Plasmid Construction
1.Primer Design and Amplification of Target Fragment：
1. Primer Design：T7 promoter + target gene（including lactase、lactose pump、Luxs、MucBP、BreR、ccdB）：
| Name | Sequence（5’→3’） | Tm Value（℃） |
|---|---|---|
| T7-F | atgatttctggaattTAATACGACTCACTATAGGGG | 55 |
| T7-R | attgagacgttctagCGCAGAAAGGCCCACCCG | 52 |
| plsrA+ccdB-F | atgatttctggaattCATAATTCATTCTTCACTTTGAACATAT | 51 |
| plsrA+ccdB-R | attgagacgttctagCGCAGAAAGGCCCACCCG | 52 |
| Pgap-F | atgatttctggaattTAATACGACTCACTATAGGGG | 58 |
| Pgap-R | attgagacgttctagCGCAGAAAGGCCCACCCG | 52 |
| MucBP-F | atgatttctggaattTAATACGACTCACTATAGGGG | 53 |
2.PCR Amplification System:
| Component | Volume |
|---|---|
| 2× Taq PCR StarMix（Dye） | 10 μL |
| DNA Template | 1 μL |
| Forward Primer | 0.4 μL |
| Reverse Primer | 0.4 μL |
| dd H2O | Up to 20 μL |
3.PCR Program:
| Step | Temperature | Duration |
|---|---|---|
| Pre-denaturation | 95℃ | 5 min |
| Denaturation | 95℃ | 30 s |
| Annealing | 55℃ | 30 s |
| Extension | 72℃ | 1 kb/min,return to Step 2, repeat for 31 cycles |
| Final extension | 72℃ | 5 min |
Reflection:Later, it was found that there were mismatches and deletions of the target gene during plasmid construction. Therefore, we switched to a DNA polymerase with higher fidelity for PCR amplification.
4.New PCR System:
| Component | Volume |
|---|---|
| 2× Phanta Flash Master Mix（Dye Plus） | 25 μL |
| DNA Template | 1 μL |
| Forward Primer | 2 μL |
| Reverse Primer | 2 μL |
| dd H2O | Up to 50 μL |
5.New PCR Program:
| Step | Temperature | Duration |
|---|---|---|
| Pre-denaturation | 98℃ | 30 s |
| Denaturation | 98℃ | 10 s |
| Annealing | 58℃ | 8 s |
| Extension | 72℃ | 1 kb/min,return to Step 2, repeat for 31 cycles |
| Final extension | 72℃ | 1 min |
2.Electrophoresis Detection:
1. Prepare agarose gels with appropriate concentrations: detection gel at 2% concentration and recovery gel at 1% concentration. Heat in a microwave until the agarose is completely dissolved.
2. After the solution cools to approximately 60℃, add nucleic acid dye at a ratio of 1:10,000 and mix thoroughly.
3. Place a comb of appropriate size, pour the warm agarose gel into the gel tray with a gel thickness of 3-5 mm, which takes approximately 20 minutes to solidify.
4. Once the gel is completely solidified, gently remove the comb. Transfer the gel tray to the electrophoresis tank, add 1×TAE buffer such that the buffer covers the gel surface by approximately 1mm to ensure proper conductivity.
5. After electrophoresis is completed, remove the gel plate and examine the migration of DNA under a UV gel imager.
3.gel extraction：
1.Transfer the gel blocks containing the target gene fragments into two 1.5 mL centrifuge tubes respectively according to the corresponding genes, and weigh to determine the weight of each gel block.
2.Add XP5 Binding Buffer in a volume equal to that of the gel to the centrifuge tube. (Note: Calculate the volume of XP5 Binding Buffer (gel dissolution buffer) needed based on 1 g/mL.)
3.Incubate the gel blocks with XP5 Binding Buffer at 50-60℃ for approximately 7 minutes until the gel is completely melted, vortexing or shaking the mixture every 2-3 minutes. If the gel block is large or the gel concentration is high, the incubation time can be appropriately extended until the gel is completely melted.
