Experiments

I. Ligation, Transformation, and Verification of the Degradation Cassette
Ligation of NahABFEDG with nahC and phnC:

Principle:

  The A-G genes of the Nah cluster are responsible for converting naphthalene to catechol (Figure 2A-II) and can theoretically also convert phenanthrene. If phenanthrene undergoes this conversion, the product is 1,2-dihydroxynaphthalene, which is an intermediate in naphthalene degradation (Figure 1A-III) and can enter the naphthalene degradation pathway. Precisely because of this, organisms possessing the nah cluster also have a limited ability to degrade phenanthrene. The reason for this weak activity is likely that nahC has a significantly lower affinity for 1,2-dihydroxyphenanthrene (Figure 1B-III) than for the naphthalene-derived intermediate (Figure 1A-III). In contrast, the phnC gene from the phn cluster can act on 1,2-dihydroxyphenanthrene (B-III), but its downstream pathway (Figure 2B1) differs from the naphthalene degradation pathway of the nah cluster and is specific for phenanthrene degradation.

Conclusion:

  Introducing phnC into cells containing nahA-G will likely enable them to convert both phenanthrene and naphthalene to catechol.

  Figures:

  Figure 1A to Figure 2A: Degradation of naphthalene by the nah cluster.

  Figure 1B to Figure 2B: Degradation of phenanthrene by the phn cluster.

Experimental Plan:

  Parallel experiments are designed comparing the modified nah cluster (introducing phnC) and the native nah cluster (using nahC). Three fragments were ordered: nahA-G (with nahC excised), nahC, and phnC, all supplied in the pET30a+ vector. Using the NdeI & EcoRI sites located after nahA-G in the vector, nahC and phnC will be ligated separately into the backbone, requiring only a single ligation step for each. This will yield the recombinant plasmids pET30a+-nahABFEDG-nahC and pET30a+-nahABFEDG-phnC. These will then be transformed separately, protein expression checked, and degradation capability tested.

Procedure:

  1. Culture bacteria containing pET-30a(+)-nahC, pET-30a(+)-phnC, and pET30a+-nahABFEDG in preparation for plasmid extraction.

  2. Amplify nahC and phnC fragments via colony PCR from revived cultures of pET-30a(+)-nahC and pET-30a(+)-phnC, respectively. Use a 50μL PCR system with ordered primers. These primers have the required restriction enzyme site sequences incorporated internally, flanked by 5' protective bases. Run 5μL of the PCR product on a gel to verify nucleic acid size, followed by PCR product purification.

  NahC: 906bp, Annealing Temp: 54°C
  phnC: 825bp, Annealing Temp: 59°C

  Ordered Primer Sequences

  nahC-EcoRI-F: ATATGAATTCGCCTGACTCAGTTTTACATC
  nahC-R: ATATGCTAGCGAATCAGGAGGAAACTAT
  phnC-EcoRI-F: ATATGAATTCGGACCCGCCACCTTCATTTC
  phnC-R: ATATGCTAGCGAGAGAGGAGGACAAGAT

  3. After culturing pET30a+-nahABFEDG bacteria for 16 hours, extract the plasmid. Use DL5000 marker as reference, and run the gel using 0.8% agarose, with gel preparation ratio according to protocol. The full length of the pET30a+-nahABFEDG plasmid is 14.3 kbp.

  4. Perform double digestion on pET30a+-nahABFEDG, nahC PCR product, and phnC PCR product using EcoRI & NheI. Use the system specified in the protocol, with a digestion duration of 4 hours. After digestion of pET30a+-nahABFEDG, perform gel extraction (or adjust centrifugation speed during product purification) to remove the small fragment between the two restriction sites on the plasmid, preventing self-ligation. This is necessary because the size of the final ligation product is close to that of the original pET30a+-nahABFEDG, making them difficult to distinguish even by gel electrophoresis. Ligate to obtain the two recombinant plasmids: pET30a+-nahABFEDG-nahC and pET30a+-nahABFEDG-phnC.

  5. Transform into E. coli DH5α. Use the recombinant plasmid transformation procedure as per the protocol. After transformation, plate 20μl/200μl onto LA (Kan+) plates. Incubate at 37°C in a constant temperature incubator for 16 hours. Select successfully transformed colonies (those able to grow on LA (Kan+) plates) and send for sequencing. Use T7 and T7 terminator primers for sequencing.

  6. Compare sequencing results with the designed sequences and check using NCBI's BLAST function. After confirming successful transformation, extract the plasmids and transform them into the final chassis – the expression strain BL21(DE3). Our degradation cassette at this stage relies on the T7 promoter of pET30a(+) for activation. The T7 promoter of the pET series does not function in DH5α due to the lack of T7 RNA polymerase. After transformation, plate 20μl/200μl onto LA (Kan+) plates. Incubate at 37°C in a constant temperature incubator for 16 hours. Select successfully transformed colonies. Detect three tags via Western Blot: FLAG tag on NahAc, HA tag on NahE, and 6*His tag on NahC/phnC.

Functional Verification of the Degradation Cassette:

  An experiment is designed to compare the residual phenanthrene content after engineered bacteria are cultured in PHE-containing medium for specific time intervals.

  (1) PHE Standard Curve: Prepare a stock solution of 1mg PHE / ml DMSO.
  PHE Final Concentration (μg/ml): 2, 4, 6, 8, 10
  Stock Solution Added (μl/ml medium): 2, 4, 6, 8, 10
  Use a microplate reader to characterize the phenanthrene concentration in the solution. Program: Absorbance Monochromator - 251nm, because PHE has an absorption peak at 251nm. Establish the correlation between the microplate reader reading and the PHE final concentration.

