TADPOLE: Technicalities

Understand Tadpole's technical aspects to harness its full potential.

Visualization and Download of Results

Once the software has completed the search and clustering of designs, the results are presented clearly and interactively through the Streamlit interface. In addition to visualization on the platform, TADPOLE provides several options for downloading and exporting data, ensuring reproducibility and compatibility with other tools.

Compressed File (.zip)

For quick and complete access to all search data, TADPOLE generates a compressed file (.zip) that meticulously organizes all relevant files. This download package is essential for archiving your work results or sharing them with other researchers. The contents of the .zip file include:

Organization by Cluster

Within the .zip, files are organized in separate folders, one for each cluster of structurally similar designs. This facilitates navigation and analysis of solution families.

Structure Files

For each design, you will find:

  • Structure Images: High-quality visualizations of the predicted secondary structures for ON and OFF states.
  • .ps Files: PostScript format files that allow high-resolution visualization and are compatible with bioinformatics tools like R-scape.
  • Text Files (.txt): Text documents with the RNA sequence, folding energies (MFE and ΔMFE), and structures in dot-bracket notation for each design. This allows you to easily import the data into other scripts or databases.

Detailed HTML Report 💡

The HTML report can be viewed immediately or downloaded as an independent file, allowing users to quickly access a summary of the results. This document provides a comprehensive analysis of the search, designed to help you make an informed decision about which designs to take to the laboratory.

Metrics Analysis and Design Ranking

Rather than including graphs, the report presents the most promising designs in two ordered lists. This allows users who don't want to perform exhaustive analysis to quickly identify the best options. Designs are ordered as follows:

By Minimum Free Energy (ΔMFE)

Designs are listed from highest to lowest according to the closeness of their ΔMFE to the input value provided by the user. The closest design is considered the best in terms of stability.

By FRE-CRE Pairings

Designs are ordered from highest to lowest according to the closeness of the number of base pairs between the FRE and CRE to the input value. A good design will have a number of pairings close to the optimal value for the desired state.

Success Criteria

These two criteria are crucial for determining the success of an RNA switch. The best design will be one that combines adequate folding energy with the correct number of pairings.

Cluster Analysis

For each cluster of designs, the report shows only the representative. This representative is the design that has the minimum free energy (MFE) closest to the MFE of the structure you provided as input. This helps you understand the common structural solutions found and identify the most robust design families, choosing the best from each group.

Example Report

Your browser does not support embedding HTML.

SBOL3 Format Export

TADPOLE offers the option to export designs in SBOL3 (Synthetic Biology Open Language), a crucial standard for interoperability in synthetic biology. This format allows standardized representation of designs, ensuring they can be shared and used in other tools.

Design Description

The SBOL3 file (.jsonld) contains a complete description of your RNA switch. This includes the complete RNA sequence as well as additional metadata in JSON format.

RNA Component (sbol3:Component)

Each design is exported as an RNA component. This component has a unique identifier and defined role, making it compatible with other systems that handle the SBOL standard.

Key Metadata

Within the JSON description, the following parameters are included for each design:

Structural Information
  • structure_unconstrained: The dot-bracket structure of the OFF state.
  • structure_constrained: The dot-bracket structure of the ON state.
Energetic Information
  • mfe_unconstrained: The minimum free energy of the OFF state.
  • mfe_constrained: The minimum free energy of the ON state.
Mutation Information

mutations: Information about any mutations performed in the SRE to optimize the design.

Interoperability and Collaboration

The ability to export in this format is essential for collaboration and reproducibility, allowing your designs to integrate seamlessly into the broader synthetic biology ecosystem.


This standardized format ensures that your RNA switch designs can be easily shared, validated, and reused across different research groups and computational platforms.

Example: How to Read the Exported Results in Your Own Project


>>> import sbol3
>>> doc = sbol3.Document()
>>> doc.read('/path/to/all_linkers.jsonld')

# Once the document is loaded, you can access both the sequences and the associated metadata
>>> for obj in doc.objects:
...     print(obj.identity, obj.name)
...     if hasattr(obj, "sequences"):
...         for seq in obj.sequences:
...             print("  Sequence:", seq.elements)
          

This way, you can not only reuse the generated constructs but also inspect their contextual information (names, descriptions, annotations, etc.), making it easier to integrate them into other projects or tools.