4.Place the HiBind® DNA Mini Column into a 2 mL collection tube.
5.Transfer up to 700 μL of the DNA gel solution to the HiBind® DNA Mini Column, centrifuge at 10,000 ×g for 1 minute at room temperature, discard the filtrate, and place the column back into the 2 mL collection tube.
6.If the volume of the DNA gel solution exceeds 700 μL, repeat step 5 until all the DNA gel solution has passed through the binding column.
7.Discard the filtrate, place the HiBind® DNA Mini Column back into the 2 mL collection tube. Add 300 μL of XP5 Binding Buffer to the binding column, centrifuge at maximum speed (≥13,000 ×g) for 1 minute at room temperature, and discard the filtrate.
8.Place the HiBind® DNA Mini Column back into the 2 mL collection tube. Add 700 μL of SPW Buffer (properly diluted with anhydrous ethanol) to the binding column. Centrifuge at 10,000 ×g for 1 minute at room temperature, and discard the filtrate.
9.Place the HiBind® DNA Mini Column back into the 2 mL collection tube, and centrifuge at ≥13,000 ×g for 2 minutes at room temperature to spin dry the residual liquid in the binding column matrix.
10.Mount the HiBind® DNA Mini Column onto a clean 1.5 mL centrifuge tube, add 15-30 μL of Elution Buffer to the binding column matrix, let it stand at room temperature for 2 minutes, and centrifuge at 13,000 ×g for 1 minute to elute the DNA. A secondary elution can be performed with new Elution Buffer (which can increase yield but will reduce concentration), or the Elution Buffer from the first elution can be re-added to the binding column for secondary elution (which can increase elution concentration without increasing elution volume). (Note: ddH₂O (double-distilled water) can also be used for elution, but Elution Buffer can stabilize DNA more effectively.)
11.Detection: Finally, use a Nanodrop to measure the concentration of the purified DNA and the A260/A280 ratio to assess the quality of the purified DNA fragments.
Inoculate 10 μL of E. coli culture harboring the target plasmid and 1.2 μL of ampicillin (50 mg/mL) into 1 mL of LB liquid medium. Incubate at 37°C with shaking at 180 rpm for 12 hours. Subsequently, inoculate 5 μL of this pre-culture and 6 μL of ampicillin (50 mg/mL) into 5 mL of LB liquid medium. Incubate at 37°C with shaking at 180 rpm for 12 hours. Extract plasmid using a standard plasmid miniprep kit.
4.Plasmid Miniprep:
1.Collect bacteria by centrifugation at 10,000 ×g for 1 minute at room temperature. Discard the supernatant medium, add 250 μL of Solution I, and vortex vigorously to fully resuspend the bacteria. (Remark: RNase A must be added to Solution I before use. Since RNase A was not added during the experiment, attention should be paid to distinguishing RNA from DNA during electrophoresis—RNA is smaller than DNA and can be easily distinguished during electrophoresis.)
2.Add 250 μL of Solution II to the resuspended solution, gently invert the tube several times to mix. If necessary, let the lysate stand at room temperature for 2-3 minutes. (Note: Avoid vigorous mixing of the lysate. The standing time should not exceed 5 minutes; otherwise, chromosomal DNA may break, reducing plasmid purity. Prolonged standing may cause plasmid DNA to break. After using Solution II, the bottle cap must be tightly closed for storage.)
3.Add 350 μL of Solution III, gently invert several times until a white flocculent precipitate forms. Centrifuge at ≥13,000 ×g for 10 minutes at room temperature.
4.Place the HiBind® DNA Mini Column into a 2 mL centrifuge tube.
5.Transfer no more than 700 μL of the supernatant to the HiBind® DNA Mini Column, centrifuge at maximum speed for 1 minute at room temperature, and discard the filtrate.
