Contribution
STREAM set out to create a robust and versatile platform that integrates both biological and technological innovation across our dry and wet lab efforts. Our dry lab team developed a comprehensive, user-friendly manual for operating the chemostat, accompanied by open-source software designed to control and monitor the system efficiently. Our wet lab team created a library of small-molecule-responsive genetic parts derived from the Escherichia coli Marionette strain family (Meyer et al., 2019). Alongside these contributions, we also developed a mathematical model that provides you with a mathematical representation of the processes in the bioreactor, and optimizes the process.
Contribution Drylab
We contribute a fully independent setup that allows for maximal flexibility, minimal costs and full accessibility to the iGEM community.
Hardware
Our project represents a major step toward making research more accessible, sustainable, and inclusive. We designed a system that empowers iGEM teams, small laboratories, and educational groups to build and use otherwise expensive and complicated experimental setups independently.
To make this possible, we provide a detailed, step-by-step guide that walks users through the entire assembly process. Thanks to the modularity of its components, the system is highly adaptable and can be easily adjusted to a wide range of experimental questions and applications, from basic research to innovative synthetic biology projects or biotechnology questions. We made sure that our system works in every lab around the globe: all components are autoclavable and sterilizable (see sterilization protocol for more details). This ensures safe, reliable use and facilitates sustainable experimental practices.
Software
We couple the hardware to an easy-to-use, open-source software, which can be used to control the chemostat and monitor the system. Together, the STREAM Chemostat Controller and the chemostat itself transform complex microbial experiments into reproducible, safe, and interactive research, empowering teams to explore, optimize, and learn with precision.
Model
For further teams and other users to develop an intuition for the chemostat process and to predict inducer effect based on time of spiking and dosage, we developed a Simulation Model. This shows trajectories for key parameters such as growth rate and product concentration and can be coupled to an optimization process that returns the best spiking times and dosages based on the given parameters.
Wetlab
New Marionette derived parts added to the iGEM registry
An aspiration of this project was to contribute a large library of small-molecule–responsive genetic parts derived from the E. coli Marionette strain family. We cloned each promoter sequence (Table 1 and 2 below) into a MoClo Level-0 vector (pMC_V_01_Part_Entry_sfGFP)(Werner et al., 2012), which has a chloramphenicol resistance cassette for positive selection, making the parts plug-and-play for downstream assembly and characterization. Parts contributed (function & value):
Table 1: Transcription factors and their signals and features
| Promoter / System | Inducer / Signal | Description & Features |
|---|---|---|
| pPhlF (PhlF system) | 2,4-Diacetylphloroglucinol (DAPG) | DAPG-inducible promoter. Provides tight, orthogonal induction. Adds an independent expression “channel” for multiplex control. See Figure 1 for exemplary in-silico plasmid. |
| pCymRC (CymR system) | Cuminic acid | Robust, tunable induction with cuminic acid. Ideal for combinatorial tuning with minimal cross-talk in multi-inducer setups. |
