Lab Notebook

Overview

Many teammates collaborated to complete our experiments.

pET-CH1 plasmid construction was carried out by Chenjiong Wan, Yixiang Sun, Jinyao Chu, Yingjie Sun and Ye Zhu, while pET-F4 plasmid construction was carried out by Sibo Hu, Ziqian Wu, Jiaye Li, Xinxin Li, Ni Liu and Yuxuan Ma.

Literature Study and dsRNAs Design

June 12 - July 4, 2025

 Aim:
  • To search for dsRNA design and prediction literatures and tools.
  • Recent researches on Lasiodiplodia theobromae.
  • Double-stranded RNA (dsRNA) for RNA interference (RNAi) targeting Chitin Synthase (predicted) in Lasiodiplodia theobromae.
Protocols:
  • Both international and national databases were used.
  • Oligowalk from Mathews group was used for siRNA design.
Results:
  • Partial mRNA sequence of Chitin Synthase in Lasiodiplodia theobromae was downloaded from GenBank.
  • Nucleitide sequence of sGFP was provided by PLD Technology (the supplier of cell-free protein expression kit we used last year).
  • Three dsRNA fragments, named F1-3 targeting Chitin Synthase in Lasiodiplodia theobromae and one dsRNA, named F4 fragment targeting superfold GFP were designed.

    • Table 1. Four dsRNA fragments sequences.

    Name Sequence
    F1CCGGAATTCCGGATGTCGAGTACAAGATGAGTAATTCTCGAGTGTTACTCATCTTGTACTCGATAGTAGCCCAAGCTTGGG
    F2CCGGAATTCCGGATGCCGACGATGCTGATTTGAATTCTCGAGTGTTCAAATCAGCATCGTCGGTAGTAGCCCAAGCTTGGG
    F3CCGGAATTCCGGATGGCTCACGTTTACGAGTACATTCTCGAGCGTGTACTCGTAAACGTGAGCTAGTAGCCCAAGCTTGGG
    F4CCGGAATTCCGGATGGCATTAAAGCGAATTTTAATTCTCGAGTTTTAAAATTCGCTTTAATGCTAGTAGCCCAAGCTTGGG
  • For safety reasons, we cannot culture the pathogenic fungi that cause peach gummosis, and thus cannot verify whether the designed dsRNAs can interfere with their growth. Instead, if we can develop dsRNA that interferes with the synthesis of sGFP, we will be able to determine the success of the experiment with the naked eye. So cloning experiment was only carried out on F4 fragment. Key structural features of F4 fragment:
    • Restriction Enzyme Recognition Sites:
      • An EcoRI restriction site (GAATTC) is present at the 5' end (sequence position: 5-10).
      • A HindIII restriction site (AAGCTT) is present at the 3' end (sequence position: 64-69).
    • Sequence Composition:
      • Total length: 73 base pairs (bp).
      • Protective bases (CCG at the 5' end and GGG at the 3' end) are attached to both ends to enhance restriction enzyme digestion efficiency.

Gene Fragments and Primers Synthesis

June 26 - July 18, 2025

 Notes:
  • Nucleitide sequence of Prunus persica chitinase, named CH1 was downloaded from KEGG.
  • CH1 gene fragments was synthesized free of charge by GenScript China.

    • Table 2. Primers and synthesized DNA fragment used in this project.

    Name Sequence
    T7_PTAATACGACTCACTATAGGG
    T7_TTGCTAGTTATTGCTCAGCGG
    CH1_F1ATGGGTCGCGGATCCGAATTCATGGCTAGCTATAGACTACTAAGCCTCA
    CH1_R1CTCGAGTGCGGCCGCAAGCTTCTAGCAGGAGAGATTAGTGCCAGG
    F4CCGGAATTCCGGATGGCATTAAAGCGAATTTTAATTCTCGAGTTTTAAAATTCGCTTTAATGCTAGTAGCCCAAGCTTGGG

GFP plasmid and pET-28a(+) plasmid amplification

July 14 - 22, 2025

 Aim:
  • Amplification of commercial GFP plasmid DNA (PLD Technology) by BL21(DE3) and pET-28a(+) plasmid DNA (Yeasen Biotechnology) by DH5α.
  • To test the activities of the DH5α super competent cells purchased last year.
Protocols:
  • Transformation by using BL21(DE3) and DH5α super competent cells (Beyotime Biotechnology)
  • Plasmid DNA isolation by Plasmid Miniprep kit (Beyotime Biotechnology)
  • dsDNA concentration determination by Qubit dsDNA High Sensitivity kit (Thermo fisher) and Fluorometer Gen5 (Leader Technology)
  • SacI (Beyotime Biotechnology) digestion for validation.
Results:
  • DNA concentrations of GFP vector and pET-28a(+) were 17 ng/μl and 37 ng/μl respectively.
  • The electrophoresis was conducted under 100 V for 30 minutes in TAE buffer.

