1. Overview

Based on the engineered polyphosphate (polyP) metabolic network system developed by our team, we have established a novel microbial biosorption platform for rare earth elements (REEs) recovery, providing a complete experimental framework for future applications. We have meticulously documented the entire workflow—from strain construction and protein expression validation to adsorption capacity assessment—including standardized protocols for cultivating engineered Pseudomonas kunmingensis (P. kunmingensis) HL22-2^T under controlled conditions, inducing target protein expression, and performing REE adsorption assays. Furthermore, we systematically elucidated the growth characteristics of the engineered strains and the dynamics of intracellular and extracellular phosphate metabolism during REE biosorption. This work offers a scalable and sustainable strategy for the bioremediation and resource recovery of rare earth elements.

2. New Basic Parts

We registered and uploaded basic parts BBa_25WRSMIP, BBa_25CVSUA1, BBa_25TC4IDA.

We also uploaded basic parts BBa_259STERK as a backbone and proved it worked as we expected.

3. New Composite Parts

We have designed eight composite parts (BBa_2502RTST, BBa_253PFMUM, BBa_25J1CVVU, BBa_25WN4TIV, BBa_259D2DLA, BBa_2566HVYF) in order to overexpress the corresponding genes in cells.

4. Updated Parts

5. Contribution

Parts-name: BBa_K4604004

5.1. Design-Modified T7 RBS-P.KPPX

To enable expression of the codon-optimized ppx gene from Escherichia coli (BBa_25TC4IDA) in Pseudomonas kunmingensis, we utilized this modified T7 RBS (BBa_K4604004) from the iGEM Parts Registry and assembled it into a novel composite part (BBa_25J1CVVU).

The resulting sequence of this construct is as follows:

AAGGAGATATACATATGAGTCCACTGCGTAAAACCGTGCCGGAATTTCTG
GCACATCTGAAATCTCTGCCGATTAGTAAAATTGCTAGCAACGATGTTCT
GACCATTTGTGTTGGTAACGAAAGCGCAGATATGGATTCAATTGCAAGCG
CAATTACATATAGCTATTGTCAGTATATCTATAACGAAGGCACCTATTCA
GAAGAAAAGAAGAAGGGTAGCTTTATTGTTCCGATCATTGATATTCCGCG
CGAAGATCTGAGTCTGCGTCGTGATGTTATGTATGTTCTGGAAAAGCTGA
AAATTAAAGAAGAAGAACTGTTCTTCATCGAAGATCTGAAAAGCCTGAAA
CAGAACGTGAGCCAGGGTACAGAACTGAATAGCTATCTGGTGGATAACAA
TGATACACCGAAAAATCTGAAAAACTATATCGATAACGTTGTGGGCATTA
TTGATCATCATTTTGATCTACAAAAACATCTGGATGCAGAACCTCGCATT
GTTAAAGTTAGCGGCAGCTGTAGCAGCCTGGTGTTTAATTATTGGTATGA
AAAGCTACAAGGTGATCGCGAAGTTGTTATGAATATTGCACCGCTGCTGA
TGGGTGCAATTCTGATTGATACCAGCAATATGCGTCGTAAAGTTGAAGAA
AGCGATAAACTGGCCATTGAACGTTGTCAGGCAGTGCTGAGTGGTGCCGT
TAACGAAGTTTCCGCCCAGGGTCTGGAAGATAGCAGCGAATTTTATAAAG
AAATCAAAAGCCGTAAAAACGATATCAAAGGTTTTAGCGTAAGCGATATT
CTGAAGAAGGATTATAAACAGTTTAACTTTCAGGGTAAAGGTCATAAAGG
TCTGGAAATTGGTCTGAGCAGCATCGTGAAACGTATGAGTTGGCTGTTTA
ATGAACATGGTGGTGAAGCAGATTTTGTTAATCAGTGTCGTCGTTTTCAG
GCAGAACGTGGTCTGGATGTTCTGGTTCTGCTGACCTCATGGCGTAAAGC
AGGTGATAGTCATCGTGAACTGGTCATTCTGGGTGATAGCAATGTGGTTC
GTGAACTGATTGAACGTGTAAGCGATAAACTACAACTACAACTGTTTGGT
GGCAATCTGGATGGTGGTGTTGCGATGTTTAAACAGCTGAATGTTGAAGC
GACACGTAAACAGGTTGTTCCGTATCTGGAAGAAGCATATAGCAATCTGG
AAGAATAA

References:

[1] J. Alvarado, A. Ghosh, T. Janovitz, A. Jauregui, M. S. Hasson, D. A. Sanders, Origin of exopolyphosphatase processivity: Fusion of an ASKHA phosphotransferase and a cyclic nucleotide phosphodiesterase homolog. Structure 14, 1263–1272 (2006).

[2] E. S. Rangarajan, G. Nadeau, Y. G. Li, J. Wagner, M. N. Hung, J. D. Schrag, M. Cygler, A. Matte, The structure of the exopolyphosphatase (PPX) from Escherichia coli O157:H7 suggests a binding mode for long polyphosphate chains. Journal of Molecular Biology 359, 1249–1260 (2006).

