Contribution

Entrepreneurship Mascot

Our Contributions

During our project, we explored previous iGEM teams working on toehold switches to take inspiration from. It helped us understand how toehold switches work and their design, provided references for literature papers to look at , how to characterise our toeholds and lastly what needs to be improved on within the field. We collated some of the best iGEM teams for toehold switches to give future iGEM teams a starting point on how other toehold teams out there have won gold medals, including a list of their toehold parts.

Best Toehold Teams Admin Guidelines Case Study Guidelines Interview Guidelines

Best iGEM Teams for Toehold Switches

Team Toehold Parts Part Description + Characterisation Achievement References
WageningenUR (2024) Overgraduate Team Project Description: Their project was making an accessible diagnostic test for multiple sclerosis (MS) by using toehold switches and Logic AND gates together to detect miRNAs dysregulated in the disease. Key things this team did well include building threshold systems using models so that dysregulated miRNA can be detected. They include AND logic gates to detect three miRNAs together (a multiplex system for specificity). They tested their parts through modelling and wet lab experiments - which were proven to be functional. They made improvement on SwitchMi Designer to better design toehold switches that anneal to miRNAs. They had a thorough plan of implementation that met their goals of making an accessible test.
BBa_K5106001 A basic part known as MS toehold switch A which detects hsa-miR-484. The part was designed using miRADAR software and analysed using NUPACK which showed the miRNA fully binding correctly to the toehold. Won: Top 10, Overgrad, Best Diagnostics Project, Gold Medal. Nominations: Best Model, Best part collection, Best presentation, Best wiki (1), (2), (3), (4), (5), (6), (7)
BBa_K5106004 A composite part of MS toehold switch A (BBa_K5106001) under the control of a T7 promoter and terminator, and LacZ reporter gene. It was used to test the toehold functionality in vitro in a cell-free PURExpress system. Qualitative data showed the toehold switch to work after 2 hours as Red-β-D-Galactopyranoside is converted to chlorophenol red by β-galactosidase. A yellow to purple colour change was observed. Quantitative data included measuring the absorption at 570 nm and 415nm to measure the product and substrate respectively. Results showed absorption at 570 nm slightly increases over time, and that it is slightly higher for the samples to which the trigger was added. The absorption at 415 nm goes slightly down. There was leakiness observed.
BBa_K5106002 A basic part known as MS toehold switch B which detects hsa-miR-484. The part was designed using miRADAR software and analysed using NUPACK which showed the miRNA fully binding correctly to the toehold.
BBa_K5106005 A composite part of MS toehold switch B (BBa_K5106002) under the control of a T7 promoter and terminator, and LacZ reporter gene. It was used to test the toehold functionality in vitro in a cell-free PURExpress system. Qualitative data showed the toehold switch to work after 2 hours as Red-β-D-Galactopyranoside is converted to chlorophenol red by β-galactosidase. A yellow to purple colour change was observed. Quantitative data included measuring the absorption at 570 nm and 415nm to measure the product and substrate respectively. Results showed absorption at 570 nm increases over time, and the absorption at 415 nm decreases over time. There is also a significant difference in results when testing toehold switches in the presence or absence of the trigger RNA.
BBa_K5106003 A basic part known as MS toehold switch C which detects hsa-miR-484. The part was designed using miRADAR software and analysed using NUPACK which showed the miRNA fully binding correctly to the toehold.
BBa_K5106006 A composite part of MS toehold switch C (BBa_K5106003) under the control of a T7 promoter and terminator, and LacZ reporter gene. It was used to test the toehold functionality in vitro in a cell-free PURExpress system. Qualitative data showed the toehold switch to not work after 2 hours as Red-β-D-Galactopyranoside was not converted to chlorophenol red by β-galactosidase. Thus the colour remained yellow. Quantitative data included measuring the absorption at 570 nm and 415nm to measure the product and substrate respectively. For both measurements, no change in absorbance over time was observed, and no difference between the presence or absence of trigger RNA was observed either. This indicates that this toehold switch is non-functional.