Principles for Selecting a Functional RNA Switch

Quick Start Guide

Get started with TADPOLE in 4 simple steps:

1

Add FRE Sequence

Input your functional RNA element sequence

2

Add CRE Sequence

Input your conformational RNA element

3

Add CRE Structure

The theoretical structure of your CRE element

4

Set Target Structure

Define the functional structure in dot-bracket notation

To construct a functional regulatory RNA switch, it is not enough to simply join an FRE and a CRE. A linker of defined length (typically 6–10 nucleotides) is essential to connect the two modules and control whether they influence each other.

The activation mechanism follows a ligand-dependent energy shift:

OFF State (unbound)

Without the ligand, the RNA adopts the most stable configuration, where the structural element is disrupted, preventing readthrough.

ON State (bound)

Ligand binding stabilizes the aptamer, restoring the functional structure of the structural element, thus allowing readthrough.

Main Design Criteria

The main design criteria for selecting a suitable linker are (See more information on the Model Page):

Energy difference

The OFF-state must initially be more stable than the ON-state by roughly half the ligand binding energy. Ligand binding then lowers the energy of the ON-state, making it the most stable configuration.

Limited inter-module pairings

Pairings between the aptamer and structural element in the unbound state must be limited, so the switch can properly transition between OFF and ON.

Accessible binding sites

Nucleotides forming the aptamer's entry and binding sites should be mostly free to allow ligand interaction.

Structural element disruption in OFF-state

Key nucleotides responsible for structural element function should be disrupted in the OFF state to ensure the switch is inactive.

Structural element preservation in ON-state

The same functional nucleotides should form their correct structure upon ligand binding.

Important Notes

All this is evaluated from the inputs of the user. The user needs to know necessarily: The sequence and structure (even if just predicted) of their FRE, and the functional parts of the structure (the key substructures for function).

In case the FRE's structure you aim to study is not well characterised, follow the next steps:

  • Use RNAFold to predict the structure of your element.
  • In order to identify the functional parts of your structure, this software includes an evolutionary analysis using a multiple sequence alignment (MSA) to help characterise conserved structural features.

Essential Inputs

Designing a switch with TADPOLE starts with a small set of inputs. At its core, you only need to tell the software two things:

  • The RNA element that performs the function (FRE).
  • The RNA element that acts as the control (CRE).

From there, you can refine your design by specifying desired structures, constraints, and the type of search method to use. The default values are based on our SECIS+theophylline aptamer system (See the tutorial on the Software Page for a guided explanation), so you can start experimenting right away without having to configure everything from scratch.

Functional RNA Element (FRE) Sequence

The RNA sequence of your functional element — the part that performs the biological action in the ON state.

Example: SECIS Element

FRE Sequence:
GGGCUCUGAAGCCGCUGAGCAAUGACCCUUUGGGUUCUGAGGCCCUGCUUUGGGGCGCAGGGACUUAAACCC

The SECIS element enables stop codon readthrough to insert selenocysteine.

Conformational RNA Element (CRE) Sequence

The RNA sequence of your control element — the part that changes conformation in response to a signal.

Example: Theophylline Aptamer

CRE Sequence:
GAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACCUUGCUAAGCCAUGA

An aptamer sequence that binds a ligand and changes shape to regulate translation.

Targeted Structure of the FRE (dot-bracket)

This input defines the exact RNA structure that your Functional RNA Element (FRE) must adopt in its active ON state.

The structure is written using dot-bracket notation, a standard way to describe RNA folding:

() Paired bases
. Unpaired bases

Example: SECIS Structure

Target Structure:
.((((.((....)).)))).

Without this targeted structure, the FRE would not carry out its function (e.g., enabling stop codon readthrough in SECIS).

How it is used in TADPOLE

Unlike constraints, this structure is not forced during folding prediction. Instead, TADPOLE generates candidate folds (via RNAFold) and then checks whether the predicted FRE conformation matches the structure you provided.

If it matches

The design is considered functionally valid.