    • Fig. 1

    Fig. 1 DNA agarose gel results

    1: GFP plasmid (Extracted on 21st July 2025, target: 2,510 bp);2: Sac digestion of the GFP plasmid (Digested on 22nd July 2025, target: 2,510 bp); 3: pET-28a(+) plasmid (Extracted on 21st July 2025, target: 5,369 bp); 4: Sac digestion of the pET-28a(+) plasmid (Digested on 22nd July 2025, target: 5,369 bp); 5,6: CH1 PCR products (Amplified on 22nd July 2025, target: 732 bp); 7: non-template control for 5&6; 8: non-template control for 10; 9: non-template control for 11; 10: CH1 PCR products (Amplified on 17th July 2025, target: 732 bp); 11: 038 PCR product (Amplified on 17th July 2025, target: 1,956 bp); 12: 100-2000 bp DNA ladder.


Construction of A Recombinant pET-CH1 Plasmid

July 23 - August 3, 2025

 Aim:
  • To generate a linearized and modified pET-28a(+) vector for subsequent cloning applications.
  • To construct a recombinant pET-CH1 plasmid for protein expression and functional analysis.
  • Digestion, extraction, cloning and transformation enabled construction and propagation of the target recombinant vector.
Protocols:
  • Double enzyme digestion pET-28a(+) vector with EcoRI & HindIII (double digestion).
  • Cloning of the target fragment into linearized pET-28a(+) , screening by colony PCR, and the recombinant plasmid was extracted.
  • Purification of double-digested pET-28a(+) vector via gel extraction.
  • Transformation of the assembled pET-CH1 construct into BL21(DE3) super competent cells for propagation and expression.
Results:
  • pET-CH1 plasmid was successfully constructed.
    • Fig. 2

    Fig. 2 E. coli plaque results

    Fig. 3

    Fig. 3 Colony PCR resutls of pET-CH1.

  • Sanger sequencing results confirmed our construct was right.

Construction of A Recombinant pET-F4 Plasmid

August 15 - 18, 2025

 Aim:
  • To construct and isolate a recombinant plasmid for expression of anti-GFP dsRNA in E. coli.
Protocols:

  • Double restriction digestion of the F4 fragment and pET-28a(+) vector, followed by ligation with T4 DNA ligase
  • Transformation of the ligation product into E. coli DH5α super competent cells (Beyotime Biotechnology) for plasmid propagation
  • Plasmid DNA extraction from positive clones.
Results:

    Fig. 4

    Fig. 4 Double digested of F4 fragment

    1,2: The F4 fragment after double digestion; 3: 100-600 bp DNA ladder.

    Fig. 5

    Fig. 5 pET-F4 E. coli plaque results

    Fig. 6

    Fig. 6 Colony PCR resutls of pET-F4.

    1: 100-600 bp DNA ladder; 2,3,4: LJY 1~3; 5,6,7: MYX 1~3; 8,9: LXX 1~2; 10: WZQ; 11: HSB; 12: CK; 13: 100-2000 bp DNA ladder.

  • Sanger sequencing results indicated something wrong with our constructs. Only part of F4 fragment was inserted in to the vector, which may due to the secondary structure of the dsRNA.
    Fig. 7

    Fig. 7 F4 fragment sequencing result vs. design

    Here is the F4 fragment mountain plot representation of the MFE structure, the thermodynamic ensemble of RNA structures, and the centroid structure.


    Fig. 8

    Fig. 8 F4 fragment mountain plot

Induced Expression and Validation of pET-CH1 Plasmid

August 23 - 31, 2025

 Aim:
  • Induced expression of pET-CH1
Protocols:
  • Expression of pET-CH1 by IPTG (0.5 mM). (Beyotime Biotechnology)
  • Total protein extration by kit. (Beyotime Biotechnology)
  • Validation of CH1 Expression by SDS-PAGE and Coomassie Staining. (Beyotime Biotechnology)
Results:

We failed to determine which band corresponds to our target protein.

    Fig. 8

    Fig. 9 SDS-PAGE gel results of total protein samples with coomassie staining.

    1, 10: Denatured Protein Ladder (14.4-116kD); 2: Empty vector; 3: CH1-1 0 h; 4: CH1-3 0 h; 5: CH1-3 2 h; 6: CH1-3 4.5 h; 7,8: GFP plasmid; 9: CH1-1 4.5 h