
LMD-9 mTurquoise LMD9 tRNAthr::P32-hlpA-mTurquoise-spec This study
LMD-9 mNeon LMD9 tRNAthr::P32-hlpA-mNeon-spec This study
LMD-9 fucanase1 LMD9 tRNAser::P32-PrtS signal peptide-Fucanase 168A-HtrA linker-PrtS CWSS-Cat This study
LMD-9 gal Random evolution on M17gal plates This study
LMD-9 mScarlet nanobody LMD9 tRNAthr::P32-hlpA-mScarlet-spec +
LMD9 PrtS::PrtS signal peptide-Nanobody LaG16-HtrA linker-PrtS CWSS-P32::Cat		 This study
LMD-9 mTurquoise nanobody LMD9 tRNAthr::P32-hlpA-mTurquoise-spec +
LMD9 PrtS::PrtS signal peptide-Nanobody LaG16-HtrA linker-PrtS CWSS-P32::Cat		 This study
LMD-9 mScarlet alpha-rep LMD9 tRNAthr::P32-hlpA-mScarlet-spec +
LMD9 PrtS::PrtS signal peptide-alpha-rep BGFP-HtrA linker-PrtS CWSS-P32::Cat		 This study
LMD-9 mTurquoise alpha-rep LMD9 tRNAthr::P32-hlpA-mTurquoise-spec +
LMD9 PrtS::PrtS signal peptide-alpha-rep BGFP-HtrA linker-PrtS CWSS-P32::Cat		 This study
LMD-9 ΔHtrA LMD9 HtrA::P32-cat This study
ExoPS- LMD9 Δeps Δrgp hasAB::P32-Cat Soumillon lab collection
TOP10 WT Escherichia coli TOP10 Soumillion lab collection

Table 1. List of strains used in our project.

2.2 Media & Culture Conditions

S. thermophilus LMD9 and derivatives were grown at 37°C without shaking in M17 (Difco Laboratories, Detroit, MI) or in chemically defined medium (CDM) (Letort, 2001) supplemented with 1% (wt/vol) glucose (M17G and CDMG, respectively). The composition of CDM is in the following table. We added spectinomycin (200 mg/mL) or chloramphenicol (5 mg/mL) when required. Solid plates inoculated with streptococcal cells were incubated anaerobically (BBL GasPak systems; Becton, Dickinson, Franklin Lakes, NJ) at 37°C.

Composition of CDM
Table 2. Composition of CDM, from Letort et al, 2001.

2.3 Chemicals

Below is the list of chemicals used in our experiments, with their source and application.

Ri03

We used the peptide Ri03 to inhibit exopolysaccharide production, since they could interfere with our surface display system. This peptide was purchased from ThermoFisher under the name 5-(4-Chlorophenyl)-2-furoic acid(CAS 41019-45-8).

sXIP

To induce natural competence, we used the pheromone sXIP(synthetic XIP); (LPYFAGCL) (purity >95%) supplied by Peptide 2.0 (Chantilly, VA) and resuspended first in dimethylformamide (DMF) and diluted in water to reach a low DMF concentration (final concentration of 0.02%).

PBS

For epifluorescence microscopy, we used PBS and PBS-agar (PBS supplemented with 1% v/v agar) as resuspension medium and for microscopy pads. PBS composition: 137 mM NaCl, 2.7 mM KCl, 1.8 mM KH2PO4, 10 mM Na2HPO4·H2O.

Fucoidan

We used fucoidan as fucose source. We used: Fucoidan = 95 9072-19-9

Product Name : Product Number : Batch Number : Source Batch : CAS Number : MDL Number : Quality Release Date : Test Fucoidan from Undaria pinnatifida ≥95% F8315-500MG 0000467431 0000452853 9072-19-9 MFCD00131109 02 Jun 2025

3. Methods

3.1 Construct amplification

During our work a lot of polymerase chain reaction (PCR) had to be done to amplify constructions our to replace some genes by others. All PCR were performed on reaction volumes of 25 µl using the Q5 2x Master Mix (New England Biolabs, USA) or the GoTaq polymerase (see PCR protocols). From the 25 µl of PCR products, 5µl were mixed with 7µl of purple dye and loaded on a 0.8% agarose gel in 1x TAE buffer for a 25 min run at 125V after which the gel was placed in a BET bath for 15-20 minutes before the reveal.  