If it does not match

The design is rejected.

This ensures that the FRE only counts as "ON" when it naturally adopts the conformation required for its function (e.g., a SECIS element forming the correct stem–loop for stop codon readthrough).

Important note on pseudoknots and non-canonical pairs: RNAFold cannot predict certain RNA features, such as pseudoknots or non-canonical base pairs (e.g., A–C, G–A). If your FRE relies on these features, the software will never predict them, and therefore, it will never "match" your input if you include them.

Solution:

  1. First, fold your FRE independently in RNAFold's web server.
  2. Take the predicted structure without pseudoknots or non-canonical pairs (which will still be a reasonable approximation of the true fold).
  3. Use this simplified structure as your FRE input (struct1).

This way, TADPOLE will be able to match predicted folds against your input and still filter valid ON states correctly, even if the biological element is more complex in reality.

               

📋 Example: SECIS FRE

               
                 

In our own construct, the theoretical structure for the SECIS element had G-A, A-G and U-U pairs that are non-canonical, and therefore, RNAFold can't predict. Following the steps mentioned above, we predicted the structure on RNAFold and got a similar structure overall, but without those non-canonical pairs. That is the structure used on our design and the default option for TADPOLE.

               
             
Watched Positions for FRE

What it is

Watched positions are a user-defined set of nucleotides in the Functional RNA Element (FRE) that are structurally critical for function. The idea is:

  • These positions do not have to be the only important sites, but if they are disrupted in the OFF state, the FRE is considered non-functional (which is the desired outcome for an OFF state).
  • TADPOLE evaluates these positions relative to the OFF-state structure: if these nucleotides change their pairing status (paired ↔ unpaired) compared to the functional ON state, the FRE is considered disrupted.
  • In short, these positions act as reporter sites: their disruption indicates loss of function.

Note: The ON state is defined by your reference structure (dot-bracket input). The check is whether these positions are disrupted in the OFF state.

How to use

Input format: a list of 1-based indices referring to positions within the FRE sequence.

📋 Example: SECIS Watched Positions

Watched Positions:
14, 15, 16, 17, 56, 57, 58, 59

Functional core region: nucleotides 10–63

Strategy: Monitor key stem positions that maintain structural integrity

Effect of changing this input

Fewer watched positions

More permissive search, higher chance to find candidates, but subtle structural drift may occur in the core.

More watched positions

Tighter structural control and higher confidence, but the search may be over-constrained and discard viable solutions.

Practical tips

  • Start minimal: pick 1–2 sentinel sites that truly report on function (e.g., stem-closing pair + 1–2 loop residues).
  • Don't watch everything: a representative subset is usually enough.
  • Paired bases: if a nucleotide is paired, you don't need to watch both sides—disruption of one will inherently affect the other.
Restriction Chain for the CRE (constraint)

This input is used to simulate the structural change that the Conformational RNA Element (CRE) undergoes in response to an external factor (e.g., ligand binding, temperature shift, miRNA interaction).

Since TADPOLE cannot explicitly model how every possible external signal alters RNA folding, the constraint string acts as a proxy: it restricts or permits base pairing in specific regions, guiding RNAFold to approximate the desired conformational shift.

How it works

  • The constraint is a dot-bracket–like string aligned to the CRE sequence (must have the same length).
  • During folding prediction, these rules tell RNAFold which bases may or may not interact, and in which direction.
  • Unlike the FRE target structure, here the constraint is imposed: the algorithm will enforce it.

Notation

Constraint notation guide:

( )

Forced paired bases

x

Forced unpaired base

<

Base may only pair with nucleotides on its 3′ side (to the right)

>

Base may only pair with nucleotides on its 5′ side (to the left)

.

No restriction

Think of < and > as soft pairing permissions: they don't fix exact partners, just limit the possible direction of interactions.

Two ways to use constraints

Full explicit fold (hard constraint)

Provide the complete secondary structure of the CRE (dot-bracket).

Pros: ensures the fold matches a known conformation.

Cons: can be over-constraining; the algorithm is forced to a structure that may not be realistic, reducing design robustness.