Stanford (2020) Undergraduates Project Description: They developed a synthetic system called SEED - Self-replicating Embedded Environmental Diagnostic. The team engineered a cell-based nucleic-acid diagnostic in B. subtilis. It takes up nucleic acids from the environment and one of their two detection routes was an RNA toehold switch that turns on a reporter when a cognate trigger RNA is present. Key things the team did well include taking a simple concept like toehold switch and applying its application within live cells, still with the purpose of being a diagnostic. Thus, their idea was very unique for an iGEM project. Their device includes a signal amplification pathway Signal B. subtilis Quorum Sensing Molecule comX. They improved on Toehold Designer software
BBa_K3697011 This DNA codes for a toehold switch to be produced in B. subtilis This sequence contains a toehold that targets a portion of the Bacillus subtilis KanR gene, GUCCUUUGCUCGGAAGAGUAUGAAGAUGAACAAAGC. The sequence begins with the reverse complement of the target, a strong subtilis RBS, 11 basepairs of the target, and a linker. The toehold and reporter in this use case were under pVeg expression (BBa_K143012), the strongest known constitutive promoter in B. subtilis. After the reporter is a strong bacterial terminator, as B. subtilis produces extremely stable mRNAs. Won: Gold medal. Nominations: Best Diagnostics Project, Best Education (8), (9)
Exeter, UK (2015) Undergraduate Project Description: Developed a toehold-switch biosensor for M. bovis (bovine TB) detection Key things the team did well was go into detail of the design of their toehold switch through using NUPACK. They also characterised their toeholds in the lab and characterised different chromoproteins that they would use as the reporter gene amajLime, aeBlue, and eforRed. They had a design strategy for when it comes to implementing their product.
BBa_K1586000 Toehold switch under the control of a standard BBa_J23100 constitutive promoter - making this a composite part. In order to characterise that this part works as expected, fluorescence intensity was measured in a cell free system in the presence of different amounts of trigger RNA, whilst the toehold concentration remained constant. Note that there was only a single repeat due to shortage of time and cost of the cell free system. Expression with randomised triggers was also measured and found to be significantly less, showing specificity. Won: Gold Medal (10), (11), (12), (13), (14)
BBa_K1586001 Toehold switch under T7 promoter and T7 terminator to make it a composite part. (GreenFET1T7) Toehold Switch from Alexander Green which was used as a template to design their own toehold switch. This part is a positive control.
BBa_K1586002 EsxB toehold switch under a J23100 promoter and has the reporter gene GFP. Used as a negative control to ZeusJ as it has a premature STOP codon. (ZeusJSTOP).
BBa_K1586003 Functional EsxB toehold under J23100 promoter and has the reporter gene GFP. The switch is designed to detect and become activated by EsxB mRNA - specific to M.Bovis. This is their own designed toehold switch.(ZeusJ) They determined the equilibrium concentrations of their three systems (unbound toehold, unbound trigger and them both bound to one another).
Thessaly, Greece (2019) Undergraduates Team Project Description: They developed a test called ODYSSEE – a modular platform for instant/field-diagnosis of Tuberculosis (TB), using toehold switches as the detection method. Their motivation was to help refugees in Greece as they are vulnerable to TB. Key things they did well is thought about their biomarker and sample. They detected a cell-free DNA fragment of mTB found in urine samples of those with active tuberculosis - which is specific and easy to collect and they also isothermally amplified their biomarker so they thought about their test's implementation. They made a universal toehold switch, which aimed to be applicable for many diseases with DNA-based biomarkers making it very useful. They tested in-vivo and in-vitro and compared the two.