The 20 µl of PCR products left were used for the DNA purification using either the Monarch Kit (New England Biolabs, USA) or the PEG/ethanol protocol. The purified DNA was then measured with the NanoDrop spectrophotometer and used for the natural transformation. 

3.2 Natural transformation

Streptococcus thermophilus brings a huge advantage in terms of synthetic biology as it is a natural competent bacterium. This characteristic allows us to be able to work with linear and not circular DNA. This process of natural transformation was used to integrate our constructions in our bacteria. For this part the general protocol was followed. Shortly, cells were cultivated overnight in CDMg at 37°C. Then, they were transferred into milk for a little over an hour before adding the peptide allowing the competence (sXIP) and the DNA of interest. This step is followed by 3 hours of incubation at 37°C before plating the transformed bacteria at different dilutions on gM17 agar plates. This step is followed by the restreaking and cultivation in gM17 of different clones. Each big step of the transformation is followed by an overnight incubation at 37°C in the typical protocol. In our case, since the constructions are quite big after the restreaking step we had to wait for 48 hours minimum to see isolated colonies. 

3.3 Controlled aggregation module

3.3.1 HtrA deletion, Alpha-rep, Nanobody & Fluorophore amplification

Two very important proteins found at the surface of Streptococcus thermophilus are HtrA and PrtS. The first thing we wanted to verify was the co-lethal character of the HtrA deletion in an ExoPS- strain as we needed to be able to display our proteins on the surface of the bacteria. To do so, we used the overlap PCR which allowed us to get rid of HtrA by replacing it with a resistance cassette. 

Before performing HtrA deletion, we first needed to get rid of the resistance cassette (ΔhasAB::P32-Cat) present in ExoPS- in order to use it for deleting HtrA and have a cleaned strain to work with. This cassette is flanked by lox sequences (lox 66 upstream and lox 71 downstream) on which we performed a loxing by transforming ExoPS- with a pGost plasmid encoding for a Cre recombinase specific to our both lox sequences, this pGhostCre is part of our lab collection. The performed loxing was failed with over 500 colonies screened. We checked the plasmid integrity using Bsph1 and Xba1 restriction enzymes. Bsph1 is predicted to cut at two sites in the plasmid, one being in the Cre recombinase gene. The agarose gel confirming this digestion showed a sole band, indicating that one of the two restriction sites was not as expected. To face this problem, we removed the resistance cassette using natural transformation by designing only homology arms, creating a recombination removing the P32-Cat. This resistance-less ExoPS- had an impaired growth by comparing it to LMD9. We so performed random evolution by cultivating the strain 10 consecutive days. The last evolved strain was sent to whole genome sequencing. From this sequencing, we saw that the eps and hasAB loci had reverted and that the rgp one was duplicated in the genome, indicating a critic role. To mimic ExoPS-, we ordered 5-(4-Chlorophenyl)-2-furoic acid, known inhibitor to rgp activity.

Alpha-rep and Nanobody are two of the three proteins that allow the controlled aggregation. They will each recognize a specific part of the GFP. The fluorophores are very important as our goal is to control the aggregation of bacteria that are genetically different. 

The amplification of these three constructions was performed using the classical PCR protocol and specific primers (see table of primers). 

3.3.2 Controlled aggregation assays

Controlled aggregation was the focus of our team. For this part, we used our fluorescent LMD9 strains that we transformed with Alpha-rep and Nanobody constructions. The first step was to cultivate them in CDMg at 37°C overnight. The following day, we made sure that each strain was at the same optical density (0.05) to avoid any imbalance. After this step, we did some co-culture of strains with different colour and different proteins (e.g. mScarlet/Alpha-rep and mTurquoise/Nanobody). These co-cultures were incubated for 3 hours before the washing step with PBS. After that, we added 10 µM of GFP in the co-culture and let it at room temperature for 1h30. The GFP was first produced in E.coli thanks to a plasmid. We transformed E.coli with the plasmid containing the GFP via electroporation. After we induced the overexpression with arabinose. Finally, we purified it using the Protein purification protocol. To visualize our results, we used the Epifluorescence microscopy. 

