Results

I. Degradation Module

1. Cloning

  We constructed two plasmids, pET30a(+)-nahABFEDG-phnC and pET30a(+)-nahABFEDG-nahC, and transformed them into E. coli DH5α. After transformation, the cells were plated on LB (Kan+) agar plates. Since pET30a(+) carries a Kanamycin resistance (Kanr) gene, successfully transformed engineered bacteria should form colonies. The results after 16 hours of plate culture are shown below.

  Colonies presumed to contain the plasmid were picked and inoculated into LB (Kan+) broth for expansion culture. PCR results after 8 hours are shown below . The primers used were:

  nahC-EcoRI-F: ATATGAATTCGCCTGACTCAGTTTTACATC

  nahC-R: ATATGCTAGCGAATCAGGAGGAAACTAT

  phnC-EcoRI-F: ATATGAATTCGGACCCGCCACCTTCATTTC

  phnC-R: ATATGCTAGCGAGAGAGGAGGACAAGAT

  It can be observed that colonies 1, 2, and 3 from the pET30a(+)-nahABFEDG-nahC transformation and colonies 1 and 2 from the pET30a(+)-nahABFEDG-phnC transformation showed positive bands, suggesting the presence of the target coding sequence. To conclusively confirm successful transformation, the plasmids were sent for sequencing. The sequencing primers used were T7 and T7ter. The sequencing results were aligned with the target gene sequence obtained from NCBI. The results indicated that the engineered bacteria containing pET30a(+)-nahABFEDG-phnC were successfully transformed, while the nah series did not yield conclusive results.

  We extracted the plasmid from the transformed DH5α cells and performed another transformation into the expression host strain BL21(DE3). The cells were plated on LB (Kan+) plates, and colonies were picked, resulting in the chassis BL21(DE3) strain containing pET30a(+)-nahABFEDG-phnC.

2. Validation

  We established a fluorescence standard curve for PHE at an emission wavelength of 345 nm to facilitate the evaluation of the engineered bacteria's ability to degrade PHE. The 345 nm wavelength corresponds to one of the characteristic emission peaks of PHE.

  A 1 mM stock solution of PHE was prepared using DMSO as the solvent. Aliquots of 1, 5, 10, 20, and 50 μL of this stock solution were added to LB medium to achieve final PHE concentrations of 1, 5, 10, 20, and 50 μg/mL in the systems, respectively. LB medium was used as a control. All samples were diluted tenfold before being added to a 96-well plate (without dilution, our standard curves consistently showed very flat responses). The standard curve obtained using the microplate reader at an emission wavelength of 365 nm is presented below.

  After applying linear fitting, we found the R² value to be relatively low. We recognized that while fluorescence intensity is directly proportional to the concentration of the sample solution at low concentrations, it may deviate from linearity at higher concentrations due to factors such as the quenching effect. Subsequently, we employed quadratic fitting, which yielded satisfactory results.

  Using this standard curve, we proceeded with the PHE degradation experiment involving the engineered bacteria containing pET30a(+)-nahABFEDG-phnC.

  We prepared a 1 M IPTG stock solution using water as the solvent. We designed three experimental systems along with their respective blank controls:

  Group 1: No bacterial inoculation.

  Group 2: Inoculated with DH5α lacking any foreign plasmid.

  Group 3: Inoculated with an equal volume of the engineered bacteria containing pET30a(+)-nahABFEDG-phnC.

  After 8 hours of culture, we added 1 µL of the IPTG stock solution to each system. Then, 50 µL of the PHE stock solution in DMSO was added to the sample groups, while the blank groups received no PHE. Samples of 100 µL were taken at 0.5, 1.0, and 1.5 hours, and their fluorescence at an emission wavelength of 345 nm was measured using a microplate reader. The results, calculated by referencing the standard curve, are shown in the accompanying figure.

  

  The results from the graph indicate that in the system without any bacterial inoculation, the PHE concentration remained largely stable during the first 0.5 hours, followed by a slight decrease after 1 hour. This reduction is likely attributed to precipitation due to the relatively high concentration.