BBa_K2973006 32B Toehold Switch Enhanced Green Fluorescent Protein (eGFP). This is the toehold switch the team used as a template to compare if their toehold switch worked the same way (positive control). Used PURExpress® In Vitro Protein Synthesis kit. Tested the toehold switch against different variations of trigger concentration + no trigger as a negative control. To measure eGFP, an excitation step at 488nm (before visualizing at 515nm, where the protein's emission wavelength is) was required. The toehold-switch had a positive correlation, but they found that there was a strong background signal and the signal remained the same even with a 10-fold decrease in trigger concentration. Won: Gold Medal, Best Diagnostics. Nomination: Best integrated human practices, Best supporting entrepreneurship (14), (15), (16), (17), (18)
BBa_K2973007 32B Toehold Switch_β-lactamase_no signal peptide. This is the toehold switch the team used as a template to compare if their toehold switch worked the same way. The reporter gene used is β-lactamase. For in-vivo protein synthesis, they co-transformed two plasmids, one with the toehold composite part and the other with the trigger composite part. They measured enzymatic activity of β-lactamase acting on nitrocefin substrate and measured the absorption at 490nm (for nitrocefin hydrolysis) and 600nm (for cell growth) in a microplate reader.
BBa_K2973011 Toehold 13 β_Lactamase Geobacillus kaustophilus. It's a composite part under a T7 promoter and terminator. A toehold switch based on sequences from Geobacillus kaustophilus controlling β-lactamase expression. It serves as a universal sensor in their project, detecting specific RNA triggers and activating antibiotic resistance. This toehold was designed to detect the short 16S rRNA sequence GAAACCGGAGCTAATACCGGATAACACCGAAGACCG of Geobacillus kaustophilus. They performed a series of in-vitro protein synthesis reactions using the PURExpress® In Vitro Protein Synthesis kit. The expression of β-lactamase under the regulation of Toehold 13 was noticeably low in the absence of a trigger sequence, while the 100nM trigger reaction easily reached levels of signal comparable to the positive control.
BBa_K2973012 Toehold 14 β_Lactamase Dictyoglomus turgidum. Another toehold switch similar to BBa_K2973011 but derived from Dictyoglomus turgidum and designed to detect the short 16S rRNA sequence GAGCGAGATGCTCAGGTAAGGAAAGGGTATAGAGGG of Dictyoglomus turgidum. Controls β-lactamase expression in response to specific trigger RNAs, offering modular sensing capabilities. They performed a series of in-vitro protein synthesis reactions using the PURExpress® In Vitro Protein Synthesis kit. They found it to be similar to their positive control. However, when no trigger sequence is added, the signal is not significantly different from the 100nM trigger condition. Therefore, the toehold works but does not work well as there is high leakage.
ULAVAL, Canada (2019) Overgraduate Team Project Description: The project was called A.D.N (airborne detector for nucleic acids) and utilized microfluidics to extract DNA and then used toehold switches for detection. Key achievements and aspects of their project include: Creation of a software called "Toeholder" to aid in designing toehold switches, which is beneficial for future iGEM teams. Demonstration of their comprehensive product design works, emphasizing in-depth planning crucial for implementation. The project's adaptability to detect multiple airborne diseases, not just one. Characterization of part "BBa_K3026001" using multiple controls, demonstrating the toehold switch's efficient function in a stress environment. This led to their nomination for "Best Basic Part". They aimed to prove their part's functionality in environmental conditions similar to the intended test environment. They performed a total mRNA extraction from an overnight culture to create a minority mRNA signal. The plasmid containing the part was placed in a myTXTL cell-free expression system from ArborBiosciences, along with a constant amount of total mRNA. To replicate the detection apparatus, they conducted four biological replicates (BR) with three technical replicates each, totaling 12 replicates. For each biological replicate, a reaction without mRNA was performed to confirm the absence of signal leakage. A control with only myTXTL and mRNA was included for each biological replicate to confirm that the signal was not from autofluorescent proteins. Fluorescence was detected in samples containing both the ToeHold switch and mRNA from ampicillin-resistant E. coli. All negative controls showed no fluorescence, confirming efficient part function. However, significant variation was observed between biological and technical replicates, suggesting the need to incorporate multiple detection chambers and process as much initial sample as possible.