| VanR-AM | Vanillate | Vanillate-responsive transcription factor enabling vanillate-inducible control when paired with its cognate promoter. Expands beyond classic IPTG/aTc/Ara inputs. |
| pTtg (TtgR system) | Naringenin | Flavonoid-responsive promoter suited for metabolic engineering or biosynthesis demos. Provides strong induction with controlled leakiness. |
| p3B5B (PcaU system) | 3,4-Dihydroxybenzoic acid (DHBA) | Benzene-derivative–responsive promoter. Useful when multiple independent regulatory “knobs” are needed. |
| pSalTCC (NahR system) | Salicylate | Salicylate-inducible promoter with low background expression. Good companion channel in multiplex circuit designs. |
| pCin (CinR QS system) | 3-OHC14-AHL (3-hydroxytetradecanoyl-HSL) | Quorum-sensing–style promoter responsive to long-chain AHL signals. Useful for cell–cell communication modules. |
Table 2: Sequences for promoters of Marionette strain (All fragments were supplied by Twist Bioscience)
| Name | Insert Sequence |
|---|---|
| nahR-AM | ATCGTCTCACTCGAATGGAACTGCGTGACCTTGATTTAAACCTGCTGGTGGTGTTCAACCAGTTGCTGGTCGACAGACGCGTATCTGTCACTGCGGAGAACCTGGGCCTGACCCAGCCTGCCGTGAGCAATGCGCTGAAACGCCTGCGCACCTCGCTACAGGACCCACTCTTCGTGCGCACACATCAGGGAATGGAACCCACACCCTATGCCGCGCATCTGGCCGAGCACGTCACTTCGGCCATGCACGCACTGCGCAACGCCCTACAGCACCATGAAAGCTTCGATCCGCTGACCAGCGAGCGTACCTTCACCCTGGCCATGACCGACATTGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGCTGGCTCACCAGGCCCCCAATTGCGTGATCAGTACGGTGCGCGACAGTTCGATGAGCCTGATGCAGGCCTTGCAGAACGGAACCGTGGACTTGGCCGTGGGCCTGCTTCCCAATCTGCAAACTGGCTTCTTTCAGCGCCGGCTGCTCCAGAATCACTACGTGTGCCTATGTCGCAAGGACCATCCAGTCACCCGCGAACCCCTGACTCTGGAGCGCTTCTGTTCCTACGGCCACGTGCGTGTCATCGCCGCTGGCACCGGCCACGGCGAGGTGGACACGTACATGACACGGGTCGGCATCCGGCGCGACATCCGTCTGGAAGTGCCGCACTTCGCCGCCGTTGGCCACATCCTCCAGCGCACCGATCTGCTCGCCACTGTGCCGATATGTTTAGCCGACTGCTGCGTAGAGCCCTTCGGCCTAAGCGCCTTGCCGCACCCAGTCGTCTTGCCTGAAATAGCCATCAACATGTTCTGGCATGCGAAGTACCACAAGGACCTAGCCAATATTTGGTTGCGGCAACTGATGTTTGACCTGTTTACGGATGCTTTGAGTGAGACGAT |
| P3b5marionette | GTGGTTGTCCTCCTATCACGGCACAAGTCAGCCTCGTGACCGTCAACTAAGTTAAGCTCGAAGATCGCGTACGGCACGACATCGTCTCACTCGGGAGTTTTGTTCGATTATCGAACAAATTATTGAAATATCGAACAAAACCTCTAAACTACTGTGGCACTGAATCAAAAAATTATAAACAATGATCAGATACTTGAGTGAGACGATGCTTTCGACGAAGACCTTAAATGGTCGGGACTATGCCGTTGGATTCTTTTATATTTGACTGCCGTAACCTCGTTGACGTCATGGTGTATCGTCGCGGAGG |
| Pbadmarionette | ATCGTCTCACTCGGGAGAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTACTTGAGTGAGACGAT |
| Pcinmarionette | AGCTCGAAGATCGCGTACGGCACGACATCGTCTCACTCGGGAGCCCTTTGTGCGTCCAAACGGACGCACGGCGCTCTAAAGCGGGTCGCGATCTTTCAGATTCGCTCCTCGCGCTTTCAGTCTTTGTTTTGGCGCATGTCGTTATCGCAAAACCGCTGCACACTTTTGCGCGACATGCTCTGATCCCCCTCATCTGGGGGGGCCTATCTGAGGGAATTTCCGATCCGGCTCGCCTGAACCATTCTGCTTTCCACGAACTTGAAAACGCTTACTTGAGTGAGACGATGTGGTTGTCCTCCTATCACG |
| PcymRCmarionette | GTGGTTGTCCTCCTATCACGGCACAAGTCAGCCTCGTGACCGTCAACTAAGTTAAGCTCGAAGATCGCGTACGGCACGACATCGTCTCACTCGGGAGAACAAACAGACAATCTGGTCTGTTTGTATTATGGAAAATTTTTCTGTATAATAGATTCAACAAACAGACAATCTGGTCTGTTTGTATTATTACTTGAGTGAGACGATGCTTTCGACGAAGACCTTAAATGGTCGGGACTATGCCGTTGGATTCTTTTATATTTGACTGCCGTAACCTCGTTGACGTCATGGTGTATCGTCGCGGAGG |
In addition to these promoters, we also saw fit to contribute our primer sequences [table 3] for amplification of the promoters’ respective transcription factors out of the Marionette strain DH10ß. This should serve towards easier accessibility for future iGEM teams. Please note that these primers were developed for the MoClo backbone pMC_V_01_Part_Entry_sfGFP (Klein Carlo A. et al. 2019), which is used in the MoClo flex system as a L0 acceptor.