6.Reattach the HiBind® DNA Mini Column to the collection tube, add 500 μL of HBC Buffer (properly diluted with isopropanol), centrifuge at maximum speed for 1 minute at room temperature, and discard the filtrate. (Note: HBC Buffer must be diluted with isopropanol according to the instructions before use.)
7.Reattach the HiBind® DNA Mini Column to the collection tube, add 700 μL of DNA Wash Buffer, centrifuge at maximum speed for 1 minute at room temperature, and discard the filtrate. (Note: DNA Wash Buffer must be diluted with anhydrous ethanol according to the instructions before use.)
8.Discard the filtrate and repeat step 7 for a second wash with DNA Wash Buffer.
9.Discard the filtrate, reattach the HiBind® DNA Mini Column to the collection tube, and centrifuge the empty column at maximum speed for 2 minutes to spin dry the column matrix.
10.Mount the HiBind® DNA Mini Column onto a clean 1.5 mL centrifuge tube, add 30 μL of ddH₂O (double-distilled water) to the column matrix, let it stand for 1 minute, and centrifuge at 13,000 ×g for 1 minute to elute the DNA. (Note: The first elution can recover 65-80% of the plasmid DNA; a second elution can be performed as needed. For the second elution, either use new ddH₂O (which can increase yield but reduce concentration) or re-add the ddH₂O from the first elution to the column (which can increase elution concentration without increasing volume).
5.restriction enzyme digestion：
Note: The restriction enzyme sites we selected: EcoRⅠ and XbaⅠ
1.Use EcoRⅠ and XbaⅠ restriction endonucleases to prepare the following reaction system, and perform double digestion on the pMB1-A plasmid. The system is shown below. (Remark: All sample additions must be performed on ice throughout the process; prepare one additional tube of undigested plasmid as a control.)
2.Undigested Plasmid System (20 μL):
| Component | Volume |
|---|---|
| Plasmid DNA | 3 μL |
| dd H2O | 17 μL |
Plasmid Digestion System (20 μL):
| Component | Volume |
|---|---|
| Plasmid DNA | 3 μL |
| dd H2O | 13 μL |
| EcoRI | 1 μL |
| XbaI | 1 μL |
| 10× GensCut Color Buffer | 2 μL |
3.After preparing the above digestion system and vortexing to mix thoroughly, place the system on a metal bath to digest at 37℃ for 1 hour.
4.While the digestion is in progress, prepare the agarose gel required for electrophoresis. The gel concentration for electrophoresis is 1%: weigh 0.2 g of agarose and dissolve it in 20 mL of 1× TAE respectively, heat in a microwave until completely dissolved, add 2 μL of nucleic acid dye after cooling slightly, and pour into the gel mold.
5.After digestion, subject all digested plasmids, undigested plasmids, and 250 bp-10000 bp marker to agarose gel electrophoresis at 120 V for 20 minutes.
6.Use a UV gel imager to check the separation effect, and determine the length of relevant fragments using the DNA Ladder.
7.Perform gel extraction on the digested plasmids and determine their concentrations.
6.Ligation and Transformation：
1.Prepare the ligation system according to the table below. The target gene fragments to be ligated are respectively (Remark: All sample additions must be performed on ice throughout the process):
| Component | Volume |
|---|---|
| Target gene fragment | 1 μL |
| Plasmid fragment | 4 μL |
| 2× Uniclone Seamless Cloning Mix | 5 μL |
2.After adding all components to the system, mix the system thoroughly using a vortex mixer for 30 seconds, then spin it down in a palm centrifuge for 30 seconds to ensure all contents settle at the bottom of the PCR tube.
3.Place the ligation system in a PCR instrument and ligate at 50℃ for 30 minutes. Subsequently, transform the ligation product into E. coli competent cells.
4.Take out the corresponding E. coli competent cells (DH5α/DE3) from the -80℃ refrigerator, thaw them on an ice box at room temperature, and label them properly.
5.Divide the thawed 100 μL competent cells into two aliquots (50 μL each), add 5 μL of the ligation product to each aliquot, and incubate them on the ice box for 30 minutes.