BBa_K3026000 Reporter Toehold_DNA_AmpR. A ToeHold switch targeting the DNA sequence of the pBluescript ampicillin resistance cassette. It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression. Won: Gold Medal, Best New application. Nomination: Best Basic Part (19), (20), (21), (22), (23), (24), (25), (26), (27), (28), (29), (30), (31)
BBa_K3026001 Reporter Toehold_DNA_AmpR. A ToeHold switch targeting the mRNA sequence of the pBluescript ampicillin resistance cassette. It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression.
BBa_K3026002 Reporter Toehold_DNA_FtsK. A ToeHold switch targeting the DNA sequence of the E. coli ftsk gene. It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression.
BBa_K3026003 Reporter Toehold_DNA_FtsK. A ToeHold switch targeting the DNA sequence of the E. coli ftsk gene. It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression.
BBa_K3026004 Reporter Toehold_DNA_SecA. A ToeHold switch targeting the DNA sequence of the E. coli secA gene. It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression.
BBa_K3026005 Reporter Toehold_DNA_SecA. A ToeHold switch targeting the mRNA sequence of the E. coli secA gene. It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression.
BBa_K3026006 Reporter Toehold_DNA_LacZ. A ToeHold switch targeting the DNA sequence of the pBluescript lacz cassette. It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression.
BBa_K3026007 Reporter Toehold_DNA_repOri. A ToeHold switch targeting the DNA sequence of the pBluescript replication origin cassette. It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression.
BBa_K3026008 Reporter Toehold_DNA_MATalpha. A ToeHold switch targeting the DNA sequence of S. cerevisiae strain BY4742 (MATalpha). It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression.
BBa_K3026010 Reporter Toehold norovirus ORF2 VP1. A ToeHold switch targeting the mRNA sequence of the VP1 gene from norovirus GII/Hu/JP/2007/GII.P15_GII.15/Sapporo/HK299. It produces sfGFP when the sequence is present.
BBa_K3026011 Reporter Toehold norovirus ORF2 VP1. A ToeHold switch targeting the mRNA sequence of the VP1 gene from norovirus GII/Hu/JP/2007/GII.P15_GII.15/Sapporo/HK299. It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression.
BBa_K3026012 Reporter Toehold_DNA_MATalpha. A ToeHold switch targeting the DNA sequence of S. cerevisiae strain BY4742 (MATalpha). It produces sfGFP when the sequence is present. Used strain BL21de3 for in vivo expression.
ICJFLS, China (2022) High School Team Project Description: A Portable Detector for Major Depressive Disorder (MDD) based on Toehold Switch detection and Cell Free System. The team "did well" by showcasing their toehold switch in a cell-free system and on a paper strip test, emphasizing its importance for product implementation. They chose an "appropriate reporter gene for the paper strip test (B-galactosidase)". They "designed and printed a 3D device model to show how their detector would work". This detector is described as holding "two paper strips", one for "reference" and the other for "sample detection". The detector can be used for "qualitative and quantitative analysis (using a phone)".
BBa_K4167000 A toehold-switch-sensor for detecting miRNA 34a-5p. It expresses amilCP (purple color change) upon activation. Optimization experiments showed best conditions: pH 7.2, 37°C, 18h fermentation, 1.5uM miRNA for higher reporter protein production in E. coli (BL21 strain). Won: Gold Medal. Nominations: Best Integrated human practices, Best Model, Best Wiki (32), (33), (34), (35), (36)
BBa_K4167001 A toehold-switch sensor for miRNA 221-3p. It expresses mRFP (red color, measurable via fluorescence or color) upon trigger binding. Optimization experiments showed best conditions: pH 7.2, 37°C, 18h fermentation, 1.5uM miRNA for higher reporter protein production in E. coli (BL21 strain).
BBa_K4167002 A toehold-switch sensor for miRNA let-7d-3p. It expresses amilGFP (yellow color, detectable fluorescent or color signal) upon activation. Optimization experiments showed best conditions: pH 7.2, 37°C, 18h fermentation, 1.5uM miRNA for higher reporter protein production in E. coli (BL21 strain).
BBa_K4167666 A toehold-switch sensor for miRNA 34a-5p. It expresses β-galactosidase (LacZ), which converts X-gal substrate into a blue color. It was tested in a cell-free system using a BL21ΔlacZ strain. Optimization showed best conditions: 30°C, 1h reaction time, and a lowest limit of visible color development of 500fM for miR-34a-5p target sensor.