Table 3: Primers for amplification of transcription factor sequences out Escherichia coli Marionette strain (All oligonucleotides were supplied by Integrated DNA Technologies)
| Primer Name | Primer Sequence |
|---|---|
| PCR_araC_f | atcgtctcaCTCGAatggctgaagcgcaaaatgatcc |
| PCR_araC_r | atcgtctcaCTCAAAGCtgacaacttgacggctacatca |
| PCR_araE_f | atcgtctcaCTCGAatggttactatcaatacggaatctgc |
| PCR_araE_r | atcgtctcaCTCAAAGCgacgccgatatttctcaacttctcg |
| PCR_betI | atcgtctcaCTCGAatgccgaaactgggtatgcag |
| PCR_betI_r | atcgtctcaCTCAAAGCatcggtcggcagatgctg |
| PCR_cinR_f | atcgtctcaCTCGAatgattgagaatacctatagcgaaaag |
| PCR_cinR_r | atcgtctcaCTCAAAGCccaattacgtcgcgtcatgc |
| PCR_cymR_f | atcgtctcaCTCGAatgagcccgaaacgtcgtacc |
| PCR_cymR_r | atcgtctcaCTCAAAGCacgtttgaattttgcataacgttcacg |
| PCR_luxR_f | atcgtctcaCTCGAatgaaaaacataaatgccgacgac |
| PCR_luxR_r | atcgtctcaCTCAAAGCatttttaaagtatgggcaatcaattgctcc |
| PCR_pcaU_f | atcgtctcaCTCGAatgtggtcgaacatggatgac |
| PCR_pcaU_r | atcgtctcaCTCAAAGCcaggatattgcgcaattcacg |
| PCR_phlF_f | atcgtctcaCTCGAatggcacgtaccccgagc |
| PCR_phlF_r | atcgtctcaCTCAAAGCacactgtgtacccggacaaacacc |
| PCR_ttgR_f | atcgtctcaCTCGAatggttcgtcgtaccaaagaagagg |
| PCR_ttgR_r | atcgtctcaCTCAAAGCtttacgcagtgccggactc |
| PRC_lacImarionette_f | atcgtctcaCTCGAatgaaaccagtaacgttatac |
| PCR_LacImarionette_r | atcgtctcaCTCAAAGCctgcccgctttccagtc |
| PRC_tetRmarionette_f | atcgtctcaCTCGAatgtccagattagataaaag |
| PCR_tetRmarionette_r | atcgtctcaCTCAAAGCggacccactttcacatttaag |
| PCR_VanRmarionette_f | atcgtctcaCTCGAatggacatgcctcgtattaaac |
| PCR_VanRmarionette_r | atcgtctcaCTCAAAGCatctgcacgaattgacc |
These L0 (CmR) parts give teams a few more clean, orthogonal “dials” for gene expressions that are not already in the Distribution Kit. They are ideal for modular cloning, so you can prototype multi-input circuits or balance pathways without spending time rebuilding basics. Each part adds a distinct small-molecule control option, making it easier to mix, match, and scale designs.
References:
Klein Carlo A. , Emde Leonie , Kuijpers Aaron , Sobetzko Patrick, MoCloFlex: A Modular Yet Flexible Cloning System, Frontiers in Bioengineering and Biotechnology, Volume 7 - 2019
Meyer, A.J., Segall-Shapiro, T.H., Glassey, E. et al. Escherichia coli “Marionette” strains with 12 highly optimized small-molecule sensors. Nat Chem Biol 15, 196–204 (2019).
Werner, S., Engler, C., Weber, E., Gruetzner, R., & Marillonnet, S. (2012). Fast track assembly of multigene constructs using Golden Gate cloning and the MoClo system. Bioengineered, 3(1), 38–43.