6.After the ice incubation, perform heat shock in a 42℃ metal bath for 90 seconds, then immediately place them back on the ice box for another 2 minutes of ice incubation.
7.After the ice incubation, add 950 μL of LB medium to each tube of competent cells. Place them in a shaker at 37℃ with a rotation speed of 180 rpm for shake culture for 1 hour.
8.After cultivation, centrifuge the tubes at 6000 rpm for 3 minutes. After centrifugation, discard approximately 900 μL of the supernatant, leaving about 100 μL of supernatant in each tube. Gently pipette to mix the liquid with the bacterial pellet thoroughly, then transfer all the mixture to LB resistant plates. Use spreaders to spread the liquid evenly until the plates are completely dry.
9.Invert the plates and place them in a 37℃ constant temperature incubator. After overnight incubation, check the bacterial growth.
7. Colony PCR：
1.Primer Design：T7 promoter + target gene（including lactase、lactose pump、Luxs、MucBP、BreR、ccdB）：
| Name | Sequence（5'→3'） | Tm Value（℃） |
|---|---|---|
| T7-colony PCR-F | aataaacaaataggggttccgc | 55 |
| T7-colony PCR-R | CCTATAGTGAGTCGTATTAcc | 52 |
| PlsrA-colony PCR-R | GTTGCCATCACAGATATAAATG | 51 |
| Pgap-colony PCR-R | GTTTACCAACAGTTGCTCTG | 55 |
| MucBP--colony PCR-R | GTTGCCATCACAGATATAAATG | 51 |
| Pgap-colony PCR-R | GTTTACCAACAGTTGCTCTG | 55 |
| MucBP--colony PCR-R | GGTAACCCGTATCTTTGAGC | 54 |
2.Prepare the colony PCR system according to the table below. (Remark: All sample additions must be performed on ice throughout the process)
| Component | Volume |
|---|---|
| 2× Taq PCR StarMix（Dye） | 5 μL |
| DNA Template | Monoclonal bacterial colony |
| Forward Primer | 0.4 μL |
| Reverse Primer | 0.4 μL |
| dd H2O | Up to 10 μL |
3.After adding all components to the system, mix the system thoroughly using a vortex mixer, then spin it down in a palm centrifuge for 30 seconds to ensure all contents settle at the bottom of the PCR tube.
4.In a sterilized ultra-clean bench, pick single colonies as the DNA template for PCR, and properly preserve the bacterial cultures. Place the system in a PCR instrument and perform amplification according to the following program:
| Step | Temperature | Duration |
|---|---|---|
| Pre-denaturation | 94℃ | 5 min |
| Denaturation | 95℃ | 30 s（31 cycles） |
| Annealing | 50℃ | 30 s（31 cycles） |
| Extension | 72℃ | 1 kb/min（31 cycles） |
| Final Extension | 72℃ | 5 min |
5.Prepare the agarose gel required for electrophoresis. The gel concentration for electrophoresis is 1%: weigh two portions of 0.8 g agarose, dissolve each in 80 mL of 1× TAE respectively, heat in a microwave until completely dissolved. After cooling slightly, add 8 μL of nucleic acid dye to each, shake well, and pour into gel molds to solidify.
6.After amplification, take 5 μL of each PCR product and 3 μL of 100 bp-2000 bp marker, and perform agarose gel electrophoresis at 120 V for 20 minutes.
7.Use a UV gel imager to check the separation effect, and determine the length of relevant fragments using the DNA Ladder to assess the success of plasmid construction.
Electrotransformation of Bifidobacterium longum Protocol
1. Strains and Materials
(1) Strains: Bifidobacterium longum ATCC15707, Escherichia coli DH5α , Escherichia coli G81387-1 harboring the plasmid containing the modified bgaB gene.
(2) Target Plasmids: pMB1-A recombinant plasmids (pGAP+modified bgaB, pGAP+LacY).