With the first try, the GFP concentration was too high, leading to cluster of GFP and a signal that was everywhere. Then, we tried this aggregation with 10 and 100 nM of GFP. For this try, we also changed the incubation time. We went from 3 hours at room temperature to 2 hours of incubation with GFP at 37°C. At this point, we saw a difference between the different conditions. The more GFP we added, the more aggregate our samples were. But we didn’t see any GFP and other results from our lab suggests that the bacterial envelop could be a problem for the surface display.

Therefore, in the future we will have to test the growth of bacteria along with Ri03 (a compound inhibiting the production of exopolysaccharides).  Before using epifluorescence microscopy, we are going to test the sedimentation of our sample. The more aggregation we have, the quicker the sedimentation will be. For this test, we will just re-suspend our bacteria and use the time laps method to see whether the sedimentation happened quicker in some sample. This test allows us to determine the conditions for an optimal sedimentation and therefore an optimal aggregation. It is a pre-test before using the epifluorescence microscopy with too many conditions.

3.4 Metabolic interdependency module

3.4.1 LMD9 on M17 supplemented with galactose 

As a part of our project is the metabolic interdependence, we thought about using auxotrophy which has the advantage of avoiding any antibiotics or other compounds that could be harmful for babies. To maintain balanced co-cultures with approximately 50% of each strain, we plan to exploit metabolic interdependence as a stabilizing strategy. The long-term goal is to engineer a Gal⁺ LacZ⁻ strain that depends on its partner for growth.

To do so, we plated LMD9 on M17 supplemented with galactose and after 72 hours we obtained a strain that was able to grow on a medium with galactose as a carbon source.

3.5 Division of labour module

3.5.1 Fucanase amplification & transformation

Fucanase is an enzyme allowing the break of fucoidan (Fucose polymers) into fucose monomers. The fucose is very important in our case as it is a component of 2’FL (fucosyllactose), a simple human milk oligosaccharide. Using fucoidan and not fucose directly has an economic interest as fucose is more expensive than fucoidan.

The amplification of the fucanase was done using the typical PCR protocol and the transformation was done using the natural transformation protocol.

The next step will be to use the L-fucose assay kit from Megazyme. This assay is based on the absorbance of our sample.

4. Protocols

4.1 Transformation in S.thermophilus

Day -1

  • Place the strain in culture in 1.3 mL of CDM (Chemically Defined Medium) with 1% glucose.

Day 0

  1. Place 50 µL of culture in 1 mL of Campina semi-skimmed milk.
  2. Incubate for 1 h 15 min at 37 °C, then add 2 µL XIP (ComR activating hormone) from the 500 µM stock and mix gently (do not vortex → invert the tubes several times).
  3. Take 400 µL in an Eppendorf tube and add 6 µL DNA of interest.
  4. Incubate for 3 h at 37 °C.
  5. Dilute from 10² to 10⁷ in milk (15 µL in 135 µL milk) on a sterile 96-well plate. Plate 100 µL on M17-Glu + selection marker plate and use 3 µL for the multi-channel dilution control.
  6. Incubate plates at 37 °C in an anaerobic jar.

Day 1

  1. Pick 4 colonies and streak them (2 colonies per plate).
  2. Incubate plates at 37 °C in an anaerobic jar.

Day 2

  • Place each clone in culture in M17.

Day 3

  • Prepare glycerol stocks: 800 µL culture + 800 µL sterile glycerol.

4.2 DNA Extraction

Minimum 500 µL is required for DNA extraction. Therefore, from a 1300 µL liquid culture, use 800 µL for glycerol storage and the rest for DNA extraction.

  1. Centrifuge for 1 min at 13,000 g → recover pellet, discard supernatant.
  2. Add 400 µL TRIS-EDTA (TE 1x) to resuspend.
  3. Centrifuge for 1 min at 13,000 g → recover pellet, discard supernatant.
  4. Resuspend in 400 µL TE 1x and homogenize.
  5. Transfer the 400 µL to a screw-cap tube + add 100 µL beads (~0.18 mm) (cut and dip tips).
  6. Fastprep at 6.5 for 1 min.
  7. Centrifuge at 16,000 g for 10 min, then place on ice.
  8. Collect 350 µL of supernatant.
  9. Store at -20 °C or proceed to PCR.