References

  1. Team WageningenUR 2024 iGEM. Team: WageningenUR - 2024.Igem.org [Internet]. Igem.org. 2024 [cited 2025 Oct 1]. Available from: https://2024.igem.wiki/wageningenur/index.html
  2. Team WageningenUR 2024 iGEM. Part:BBa K5106001 - parts.igem.org [Internet]. Igem.org. 2024 [cited 2025 Oct 1]. Available from: https://parts.igem.org/Part:BBa_K5106001
  3. Team WageningenUR 2024 iGEM. Part:BBa K5106004 - parts.igem.org [Internet]. Igem.org. 2024 [cited 2025 Oct 1]. Available from: https://parts.igem.org/Part:BBa_K5106004
  4. Team WageningenUR 2024 iGEM. Part:BBa K5106002 - parts.igem.org [Internet]. Igem.org. 2024 [cited 2025 Oct 1]. Available from: https://parts.igem.org/Part:BBa_K5106002
  5. Team WageningenUR 2024 iGEM. Part:BBa K5106005 - parts.igem.org [Internet]. Igem.org. 2024 [cited 2025 Oct 1]. Available from: https://parts.igem.org/Part:BBa_K5106005
  6. Team WageningenUR 2024 iGEM. Part:BBa K5106003 - parts.igem.org [Internet]. Igem.org. 2024 [cited 2025 Oct 1]. Available from: https://parts.igem.org/Part:BBa_K5106003
  7. Team WageningenUR 2024 iGEM. Part:BBa K5106006 - parts.igem.org [Internet]. Igem.org. 2024 [cited 2025 Oct 1]. Available from: https://parts.igem.org/Part:BBa_K5106006
  8. Team Stanford 2020 iGEM. Team:Stanford - 2020.igem.org [Internet]. Igem.org. 2020 [cited 2025 Oct 1]. Available from: https://2020.igem.org/Team:Stanford
  9. Team Stanford 2020 iGEM. Part:BBa K3697011 - parts.igem.org [Internet]. Igem.org. 2020 [cited 2025 Oct 1]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3697011
  10. Team Exeter 2015 iGEM. Team:Exeter - 2015.igem.org [Internet]. Igem.org. 2015 [cited 2025 Oct 2]. Available from: https://2015.igem.org/Team:Exeter
  11. Team Exeter 2015 iGEM. Part:BBa K1586000 - parts.igem.org [Internet]. Igem.org. 2015 [cited 2025 Oct 2]. Available from: https://parts.igem.org/Part:BBa_K1586000
  12. Team Exeter 2015 iGEM. Part:BBa K1586001 - parts.igem.org [Internet]. Igem.org. 2015 [cited 2025 Oct 2]. Available from: https://parts.igem.org/Part:BBa_K1586001
  13. Team Exeter 2015 iGEM. Part:BBa K1586003 - parts.igem.org [Internet]. Igem.org. 2015 [cited 2025 Oct 2]. Available from: https://parts.igem.org/Part:BBa_K1586003
  14. Team Thessaly 2019 iGEM. Team:Thessaly - 2019.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 2]. Available from: https://2019.igem.org/Team:Thessaly
  15. Team Thessaly 2019 iGEM. Part:BBa K2973006 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 2]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K2973006
  16. Team Thessaly 2019 iGEM. Difference between Revisions of "Part:BBa K2973007" - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 2]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K2973007
  17. Team Thessaly 2019 iGEM. Difference between Revisions of "Part:BBa K2973011" - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 2]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K2973011
  18. Team Thessaly 2019 iGEM. Difference between revisions of "Part:BBa K2973012" - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 2]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K2973012
  19. Team ULAVAL 2019 iGEM. Team:ULaval - 2019.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://2019.igem.org/Team:ULaval
  20. Team ULAVAL 2019 iGEM. Part:BBa K3026000 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026000
  21. Team ULAVAL 2019 iGEM. Part:BBa K3026001 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026001
  22. Team ULAVAL 2019 iGEM. Part:BBa K3026002 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026002
  23. Team ULAVAL 2019 iGEM. Part:BBa K3026003 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026003
  24. Team ULAVAL 2019 iGEM. Part:BBa K3026004 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026004
  25. Team ULAVAL 2019 iGEM. Part:BBa K3026005 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026005
  26. Team ULAVAL 2019 iGEM. Part:BBa K3026006 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026006
  27. Team ULAVAL 2019 iGEM. Part:BBa K3026007 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026007
  28. Team ULAVAL iGEM iGEM. Part:BBa K3026008 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026008
  29. Team ULAVAL 2019 iGEM. Part:BBa K3026010 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026010
  30. Team ULAVAL 2019 iGEM. Part:BBa K3026011 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026011
  31. Team ULAVAL 2019 iGEM. Part:BBa K3026012 - parts.igem.org [Internet]. Igem.org. 2019 [cited 2025 Oct 3]. Available from: https://parts.igem.org/wiki/index.php?title=Part:BBa_K3026012
  32. Team ICJFLS 2022 iGEM. Dawnlight Saga: A Portable Detector for MDD Based on Toehold Switch and Cell Free System - 2022.igem.wiki [Internet]. Igem.wiki. 2022 [cited 2025 Oct 3]. Available from: https://2022.igem.wiki/icjfls/
  33. Team ICJFLS 2022 iGEM. Part:BBa K4167000 - parts.igem.org [Internet]. Igem.org. 2022 [cited 2025 Oct 3]. Available from: https://parts.igem.org/Part:BBa_K4167000
  34. Team ICJFLS 2022 iGEM. Part:BBa K4167001 - parts.igem.org [Internet]. Igem.org. 2022 [cited 2025 Oct 3]. Available from: https://parts.igem.org/Part:BBa_K4167001
  35. Team ICJFLS 2022 iGEM. Part:BBa K4167002 - parts.igem.org [Internet]. Igem.org. 2022 [cited 2025 Oct 3]. Available from: https://parts.igem.org/Part:BBa_K4167002
  36. Team ICJFLS 2022 iGEM. Part:BBa K4167666 - parts.igem.org [Internet]. Igem.org. 2022 [cited 2025 Oct 3]. Available from: https://parts.igem.org/Part:BBa_K4167666

