Home

Team

Attribution Members Sponsorship

Project

Description Design Contributions Safety Notebook

Lab work

Engineering Materials Parts Protocol Modeling Hardware

Results

Human Practices

Education Intergrated Human Practice

Awards

Loading...
Back to top

Materials

Bacterial & Cell

  • DH5α (YB-biotech, Taiwan): for plasmid amplification.
  • BL21 (YB-biotech, Taiwan): for protein expression.
  • HEK293T：for protein expression of mammalian system

Plasmid

  • pET-15b: for expressing (Npu-DnaEC)-CWE-6xHis-CBD, 6xHis-(Npu-DnaEC)-CWE-CBD, and sRAGE-EGFP-6xHis-RGK-(Npu-DnaEN) protein in BL21
  • pcDNA3.1: for expressing (Npu-DnaEC)-CWE-6xHis-CBD, 6xHis-(Npu-DnaEC)-CWE-CBD, sRAGE-EGFP-6xHis-RGK-(Npu-DnaEN), and 6xHis-Thrombin-EGFP-linker-CBD protein in HEK293T

Marker

  • BioKit Biotechnology Incorporation 1 Kb DNA Ladder
    • Description: 1 kb DNA Ladder is suitable for size of linear double stranded DNA fragments from 0.5 kb to 10 kb. The 10 bands of the ladder contain fragment following sizes: 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 5, 6, 8 and 10 kb. The intensity of 1 and 4 kb is about three times than the other bands to serve as reference points.
  • BioKit Biotechnology Incorporation 100bp DNA ladder
    • Description: 100 bp DNA Ladder is suitable for size of linear double stranded DNA fragments from 100 bp to 3 kb. The 13 bands of the ladder contain fragments following sizes: 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000 and 3000 bp. The intensity of 500 bp is about three times than the other bands to serve as reference points.
  • SMOBIO [PM2600] ExcelBand™ 3-color High Range Protein Marker (9-245 kDa)
    • Description: 3-color High Range Protein Marker contain 12 pre-stained proteins which cover a wide range of molecular weights from 10 to 245 kDa in Tris-Glycine buffer. There are two bands that carry enhanced intensity corresponding to a green at 25 kDa and red at 75 kDa.

Primer

  • pET15b-EGFP-C7-5316-reverse
    • Sequence: 5'- GGTATATCTCCTTCTTAAAG -3’
    • Description：Applying in the colony PCR of pET-15b-(Npu-DnaEC)-CWE-6xHis-CBD, pET-15b-6xHis-(Npu-DnaEC)-CWE-CBD, and pET-15b-sRAGE-EGFP-6xHis-RGK-(Npu-DnaEN).
  • pET15b-EGFP-C7-6093-reverse
    • Sequence: 5'- TTTATACAGTCATCCATGCC -3’
    • Description：Applying in the colony PCR of pET-15b-6xHis-Thrombin-EGFP-linker-CBD.
  • pET15b-EGFP-C7-6145-forward
    • Sequence: 5'- GGATCCGGCTGCTAACAAAG -3’
    • Description：Applying in the colony PCR of pET-15b-(Npu-DnaEC)-CWE-6xHis-CBD, pET-15b-6xHis-(Npu-DnaEC)-CWE-CBD, and pET-15b-sRAGE-EGFP-6xHis-RGK-(Npu-DnaEN).
  • pET15b-EGFP-C7-5297-forward
    • Sequence: 5'- CTTTAAGAAGGAGATATACC-3’
    • Description: Applying in the colony PCR of pET-15b-(Npu-DnaEC)-CWE-6xHis-CBD, pET-15b-6xHis-(Npu-DnaEC)-CWE-CBD, and pET-15b-sRAGE-EGFP-6xHis-RGK-(Npu-DnaEN).
  • pET15b-EGFP-C7-6164-reverse
    • Sequence: 5' - CTT TGT TAG CAG CCG GAT CC - 3’
    • Description: Applying in the colony PCR of pET-15b-(Npu-DnaEC)-CWE-6xHis-CBD, pET-15b-6xHis-(Npu-DnaEC)-CWE-CBD, pET-15b-6xHis-Thrombin-EGFP-linker-CBD, and pET-15b-sRAGE-EGFP-6xHis-RGK-(Npu-DnaEN).
  • pET15b-EGFP-C7-6073-forward
    • Sequence: 5' - CTTTGTTAGCAGCCGGATCC - 3’
    • Description: Applying in the colony PCR of pET-15b-6xHis-Thrombin-EGFP-linker-CBD.
  • pcDNA3.1-952-forward
    • Sequence: 5'- GAATTCTGCAGATATCCAGC - 3’
    • Description: Applying in the colony PCR of pcDNA3.1- signal peptide-sRAGE-EGFP-6xHis-RGK-(Npu-DnaEN), pcDNA3.1-signal peptide-mutsRAGE-EGFP-6xHis-RGK-(Npu-DnaEN), pcDNA3.1- (Npu-DnaEC)-6xHis-CBD, 6xHis-(Npu-DnaEC)-CBD, and pcDNA3.1- EGFP-6xHis-CBD construction.
  • pcDNA3.1-971-reverse
    • Sequence: 5'- GCTGGATATCTGCAGAATTC - 3’
    • Description: Applying in the colony PCR of pcDNA3.1- signal peptide-sRAGE-EGFP-6xHis-RGK-(Npu-DnaEN), pcDNA3.1-signal peptide-mutsRAGE-EGFP-6xHis-RGK-(Npu-DnaEN), pcDNA3.1- (Npu-DnaEC)-6xHis-CBD, 6xHis-(Npu-DnaEC)-CBD, and pcDNA3.1- EGFP-6xHis-CBD construction.
  • pcDNA3.1-900-forward
    • Sequence: 5'- CGTTTAAACTTAAGCTAACC – 3’
    • Description: This primer is employed for amplifying the pcDNA3.1 vector, (Npu-DnaEC)-CWE-6xHis-CBD, 6xHis-(Npu-DnaEC)-CWE-CBD, and sRAGE-EGFP-6xHis-RGK-(Npu-DnaEN) construction in mammalian system.