(3) Reagent Preparation:
① Bifidobacterium longum Growth Medium: Weigh 19.86 g of MRS solid powder into a blue-capped bottle. Add 300 mL of ddH₂O, dissolve thoroughly, and precisely adjust the pH to between 7.0 and 7.2 using a pH meter. Autoclave at 121°C, 0.05 MPa for 20 minutes. After cooling to room temperature, store at 4°C. Add L-Cysteine solution at a 1:100 ratio immediately before use.
100× L-Cysteine Solution: Weigh 0.484 g of L-Cysteine and dissolve in 10 mL of ddH₂O. Filter sterilize using a sterilized 0.22 μm filter and store at 4°C.
② LB Liquid Medium (without antibiotics): Weigh 1 g NaCl, 1 g Tryptone, and 0.5 g Yeast Extract. Dissolve in 100 mL dH₂O and autoclave.
③ Electroporation Buffer: 1 mM citrate buffer (2.52 mg citric acid, 22.42 mg trisodium citrate, 1 L distilled water, pH 6.0) containing 0.5 M sucrose, pH 6.0.
④ Antibiotic Selection Solid Medium: Add agar at 15 g/L during the preparation of the B. longumGrowth Medium. Autoclave at 121°C, 0.05 MPa for 20 minutes. After cooling to approximately 50°C, add L-Cysteine solution at a 1:100 ratio and ampicillin to a final working concentration of 20 μg/mL (from a 50 mg/mL stock). Mix well and pour into 10 cm Petri dishes. Allow plates to solidify and store at 4°C until use.
(4) Consumables Preparation: Sterile 1.5 mL microcentrifuge tubes, sterile 50 mL centrifuge tubes, sterile pipette tips, etc.
2. Strain Cultivation
Inoculate 20 μL of frozen stock into 2 mL of complete growth medium. Incubate anaerobically at 37°C overnight until OD₆₀₀ reaches ≥1.0. Subculture at a 1:100 ratio into 5 mL of fresh B. longumGrowth Medium and incubate anaerobically at 37°C for 6-12 hours. Repeat this subculturing process 3-5 times. Inoculate at a 1:100 ratio into 50 mL of growth medium and incubate anaerobically at 37°C until the culture reaches the mid-logarithmic growth phase.
3. Plasmid Acquisition
Inoculate 10 μL of E. coli culture harboring the target plasmid and 1.2 μL of ampicillin (50 mg/mL) into 1 mL of LB liquid medium. Incubate at 37°C with shaking at 180 rpm for 12 hours. Subsequently, inoculate 5 μL of this pre-culture and 6 μL of ampicillin (50 mg/mL) into 5 mL of LB liquid medium. Incubate at 37°C with shaking at 180 rpm for 12 hours. Extract plasmid using a standard plasmid miniprep kit.
4. Electrotransformation Procedure
(1) Electroporation Cuvette Pretreatment:
① New Cuvettes: Open packaging under sterile conditions and expose to UV light in a laminar flow hood for 15 minutes.
② Used Cuvettes: After previous use, soak in 75% ethanol solution (store at 4°C for no more than 2 days). Rinse 10 times with 1 mL of 75% ethanol, followed by 10 rinses with 1 mL of 3% hydrogen peroxide solution. Finally, rinse thoroughly with disinfectant alcohol, wrap with clean tissue paper, and store at 4°C.
(2) Harvest B. longum cells cultured to OD₆₀₀ ≈ 0.5 by centrifuging 50 mL of culture at 4°C, 1000 × g for 15 minutes.
(3) Resuspend the cell pellet in 25 mL of ice-cold, sterile 10% glycerol solution containing 2% sucrose. Centrifuge at 4°C, 1000 × g for 15 minutes. Repeat this washing step twice.
(4) Wash the cell pellet twice by resuspending in 10-25 mL of ice-cold Electroporation Buffer and centrifuging at 4°C, 1000 × g for 15 minutes. Finally, resuspend the cell pellet in 200 μL of ice-cold Electroporation Buffer.