Admin Contribution

Administrative Guidelines

KCL-UK iGEM 2025
Administrative Guidelines
Download PDF

Case Study Guideline

Why is selecting a specific case study important?

Selecting a case study to work on can be a good way to ensure your IGEM diagnostic project is more impactful in its implementation. When creating a diagnostic tool, you have to account for both scientific limitations and real-life considerations. Scientific limitations concern what your test can logistically do, e.g., what samples your biomarker can be detected in, what detection method you will use to detect it and what readout method is applicable to all of this, etc. Real-life considerations are more closely linked to social problems that could change how your test would interact with certain communities, e.g., places lacking access to electricity, sanitation, education, etc. In its early stages, your project will be very limited by the scientific aspects of things and so it will be difficult to adapt this to account for all real life situations that may exist everywhere your disease of choice is present. Different locations could face vastly different logistical problems, which could be hard to account for, e.g., your disease of choice may be very common in urban areas of one country due to overcrowding and rural areas of a different country due to a high frequency of unvaccinated people. It is hard to account for both of these environments simultaneously at the beginning of your project, as they both come with their own separate limitations. This is where it can be beneficial to first select a case study your current project can directly help. You will focus on an area that is suitable for the application of your project in its early form. This way, you can ensure your project can make a real change within a certain community. The human practices team could do work to investigate problems intersected with the disease in this specific area and do social work to aid the communities. As your test progresses and improves, you can then move on to expanding the scope of your project, but at first, focusing on a single area ensures your project will be useful to selected users.