4.3 Polymerase Chain Reaction (Q5 High-Fidelity DNA Polymerase)

PCR (Polymerase Chain Reaction) is a technique used to amplify a template DNA by cycling through denaturation, annealing, and extension phases with a thermostable DNA polymerase.

Reaction Mix

Component Volume
Template DNA1 µL
Forward Primer (10 µM)1.25 µL
Reverse Primer (10 µM)1.25 µL
Q5 High-Fidelity DNA Polymerase0.25 µL
Q5 Reaction Buffer (5X)5 µL
dNTP Solution Mix (10 mM)0.5 µL
Nuclease-free waterto 25 µL

PCR Cycle

Step Temperature Time Cycles
Initial Denaturation98 °C30 s-
Denaturation98 °C10 s30×
Annealing50–72 °C30 s
Extension72 °C30 s/kb
Final Extension72 °C2 min-
Hold16 °C∞-

4.4 Polymerase Chain Reaction (GoTaq Polymerase)

Reaction Mix

Component Volume
Template DNA1 µL
MgCl₂2.5 µL
Forward Primer (10 µM)1.25 µL
Reverse Primer (10 µM)1.25 µL
GoTaq Polymerase0.125 µL
Buffer (5X)5 µL
dNTP Solution Mix (10 mM)0.5 µL
Nuclease-free waterto 25 µL

PCR Cycle

Step Temperature Time Cycles
Initial Denaturation95 °C30 s-
Denaturation95 °C15 s30×
Annealing45–68 °C15 s
Extension72 °C30 s/kb
Final Extension72 °C2 min-
Hold16 °C∞-

⚠️ The annealing temperature and the extension time may change depending respectively on the primers and the length of the target DNA. In our work, only these two parameters were adjusted.

4.5 PEG/Ethanol Purification

Polyethylene glycol (PEG) selectively precipitates high-molecular-weight DNA while leaving small fragments (primers, dimers) in solution.

Reagents

  • PEG solution: PEG 8000 20% + NaCl 2.5 M
    Note: PEG takes more than 20 minutes to dissolve when preparing the initial solution.
  • Cold 70–80% ethanol
  • Sterile ultrapure water

Preparation of PEG solution (for 50 mL)

  1. Weigh 10.0 g PEG 8000 (MW 6000–8000 ideal).
  2. Add 7.3 g NaCl.
  3. Add qH₂O to 45 mL.
  4. Stir and let PEG dissolve. If necessary, place in incubator or water bath at 37 °C and stir regularly.
  5. Once dissolved, adjust to 50 mL final volume with qH₂O.

Protocol

  1. Add 0.6–1 volume PEG solution to PCR product (v/v).
  2. Mix by inversion (5–10 times) or gently pipette up & down. Incubate 15 min at room temperature.
    Note: longer incubation (up to 2 h) can improve yield; avoid mixing during incubation.
  3. Centrifuge 15 min at 12,000–14,000 rpm (RT or 4 °C).
  4. Carefully discard supernatant without disturbing the pellet.
  5. Wash pellet with 5–10 volumes cold 70% ethanol.
  6. Centrifuge 5 min at 13,000 rpm (optionally at 4 °C).
  7. Repeat steps 5–6 if higher DNA purity is required.
  8. Remove ethanol and dry pellet 5–10 min at room temperature.
    Note: using a SpeedVac may improve DNA quality. Ensure no ethanol remains before next step.
  9. Resuspend pellet in 20–50 µL ultrapure water.

4.6 Epifluorescence Microscopy & Co-culture

Day -1

  • Prepare PBS solution: 137 mM NaCl, 2.7 mM KCl, 1.8 mM KH₂PO₄, 10 mM Na₂HPO₄·H₂O.
  • Start overnight cultures at 37 °C in 1.3 mL CDMg.

Day 0

  1. Measure optical density and dilute cultures in fresh CDMg to reach OD = 0.05.
  2. Incubate samples at 37 °C for 4 h.
  3. Centrifuge cells and wash 2× with 500 µL PBS. Resuspend pellet in CDMg.
  4. Add GFP (final concentration ≤ 5 µM) and incubate at 37 °C for 2–3 h.
  5. Centrifuge cells and wash 2× with 500 µL PBS. Resuspend pellet in 50 µL PBS.
  6. Prepare slides with PBS solution supplemented with 1.5% agarose and deposit 3 µL of cells.