  (2) IPTG Concentration Gradient: Prepare a 1M IPTG aqueous solution.   IPTG Final Concentration (mM): 0, 1, 2   Stock Solution Added (μl/ml medium): 0, 1, 2

  (3) Control: Use DMSO instead of the PHE DMSO solution to assess the effect of DMSO on absorbance.

  (4) Control: Use BL21(DE3) without the target genes instead of the engineered bacteria, to verify that the degradation capability is conferred by the target genes and not by other IPTG-induced pathways.

II. Ligation, Transformation, and Verification of PhnSR

Principle:

  PhnSR is the component within the phn operon that senses PHE. PhnR encodes a repressor protein that normally interacts with a sequence upstream of the phnS promoter, inhibiting the expression of downstream genes. When PhnR binds salicylic acid, an intermediate of PHE degradation, this repression is lifted. We designed a system where EGFP expression is controlled by phnSR to verify whether phnSR can function in E. coli.

Procedure:

  1. Culture bacteria containing pET-30a(+)-phnSR in preparation for plasmid extraction. After culturing pET-30a(+)-phnSR for 16 hours, extract the plasmid. Use DL5000 marker as reference, and run the gel using 0.8% agarose, with gel preparation ratio according to protocol. The full length of the plasmid is 8.9 kbp.

  2. PCR amplify the EGFP gene from the lab-stocked plasmid pEGFP-6X Myc-EGFP. Run the PCR product on a gel. EGFP: 714bp, Annealing Temp: 53°C.

  Ordered Primers:

  EGFP-F-AvrII: ATATCCTAGGATGGTGAGCAAGGGCGAG
  EGFP-R-HindIII: ATATAAGCTTTCACTTGTACAGCTCGTC

  3. Digest both the EGFP PCR product and pET-30a(+)-phnSR separately with AvrII & HindIII. Use the system specified in the protocol, with a digestion duration of 4 hours. Ligate to obtain pET-30a(+)-phnSR-EGFP.

  4. Transform into E. coli DH5α. Use the recombinant plasmid transformation procedure as per the protocol. After transformation, plate 20μl/200μl onto LA (Kan+) plates. Incubate at 37°C in a constant temperature incubator for 16 hours. Select successfully transformed colonies (those able to grow on LA (Kan+) plates) and send for sequencing. Use T7 and T7 terminator primers for sequencing.

Functional Verification of the Sensing Cassette:

  (1) Use the microplate reader's Fluorescence - 507nm setting to characterize the fluorescence intensity resulting from EGFP expression. Measure hourly for three hours under inducing conditions during continuous culture.

  (2) SA Concentration Gradient: Prepare a 1M SA stock solution.
  SA Final Concentration (mM): 0, 0.1, 0.5, 1, 5

  Stock Solution Added (μl per ml of culture? Note: text says *10^-1μl/ml, might need verification): 0, 1, 5, 10, 50

Based on the time gradient and inducer concentration gradient, the most direct indicator in this experiment is whether the fluorescence intensity increases with higher inducer dose and longer time.

III. Ligation, Transformation, and Preliminary Verification of rhlAB

Principle:

  Pseudomonas bacteria secrete a biosurfactant, rhamnolipids, to desorb weakly polar organic compounds from soil particles and facilitate their entry into the cell membrane. We will transfer pET28a(+) containing inserted rhlAB into E. coli to enable it to produce rhamnolipids, thereby enhancing the adsorption of PHE by the engineered bacteria. (A figure can be added here.)

Procedure:

  1. pET28a(+) is available in the lab. Pre-culture DH5α containing pET28a(+). Incubate at 37°C, 220 rpm for 16 hours, then extract the plasmid.
  2. Amplify rhlAB via PCR from a lab-prepared lysate of Pseudomonas aeruginosa. Note: Pseudomonas aeruginosa is not on the white list; directly handling live cells may pose a safety risk to the project, hence we use the lysate. Run the PCR product on a gel and purify. RhlAB: 2234bp, Annealing Temp: [Value missing from original text].

  Ordered Primers:

  rhlAB-R-SalI: ATATGTCGACGGACGCAGCCTTCAG
  rhlAB-F-NdeI: ATATCATATGCGGCGCGAAAGTCTG

  3. Perform double digestion separately on the pET28a(+) plasmid and the rhlAB PCR product using NdeI & SalI. Use the system specified in the protocol, with a digestion duration of 4 hours. Ligate to obtain pET-28a(+)-rhlAB.

  4. Transform into E. coli DH5α. Use the recombinant plasmid transformation procedure as per the protocol. After transformation, plate 20μl/200μl onto LA (Kan+) plates. Incubate at 37°C in a constant temperature incubator for 16 hours. Select successfully transformed colonies (those able to grow on LA (Kan+) plates) and send for sequencing. Use primers rhlAB-R-SalI and rhlAB-F-NdeI for sequencing.

Functional Detection:

  This experiment utilizes CTAB-Methylene Blue plates for detection. The cationic surfactant CTAB (cetyltrimethylammonium bromide) combined with the indicator methylene blue gives a highly specific reaction for rhamnolipid production. When engineered bacteria secrete rhamnolipids (an anionic surfactant), a clear zone or dark blue halo will form around the colonies. This occurs because rhamnolipids form an insoluble blue complex with CTAB-methylene blue, causing precipitation and resulting in a clear hydrolysis zone against the dark blue background. Streak the engineered bacteria to be tested, along with a negative control E. coli (non-rhamnolipid producing), onto the plates. Incubate inverted at 37°C for 16 hours. Colonies of engineered bacteria capable of secreting rhamnolipids will be surrounded by an opaque dark blue halo or a clear hydrolysis zone.