Minimal restrictions (soft constraints, recommended)

Instead of fixing the entire structure, define only the critical bases (e.g., which must stay unpaired, or which region must look 5′/3′ for pairing).

Pros: allows RNAFold to find natural low-energy states while still simulating the effect of the external stimulus.

Cons: requires some prior knowledge of which regions are essential.

               

📋 Example: Aptamer binding site

               
                 

In our theophylline aptamer design:

                 
                   
                      Binding Pocket:                       Must remain free to interact with the ligand                    
                   
                      Flanking Region:                       Tends to pair towards the 5′                    
                 
                 

So instead of forcing the whole fold, we assign a subtle constraint such as:

                 
                    <<<<<<<                  
                 

This is enough to bias the folding towards the desired functional conformation without overfitting the model.

               
             

Practical tips

  • Start minimal: use < and > windows around key regions. Add x or () only if strictly necessary.
  • Avoid over-constraining: long forced stems (((((....))))) can produce designs that look good in silico but fail in real conditions.
  • Remember limitations: RNAFold cannot predict pseudoknots or non-canonical pairs. Constraints also cannot force true pseudoknots.
  • Match lengths: the constraint string must have exactly the same number of characters as the CRE sequence.

Advanced Parameters

Search Method

Finally, you must choose how TADPOLE explores the design space. Two options are available:

Brute Force

Systematically evaluates all possible combinations.

Best for small search spaces; guarantees that the optimal solution will be found.

Computationally expensive: becomes impractical for long linkers or when mutations are allowed.

Suitable only for simple systems where the search space is limited.

Genetic Algorithm (GA)

Uses evolutionary strategies to iteratively improve designs.

Scales well to larger, more complex problems (e.g., long linkers, designs with mutations).

Does not guarantee the absolute global optimum, but reliably finds high-quality solutions within reasonable time.

In short, Brute Force prioritizes completeness, while the Genetic Algorithm prioritizes efficiency. This flexibility allows TADPOLE to support both quick tests and ambitious, large-scale explorations.

In our experience, Brute Force works well for linkers shorter than 7 nucleotides. For longer linkers or when mutations are enabled, the computational cost becomes too high, making the Genetic Algorithm the more practical choice.

Mutable Positions for FRE

What it is

This parameter allows you to define which nucleotides in the FRE can mutate. The goal is to explore sequence variants without breaking the essential biological function of the RNA switch.

Mutations are allowed only in positions that do not compromise the functional RNA element. If a nucleotide is paired in a stem, its complementary partner is automatically adjusted to maintain the pairing — preserving the secondary structure and avoiding functional disruption.

How to use

  • Define a list of mutable positions, numbered from the first nucleotide of the FRE sequence.
  • Only the listed positions can change during the search; all other nucleotides remain fixed.
  • If you specify a nucleotide that is part of a pair, its paired base will mutate accordingly to maintain complementarity and preserve the fold.
               

📋 Example: SECIS FRE

               
                 

The functional core lies between nucleotides **10–63**. Therefore, only nucleotides outside this region (1–9 and those after 63) should be mutable.

                 

Paired bases in stems are automatically co-mutated to preserve Watson–Crick pairing.

                 
                   
                      Functional Region:                       10–63                    
                   
                      Mutable Positions:                       1–9                    
                 
                 

This setup ensures that the critical region remains intact, while the flanking nucleotides can introduce diversity without compromising function. The illustrative setup highlights:

                 
                       
  • Watched (FRE): select a few apical-loop residues and both sides of key stem pairs within 10–63.
  •                    
  • Mutable (FRE): 1–9 (and >63 if present).
  •                    
  • Result: the core keeps its functional architecture; flanks supply sequence diversity.
  •                  
               
             

Practical tips

  • Start with a small set of mutable positions to limit the search space and reduce the risk of generating non-functional variants.
  • Remember that mutability expands the search space exponentially; Brute Force is impractical when mutations are included, so use the Genetic Algorithm.
  • Best practice: avoid putting watched indices themselves into the mutable list; watch them to preserve structure and functionality, mutate around them to explore diversity.
Linker Length

What it is

The linker is the sequence of nucleotides placed between the FRE and the CRE. Its length directly influences how the two elements can interact.