4.7 Overexpression and Purification of Proteins

Day -1

  1. Prepare 4 cultures of 50 mL LB medium with E. coli from the cryostock.
  2. Incubate cultures at 37 °C overnight.
  3. Pre-heat 2 × 1 L LB medium at 37 °C overnight.

Day 0

  1. Check OD with a spectrophotometer (900 µL LB + 100 µL culture).
  2. Dilute culture to reach final OD = 0.08 in the 1 L LB medium.
  3. Incubate at 37 °C until OD reaches 0.4–0.6 (~2 h).
  4. Add 20 mL arabinose (50×) to induce protein production (GFP in our case).
  5. Incubate at 30 °C for 4 h.
  6. Keep 5 mL for a miniprep and centrifuge the rest at 3900 g, 15 min.
  7. Discard supernatant and resuspend pellet in wash buffer (100 mM Tris + 150 mM NaCl).
  8. Centrifuge 10 min at 5000 g and discard supernatant.
  9. Store pellet at -80 °C.

Day 1

  1. Resuspend pellet in 20 mL wash buffer.
  2. Apply solution on a Ni-NTA column (for His-tagged proteins).
  3. Wash with 20 mM imidazole solution to remove non-specific binding.
    Note: Use Bradford reagent (15 µL flow-through + 135 µL Bradford reagent) to monitor washing. Continue until blue color disappears.
  4. Elute protein of interest using 300 mM imidazole solution.

4.8 DNA Purification using Monarch Kit (New England Biolabs)

  1. Add 5 volumes Monarch Buffer BZ (e.g., 100 µL) to 1 volume sample (e.g., 20 µL). Mix well by pipetting or flicking the tube. Do not vortex.
  2. Insert Monarch Spin Column S1A into the collection tube and load the sample. Spin 1 min, then discard flow-through.
  3. Re-insert column into the collection tube. Wash by adding 200 µL Monarch Buffer WZ and spin 1 min. Discarding flow-through is optional.
  4. Repeat wash (step 3).
  5. Transfer column to a clean 1.5 mL microfuge tube.
  6. Add 5–20 µL Monarch Buffer EY to the center of the matrix to elute DNA. Wait 1 min, then spin 1 min.

4.9 Plasmid Purification — Miniprep (SMARTPURE Kit)

  1. Add 1–1.5 mL overnight bacterial culture to a 1.5 mL microcentrifuge tube.
  2. Centrifuge 30 s at 10,000 × g. Discard supernatant.
  3. Repeat steps 1–2 to collect more cells.
  4. Resuspend pellet completely in 250 µL Resuspension Buffer.
  5. Add 250 µL Lysis Buffer and gently invert tube 4–6 times. Do not exceed 5 min. Do not vortex to avoid genomic DNA shearing. Close Lysis Buffer bottle immediately after use to avoid acidification.
  6. Add 350 µL Neutralization Buffer and mix by inverting 4–6 times until cloudy and homogeneous.
  7. Centrifuge 10 min at >14,000 × g until a compact white pellet forms.
  8. Place a SmartPure column in a collection tube, apply supernatant, and centrifuge 30–60 s at 6,000 × g. Discard flow-through.
  9. Add 650 µL Wash Buffer to the column. Centrifuge 30–60 s at 12,000 × g. Discard flow-through.
  10. Repeat wash (step 9).
  11. Centrifuge an additional 1 min at 12,000 × g to remove residual liquid.
  12. Transfer column to a sterile 1.5 mL microcentrifuge tube.
  13. Add 50 µL Elution Buffer, ddH₂O or TE Buffer to the column. Let stand 1 min at RT.
  14. Centrifuge 1 min at 12,000 × g to recover purified plasmid DNA.

The purified plasmid DNA can be used directly or stored at -20 °C for long-term storage.

4.10 SDS-PAGE

  1. Add 5 µL bromophenol blue to 15 µL proteins.
  2. Incubate mixture at 98 °C for 10 min.
  3. Load sample on a 4–20% polyacrylamide gel.
  4. Run electrophoresis at 120 V for 1 h 30.
  5. Stain gel in ~20 mL Coomassie Brilliant Blue for at least 20 min.