  In systems inoculated with either DH5α or the engineered bacteria, PHE concentration decreased within the first 0.5 hours, with the rate of decline slowing after 1 hour. The PHE concentration in the system with the engineered bacteria was significantly lower than that in the system with plasmid-free DH5α, indicating preliminary degradation capability of the engineered bacteria toward PHE.

  The faster decrease in PHE concentration in the control group inoculated with DH5α compared to the mock group (no bacteria) may be due to bacterial absorption of PHE.

  The results in the graph indicate that in the system without any bacterial inoculation, the PHE concentration remained essentially unchanged within the first 0.5 hours, but showed a slight decrease after 1 hour, which is presumed to be due to precipitation caused by the relatively high concentration.

  In systems inoculated with either DH5α or the engineered bacteria, a decrease in PHE concentration was observed within the first 0.5 hours, followed by a slowdown in the rate of decrease after 1 hour. The PHE concentration in the system inoculated with the engineered bacteria was significantly lower than that in the system with DH5α (without the plasmid), indicating that the engineered bacteria preliminarily demonstrated the ability to degrade PHE.

  The faster decrease in PHE concentration in the control group inoculated with DH5α compared to the mock group (no bacteria) is possibly because the bacteria themselves absorbed PHE.

II. Sensing Module

1. Cloning

  We constructed the plasmid pET30a(+)-phnR-P-phnS-EGFP and transformed it into E. coli DH5α. After transformation, the cells were plated on LB (Kan+) agar plates. The results after 16 hours of plate culture are shown below.

  Colonies presumed to contain the plasmid were picked and inoculated into LB (Kan+) broth for expansion culture. PCR results after 8 hours are shown below . The primers used were:

  EGFP-F-AvrII: ATATCCTAGGATGGTGAGCAAGGGCGAG

  EGFP-R-HindIII: ATATAAGCTTTCACTTGTACAGCTCGTC

  Due to researcher error, the agarose gel was not completely dissolved during preparation for this electrophoresis, causing band smearing. Nevertheless, it can be inferred that the first and second samples contain the target sequence. To conclusively confirm successful transformation, the plasmids were sent for sequencing. The sequencing primers used were EGFP-F-AvrII and EGFP-R-HindIII. The sequencing results were aligned with the target gene sequence obtained from NCBI.

  The results confirmed the successful transformation of the engineered bacteria containing pET30a(+)-phnR-P-phnS-EGFP. The plasmid was extracted and then transformed into BL21(DE3). The cells were plated on LB (Kan+) plates, and colonies were picked, resulting in the chassis BL21(DE3) strain containing pET30a(+)-phnR-P-phnS-EGFP.

2. Validation

  According to our design, adding SA (salicylic acid), an intermediate metabolite of PHE, to the solution should activate the sensing module phnSR, leading to the expression of the downstream EGFP gene. The fluorescence emitted by EGFP was detected using a microplate reader.

  We prepared a 1 M stock solution of SA in anhydrous ethanol and established a concentration gradient to test the sensitivity of phnSR. Eight-hour cultures of the engineered bacteria were divided into six tubes and treated as follows:

  Control: Added 50 µL of anhydrous ethanol to account for any potential effects of the solvent itself.
  Blank: No addition of anhydrous ethanol or SA.
  Group 1: Added 1 µL of 10⁻¹ M SA stock solution.
  Group 2: Added 5 µL of 10⁻¹ M SA stock solution.
  Group 3: Added 10 µL of 10⁻¹ M SA stock solution.
  Group 4: Added 50 µL of 10⁻¹ M SA stock solution.

  Samples were taken at the 1-hour, 2-hour, and 3-hour time points. The OD₆₀₀ was measured using the microplate reader, and fluorescence was observed under 300 nm illumination using a gel imager. Based on the results, it appears that EGFP was not expressed in any of the groups. Although the microplate reader detected fluorescence in the experimental groups, this fluorescence did not change over time. Furthermore, the control and blank groups also exhibited varying levels of fluorescence. Critically, in the experimental groups, the fluorescence intensity remained constant over time, whereas it should have increased if expression was occurring.

  Currently, we hypothesize that although the transformation was successful, the phnS component may not function correctly in E. coli, or phnR cannot be activated by SA under the current conditions. This part might require changing the chassis organism.