Short linker

Restricts flexibility, often forcing the CRE and FRE into rigid orientations.

Long linker

Introduces more conformational freedom, which expands the number of possible folds but also enlarges the search space.

Too long linker

Can cause the FRE to interact only with the linker itself, reducing effective FRE–CRE interactions.

TADPOLE treats linker length as a design parameter. In the Brute Force search, you can define a range to systematically explore. In the Genetic Algorithm (GA) search, linker length is optimized dynamically along with sequence variation.

How to use

Provide either:

  • A single value (e.g., linker length = 7), or
  • A range (e.g., 5–12), if using Brute Force.

When a range is given, Brute Force will systematically test each linker length in that interval.

The default range in TADPOLE is chosen based on literature as the most biologically plausible window.

               

📋 Example: SECIS + aptamer system

               
                 
                   
                      Tested Linker Lengths:                       5–9 nucleotides                    
                   
                      Brute Force Results:                       No valid linker found for <7 nt                    
                   
                      Genetic Algorithm (with mutations):                       Functional linkers found in 5-9 nt range                    
                 
               
             

Practical tips

  • Be aware that search complexity grows rapidly with longer linkers, especially if mutations are enabled.
  • For long linkers, Brute Force is not recommended — the GA is more efficient and practical.
  • If the FRE is highly structured, avoid overly long linkers, as they may divert interactions away from the CRE.
Maximum Changes on the FRE Structure

What it is

This parameter defines how much your functional RNA (FRE) structure can vary during the design search. In other words, it limits TADPOLE's tolerance for changes relative to the target FRE structure. This is important to preserve biological function while exploring new sequences or conformations.

How it works

  • The parameter is usually expressed as the maximum number of nucleotides whose state (paired vs unpaired) can differ from the target.
  • If a design exceeds this number, it is automatically discarded.
  • This allows exploration of variants with some flexibility without compromising functionality.
               

📋 Example: SECIS Tolerances

               
                 

Not all nucleotides in the SECIS are critical for its function. This means that some parts of the structure can change without losing functionality. For example, theoretically, the nucleotides at the base of the SECIS must be paired. However, in our constructs, we used designs where the first few bases were paired with nearby flanking sequences rather than strictly within the SECIS itself. This demonstrates that certain regions can tolerate structural changes while preserving function.

               
             

Why it is important

Provides a balance between exploration and control:

Too restrictive

Very few possible solutions, search is over-constrained.

Too permissive

High risk of losing the FRE's biological function.

Balanced approach

Helps the genetic or brute-force search focus on plausible solutions.

How to use it

  • Define the reference FRE structure (dot-bracket).
  • Decide how many changes to allow, depending on how strict the structure needs to be for function.
  • Enter that number in TADPOLE as the Maximum changes on the FRE structure.

Practical tips

  • For very sensitive FREs: start with a low value (1–2) to ensure functionality.
  • For FREs whose function depends only on certain parts of the structure, or for exploratory designs: allow up to 10 changes to increase diversity.
Maximum Number of FRE-CRE Pairings

What it is

This parameter sets the maximum number of base-pair interactions that can form between the FRE and the CRE in the OFF state. It controls how strongly the FRE and CRE can bind to each other, which directly affects folding, stability, and the ability to switch back to the ON state.

How it works

  • Expressed as a number.
  • If a design produces more pairings than the limit, it is automatically discarded.
  • The idea is that the OFF state should be stable, but not so stable that it prevents transition back to the ON state.
               

📋 Example: SECIS Pairing

               
                 
                   
                      Allowed Pairings:                       Up to 10                    
                   
                      Functionality:                       Enough to disrupt the ON structure while still allowing recovery                    
                 
               
             

Why it is important

  • Avoids excessive binding: too many FRE–CRE pairings in the OFF state can "lock" the system, making it too hard to switch back ON.
  • Keeps the search realistic: limiting the maximum interactions prevents an explosion of unfeasible designs dominated by over-stabilized OFF states.