4.11 Plasmid Extraction

Day 1

  1. Work under laminar flow hood / flame sterilization.
  2. Inoculate strain of interest in 10 mL appropriate medium (M17G for L. lactis, LB for E. coli) supplemented with the relevant antibiotic (encoded by the plasmid resistance cassette).
  3. Incubate overnight at 30 °C without shaking.

Day 2

  1. Work under laminar flow hood / flame sterilization.
  2. Aliquot culture into 4 × 2 mL microtubes and centrifuge 2 min at 13,000 rpm, RT. Discard supernatant. Remove remaining liquid with pipette if necessary.
  3. Outside hood/flame: Prepare lysozyme + S1 solution (2 mg/mL) by adding 25 µL lysozyme (−20 °C, 20 mg/mL) to 250 µL S1 buffer.
  4. Resuspend pellets:
    • Pellet 1 → 275 µL S1 + lysozyme
    • Pellet 2 → resuspend in suspension from Pellet 1
    • Pellet 3 → 275 µL S1 + lysozyme
    • Pellet 4 → resuspend in suspension from Pellet 3
    ➝ Results in 2 tubes (Pellet 2 & Pellet 4).
  5. Incubate 30 min at 37 °C water bath, mixing gently every 10 min.
  6. Add 500 µL S2 buffer and mix gently (invert 6–7×).
  7. Pre-cool centrifuge to 4 °C. Incubate samples 5 min at 4 °C.
  8. Add 375 µL S3 buffer, mix gently (invert 6–7×). Two phases should appear. Incubate 5 min at 4 °C.
  9. Centrifuge 10 min at 13,000 rpm, 4 °C. Collect supernatant into 2 mL screw-cap tube.

Phenol–Chloroform Extraction

  1. Under chemical fume hood: Add 1 volume phenol–chloroform–isoamyl alcohol (~900 µL). Close tube tightly, seal with parafilm, vortex 20 s.
  2. Centrifuge 7 min at 13,000 rpm, RT.
  3. Recover upper aqueous phase into clean 2 mL screw-cap tube. Repeat transfer twice (3× total), ending in a clean Eppendorf tube.

Ethanol Precipitation

  1. Outside chemical hood: Add 500 µL 100% ethanol (−20 °C), vortex 5 s, incubate 5 min at −80 °C.
  2. Centrifuge 7 min at 13,000 rpm, 4 °C. Carefully discard supernatant.
  3. Add 700 µL 70% ethanol (−20 °C), mix gently.
  4. Centrifuge 7 min at 13,000 rpm, 4 °C. Discard supernatant.
  5. Dry pellet in SpeedVac 30 min at 60 °C.
  6. Resuspend pellet in 20 µL sterile H₂O.
  7. Measure DNA concentration with Nanodrop, label tube, store at −20 °C.
  8. Repeat the procedure 2 more times (3 extractions total).

4.12 Loxage Protocol

Day –1

  1. Inoculate strains to be loxed in 1.3 mL CDM medium + appropriate antibiotic.
  2. Incubate overnight at 37 °C.

Day 0

  1. Transfer 50 µL culture into 1 mL semi-skimmed Campina milk. Incubate 1 h 15 at 37 °C.
  2. Add 10.5 µL XIP carrying the Cre plasmid. Mix gently by inversion (do not vortex).
  3. Incubate 3 h at 37 °C.
  4. Plate cultures on Erythromycin (Ery) agar. Incubate 24 h at 30 °C.

Day 1

  1. Select at least 8 isolated colonies.
  2. Resuspend each colony in 1 mL M17G broth (no antibiotic).
  3. Incubate overnight at 37 °C.

Day 2

  1. Prepare serial dilutions and plate on M17G agar without antibiotic (10⁻⁶ dilution).
  2. Incubate overnight at 37 °C.

Day 3

  1. Pick 10 colonies from each isolate.
  2. Streak each colony onto 3 plates:
    • Without antibiotic
    • With Erythromycin (Cre plasmid marker)
    • With Chloramphenicol (loxed cassette marker)
  3. Incubate overnight at 37 °C.

Day 4

  1. Compare plates.
  2. Inoculate liquid M17G medium with strains that show no resistance to either antibiotic.
  3. Incubate overnight at 37 °C.