[3] I. Pardo, R. K. Jha, R. E. Bermel, F. Bratti, M. Gaddis, E. McIntyre, W. Michener, E. L. Neidle, T. Dale, G. T. Beckham, C. W. Johnson, Gene amplification, laboratory evolution, and biosensor screening reveal MucK as a terephthalic acid transporter in Acinetobacter baylyi ADP1. Metabolic Engineering 62, 260–274 (2020).

5.2. Experiment-Modified T7 RBS-P.KPPX

Amplification of the Target Gene Fragment

The target gene fragment was amplified via polymerase chain reaction (PCR). A 50 µL reaction was prepared containing 800 ng of template DNA, 2.5 µL each of forward and reverse primers (100 µM), 25 µL of 2× Proofast Master Mix (Dye), and sterilized distilled water to volume. The reaction was carried out using a programmed thermal cycler. Successful amplification was confirmed by electrophoresis, showing a product of the expected size.

5.3. Characterisation-Modified T7 RBS-P.KPPX

Through primer design, the codon-optimized gene encoding PPX from Escherichia coli was fused with a modified T7 RBS (BBa_K4604004) obtained from the iGEM database. The corresponding fusion fragment was amplified via polymerase chain reaction (PCR). Agarose gel electrophoresis confirmed the presence of an amplification product approximately 1200 bp in size, matching the expected length based on the designed coding sequence.

Figure 1. Agarose gel electrophoresis verification

5.4. Application-Modified T7 RBS-P.KPPX

This composite part Modified T7 RBS-P.KPPX (BBa_25J1CVVU) is then designed for assembly into the linearized pCM28 plasmid device (BBa_259STERK) to enable heterologous expression of PPX in Pseudomonas species. The expressed exopolyphosphatase catalyzes the complete hydrolysis of inorganic polyphosphate (PolyP) into inorganic phosphate (Pi), facilitating efficient phosphate recycling in engineered bacterial systems.

The plasmid map is:

Figure 2. Plasmid design

After constructing the recombinant plasmid pCM28-modified T7 RBS-P.KPPX, it was transformed into Pseudomonas kunmingensis to generate the engineered strain KPPX. Protein expression was subsequently analyzed by SDS-PAGE, and Coomassie Blue staining confirmed the presence of the target protein at the expected molecular weight of approximately 45 kDa.

Figure 3. SDS-PAGE analysis of recombinant protein

The successful construction of the engineered strain KPPX enables its potential use in the biosorption of rare earth elements (REEs). The adsorption capacity was evaluated using inductively coupled plasma mass spectrometry (ICP-MS). Notably, the results indicated that KPPX showed significantly decreased biosorption of La, Pr, and Nd compared to the wild-type strain.

Figure 4. ICP-MS analysis of REE adsorption by engineered P. kunmingensis
(RE ion CONC. (ng/g): The mass of adsorbed rare earth ions per gram of wet biomass)

5.5 Discussion-Modified T7 RBS-P.KPPX

Through primer-assisted fusion, the codon-optimized ppx gene from Escherichia coli (BBa_25TC4IDA) was combined with a modified T7 RBS (BBa_K4604004) from the iGEM database. A product of approximately 1200 bp was successfully amplified using polymerase chain reaction (PCR). The observed fragment size matched the expected length, confirming successful amplification and yielding the correct genetic construct for subsequent plasmid assembly.

SDS-PAGE analysis confirmed the successful expression of the PPX protein in Pseudomonas kunmingensis, demonstrating the effective construction of the engineered strain KPPX. In contrast to the wild-type strain, the engineered strain KPPX exhibited a significant reduction in adsorption capacity for rare earth elements (REEs). We hypothesize that this decrease resulted primarily from the expression of the PPX enzyme, which catalyzed the premature hydrolysis of intracellular polyphosphate (polyP) reserves before the adsorption assay. Consequently, only limited phosphate was released extracellularly during the actual adsorption process, reducing the availability of free phosphate for complexation with REE ions.

This outcome contrasts sharply with the enhanced adsorption performance achieved using a PPK1-based engineering strategy in strain KPPK1, where polyP accumulation significantly improved REE binding. Together, these findings emphasize the crucial importance of temporal and metabolic control in the design of microbial biosorption systems. They also reinforce that engineering strategies which promote polyP accumulation—such as PPK1 overexpression—are more effective for enhancing REE recovery performance.

6. Additional Requirements for a Silver Medal

S1. Engineering Success

Demonstrate engineering success in a part of your project by going through at least one iteration of the engineering design cycle.

(optional) If your team created a new Part for this criterion, enter its name below. Clearly document the contribution by appending a Part Documentation on the Registry.

Part Name: BBa_25WN4TIV

7. Additional Requirements for a Gold Medal

Impress the judges with your work towards three special prizes of your choice. You do not have to win any Special Prize awards to meet the Gold Medal criteria, but you do have to impress the judges in your efforts towards each Special Prize you select. Teams may select and compete for fewer than three special prizes, but they will not qualify for a Gold Medal.

G1. Best new basic part: BBa_259STERK

G2. Best new composite part: BBa_2502RTST