Guideline:

  1. Read up on outbreaks and high-burden countries. Try to find consistencies and patterns in how the disease typically spreads and where it is most prevalent.
  2. Pick 3-5 recurring incidents of transmission or high-burden countries to work on and conduct more in-depth research into why the disease is such a problem in these areas and any gaps in the market you can fill. Be purposeful in picking these 3-5, rationalising why they were chosen in particular. Identify specific target demographics within the populations and theorise ways in which your product could help them.
  3. Research your project in the context of these case studies, questioning realistically if your project will actually help these populations you identified. Consider the limitations of your project in its current form and ask if the settings of your case studies could fundamentally support your project. E.g., is there sufficient infrastructure to dispense your project, is there systemic need for projects like yours and are there location-specific guidelines which will impact how easy it is to set up your project?
  4. Set up stakeholder interviews with general epidemiologists and people who have extensive experience with your disease of choice. Talk at length about your project, mentioning all its current flaws and then mention your research into case studies. From this ask for their informed opinion on what would be the most promising options and which ones you can immediately discount.
  5. Following this, you should set up additional stakeholder interviews (non-specific to your case studies at first) of people whose daily lives have been impacted by the disease, e.g., patients and healthcare workers, your project is centred around. Try and identify any glaring problems with your diagnostic and work with the lab and research team to amend as many of these as possible before proceeding with your project.
  6. Once this is done, set up stakeholder meetings with informants specific to your remaining case studies. Directly questioning the need for your diagnostic in their settings and any further opinions about applications and implementation of your diagnostic, as well as limitations which were not already illuminated by previous research.
  7. Once this is done, your case study list should be narrowed down. Of the remaining, select the most appropriate according to your own judgement and that of the various stakeholders you consulted. Ensure you have used a diverse selection of stakeholders throughout your research.
  8. From here, survey the general public of the area of your case study, asking them their experience with the disease and gauge their attitudes towards your test. You're aiming for positive reception. Also be mindful of stigmas and social issues intersected with disease in this location.
  9. Make a plan for addressing these social issues and make a location-specific implementation strategy. Researching heavily and consulting stakeholders from your case study location and those who have set up startups in similar settings on the requirements of your diagnostic in this location.

Stakeholder Interview Guideline

Why is conducting interviews important?

Stakeholder interviews are an essential part of IGEM, particularly the Human Practices and Ethics side of things. By speaking to real people who have worked in the field of your project and are directly affected by the issues your project will address, you can gain a deeper understanding of the needs you need to meet in order for your project to truly make a difference. Speaking to these people will only further humanise the issues you're trying to overcome, further inspiring your team. It will also help aid the direction of your project with ideal pathways to go down and ensure your project stays grounded in the reality of your target audience. This is a good opportunity to give voices in synthetic biology to a diverse audience, this can be particularly notable as synthetic biology is not a highly accessible field and you can use your platform to uplift the voices of vulnerable groups. (This guide principally reflects end users of your project, not experts who will give scientific clarification of your project, who you also need separately as stakeholders.)

Guideline:

  1. Identify the target audience of stakeholders that you need primary input from. These will be your end users and may fall into multiple categories: e.g., for a diagnostic test, you'll have the patients who will use the test and the healthcare workers who will conduct it.
  2. Select a diverse line up of stakeholders who reflect the final users of your project, e.g., if you intend for your project to be used internationally, you need to get stakeholders from different countries, or if you have a specific implementation plan in a certain country, you must find stakeholders from there (or individuals with expert knowledge of the issues regarding your project in said country).
  3. From there, you must decide when to conduct formal vs informal interviews. Formal interviews will generally be taken with utmost focus, being recorded and transcribed whilst informal interviews can be more conversational with general questions to prompt helpful information from stakeholders. Informal vs formal interviews will be largely determined by personal situations with stakeholders' proximity to the issue you are investigating and their preferences of sharing information but aim to ensure you have formal interviews with potential end-users of your project.
  4. Prepare a list of questions for each category of stakeholders, e.g., for the category of infectious diseases: patients, healthcare workers, etc. Ensure the questions you ask will result in answers you can use to directly implement changes into your project. Ask for consent from stakeholders and inform them, being transparent with individual stakeholders about how their interviews will be used.
  5. For formal interviews, record and transcribe the meetings, deleting these files at a later agreed upon date when the write up is complete.
  6. Write up the results of your interviews: include a basic summary of the stakeholder account, the key things you learnt from it and how you will use these findings to improve and inform your project moving forward.