Day 5

  1. Add glycerol and store strains at −80 °C.
  2. Perform PCR to confirm cassette loss.

4.13 L-Fucose Assay Kit

5. List of Primers

Table 1. Primers

ID Primer Sequence (5’→3’)
844AR MD UpPrtS fwdtcttttcagcgatttcc
849AR MD DownPrtS revctgtacaccatttctgatc
853AR_MD_M039blsttgaagaaataactgaattttcag
1028SA.Up_tRNAsercgttgtaacgtcactaacaatggaac
1024SA.Dw_tRNAsergagctgcgtaagttcagagagacc
1621CV_tRNAthr_DWtgcaccctagaggagtc
1690CV_FP_tRNAthr_1_UPcgcattagaaaATTACTGTCCTCGGGATATG
1691CV_FP_tRNAthr_1_DWGACAGTAATtttctaatgcgggtgaag
1692CV_FP_tRNAthr_2_UPGTAACGTGAaaagttagccggcttagc
1693CV_FP_tRNAthr_2_DWggctaactttTCACGTTACTAAAGGG
1715CV_tRNAthr_long_UPCGGCCGTAACTATAACGGTC
1716CV_tRNAthr_long_DWCCGTCCTCTTCAGCCTCTTG
1723CV_1692_bisGTAACGTGAaaagttagccggcttagctcag
1736CV_htra_Fctctagttgcgtttttcttttg
1737CV_htra::CAT_1FgaggactaaacTAAGGAAGATAAATCCCATAAG
1738CV_htra::CAT_1RCTTCCTTAgtttagtcctccttcttg
1739CV_htra::CAT_2FGTAACGTGAAttattgacaaatctgtc
1740CV_htra::CAT_2RgtcaataaTTCACGTTACTAAAGGGAATGTAG
1741CV_htra_Rctccatctttattcttgtcc
1743MB – STER0849 DOWN revgtatctctcaagtatcttttgaaataagaatg
CV1CV_DhtrA_RGTAACGTGAaaagttagccggcttagc
j1Cat to Ery UP RGAGAATATTTTATATTTTTGTTCATTTGATATGCCTCCTAAATTTTTATC
j2Cat to Ery Up FGATAAAAATTTAGGAGGCATATCAAATGAACAAAAATATAAAATATTCTC
j3Cat to Ery Dw RCAGTCGGCATTATCTCATATTATTTCCTCCCGTTAAATAATAG
j4Cat to Ery Dw FCTATTATTTAACGGGAGGAAATAATATGAGATAATGCCGACTGTAC

Table 2. Primer Combinations

Primers Target / Product
1715 + 1691Up fragment Fluorescent constructions (1542 bp)
1690 + 1693Fluorophores amplification (NeonGreen, mScarlet, mTurquoise) (2396 bp)
1692 + 1716Down fragment Fluorescent constructions (1088 bp), failed: replaced by 1723
1723 + 1716Down fragment Fluorescent constructions (1088 bp)
1715 + 1716Overlap PCR for fluorescent cassette and homology fragments (4987 bp)
1736 + 1738Up fragment for HtrA deletion (1393 bp), failed: replaced by CV1
1736 + CV1Up fragment for HtrA deletion (1395 bp)
1737 + 1740CAT cassette (Chloramphenicol resistance) for HtrA deletion (1326 bp)
1739 + 1741Down fragment for HtrA deletion (770 bp)
1736 + 1741HtrA deletion
983 + 1833Nanobody (3663 bp) and Alpha-rep (3744 bp) amplification
1020 + 1024Fucanase amplification (4883 bp)
983 + i1Up fragment for resistance cassette swapping (CAT → Ery) (1375 bp)
i2 + i3Erythromycin resistance gene (782 bp)
i4 + 1833Down fragment for resistance cassette swapping (CAT → Ery) (1767 bp)
983 + 1833Overlap PCR for resistance cassette swapping (α-rep: 3831 bp, Nanobody: 3750 bp)
844 + 849PrtS locus amplification

References

  1. Zhang Y, Li X, Wang Z, et al. “Structural investigation of Fun168A unraveling the recognition mechanism of endo-1,3-fucanase towards sulfated fucan”. International Journal of Biological Macromolecules. 2024; Volume:132622. doi: 10.1016/j.ijbiomac.2024.132622