How to use it

  • Look at the length of your FRE and CRE.
  • Decide a maximum number of pairings based on how strong you want the OFF state to be.
  • A good rule of thumb is around 10% of the nucleotides in your FRE.
  • Enter that number in TADPOLE as Maximum number of FRE-CRE pairings.

Practical tips

  • If your ON state is fragile or hard to stabilize → set a low limit (few pairings).
  • If your OFF state is too weak or unstable → allow more pairings.
  • Adjust the value depending on whether you want the system to favor easier activation (ON) or stronger repression (OFF).
Minimum Energy Difference (kcal/mol)

What it is

This parameter defines the minimum energy gap that must exist between the OFF and ON states of the FRE, ensuring a clear functional distinction between the two conformations. It is expressed in kcal/mol and provides a thermodynamic threshold that designs must satisfy to be considered valid.

There are three common cases:

  1. Ligand-aptamer designs: the ON state is stabilized by ligand binding to the CRE.
  2. miniRNA designs: the OFF state is stabilized by interactions with a small complementary RNA sequence.
  3. Intrinsic folding switches: the RNA shifts between ON and OFF conformations without an external binding partner.

The energy difference is calculated as the difference between the OFF and ON states. The system must satisfy the minimum energy threshold to ensure proper switching behavior.

Why it is important

  • Ensures that the OFF state dominates in the absence of the CRE (or ligand).
  • Guarantees that binding of the CRE (or ligand) is sufficient to flip the system into the ON state.
  • Prevents ambiguous folding outcomes where neither conformation is clearly preferred.

How to use it

Choose the minimum energy difference based on the type of switch:

  • Ligand/aptamer systems: typically 3–5 kcal/mol.
  • miniRNA-based switches: smaller thresholds (1–2 kcal/mol) may be sufficient.
  • Intrinsic folding switches: may require stronger differences (5+ kcal/mol).

Enter the chosen value into TADPOLE as the Minimum Energy Difference.

Practical tips

  • Too low a value → OFF and ON states may coexist, leading to leaky function.
  • Too high a value → CRE binding might not be sufficient to flip the switch.
  • Moderate values (3–5 kcal/mol) often give the best balance between robustness and responsiveness.

The minimum energy difference ensures OFF state dominates without ligand binding, and ON state dominates once binding adds stabilizing energy.

References

  1. Lorenz, R., Bernhart, S. H., Höner zu Siederdissen, C., Tafer, H., Flamm, C., Stadler, P. F., & Hofacker, I. L. (2011). ViennaRNA Package 2.0. Algorithms for Molecular Biology, 6, 26. https://doi.org/10.1186/1748-7188-6-26
  2. Cock, P. J. A., Antao, T., Chang, J. T., Chapman, B. A., Cox, C. J., Dalke, A., Friedberg, I., Hamelryck, T., Kauff, F., Wilczynski, B., & De Hoon, M. J. L. (2009). Biopython: Freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics, 25(11), 1422–1423. https://doi.org/10.1093/bioinformatics/btp163
  3. Rodnina, M. V., Korniy, N., Klimova, M., Karki, P., Peng, B. Z., Senyushkina, T., Belardinelli, R., Maracci, C., Wohlgemuth, I., & Samatova, E. (2019). Translational recoding: Canonical translation mechanisms reinterpreted. Nucleic Acids Research, 48(3), 1056–1067. https://doi.org/10.1093/nar/gkz783
  4. Jenison, R. D., Gill, S. C., Pardi, A., & Polisky, B. (1994). High-resolution molecular discrimination by RNA. Science, 263(5152), 1425–1429. https://doi.org/10.1126/science.7510417
  5. Berry, M. J., Banu, L., Harney, J. W., & Larsen, P. R. (1993). Functional characterization of the eukaryotic SECIS elements that direct selenocysteine insertion at UGA codons. EMBO Journal, 12(8), 3315–3322. https://doi.org/10.1002/j.1460-2075.1993.tb05983.x
  6. Mathews, D. H., Sabina, J., Zuker, M., & Turner, D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. Journal of Molecular Biology, 288(5), 911–940. https://doi.org/10.1006/jmbi.1999.2700
  7. Holland, J. H. (1992). Adaptation in Natural and Artificial Systems. MIT Press.
↑