(5) Aliquot 50 μL of the cell suspension into a sterile 1.5 mL microcentrifuge tube and mix with 1.5 μg of plasmid DNA.
(6) Transfer the DNA-cell mixture into a pre-chilled 0.2 cm electroporation cuvette. Incubate on ice for 5 minutes.
(7) Electroporation: Deliver an electric pulse using the following parameters: Voltage 1.8 - 2.75 kV, Capacitance 25 μF, Resistance 200 Ω, resulting in a pulse time of 3-4 ms.
(8) Recovery: Immediately after electroporation, add 1 mL of pre-warmed (37°C) Growth Medium containing 2% (wt/vol) sucrose to the cuvette. Gently pipette to mix and transfer the suspension to a sterile 1.5 mL microcentrifuge tube. Incubate anaerobically at 37°C for 2-4 hours for recovery. Avoid vigorous shaking during recovery.
5. Selection of Positive Clones
After recovery, centrifuge the culture at 5000 × g for 5 minutes. Discard most of the supernatant, leaving approximately 200 μL to resuspend the cell pellet. Spread the resuspended cells onto Antibiotic Selection Solid Medium plates. Incubate the plates anaerobically at 37°C for 48-72 hours, until single colonies appear. Pick individual colonies, inoculate into growth medium containing the appropriate antibiotic, and culture anaerobically. Verify successful transformation by plasmid extraction followed by PCR, restriction enzyme digestion, or sequencing.
Reference
[1] Liu, Y., Xiong, Z., Liu, W., Song, Z., Song, X., & Ai, L. (2025). High-efficiency transformation of Bifidobacterium animalis AR668-R1 using electroporation. Journal of Biotechnology, 404, 94–101. [2] Argnani, A., Leer, R. J., van Luijk, N., & Pouwels, P. H. (1996). A convenient and reproducible method to genetically transform bacteria of the genus Bifidobacterium. Microbiology, 142(1), 109–114. https://doi.org/10.1099/13500872-142-1-109
Functional Assay Protocol
I.Assay of Lactase Activity and Lactose Transport System
1. Solution Preparation
(1) Soluble Protein GST Lysis Buffer: 50 mM Tris-HCl(pH 7.5), 300 mM NaCl, 5 mM MgCl₂, 1 mM PMSF，1 mM TCEP. (Tris-HCl(pH 7.5): 7.88g. NaCl: 17.53g. MgCl₂: 0.48g. PMSF: 0.17g. TCEP: 0.29g. H2O: 1.0L)
(2) Soluble Protein GST Dialysis Buffer: 20 mM Tris-HCl(pH 7.5), 150 mM NaCl, 1 mM MgCl₂, 1 mM TCEP. (Tris-HCl(pH 7.5): 3.15g. NaCl: 8.77g. MgCl₂: 0.10g. TCEP: 0.29g. H2O: 1.0L) Store at 4°C.
(3) Wash Buffer: 20 mM Tris-HCl(pH 7.5), 150 mM NaCl, 1 mM MgCl₂, 1 mM TCEP.(Tris-HCl(pH 7.5): 3.15g. NaCl: 8.77g. MgCl₂: 0.10g. TCEP: 0.29g. H2O: 1.0L) Store at 4°C.
(4) GST Protein Elution Buffer: 50 mM Tris-HCl(pH 7.5), 150 mM NaCl, 15 mM reduced glutathione, 1 mM TCEP.(Tris-HCl(pH 7.5): 7.88g. NaCl: 8.77g. reduced glutathione: 4.61g. TCEP: 0.29g. H2O: 1.0L) Store at 4°C.
(5)Buffer 1: neutral buffer solution 0.1 M Sodium Phosphate Buffer,pH 7.0. Add lactose to this buffer at a final concentration of 10-20 mM to serve as the substrate. ①Solution A (0.2 M NaH₂PO₄): Dissolve 31.21 g of NaH₂PO₄·2H₂O or 27.6 g of NaH₂PO₄ in ultrapure water and bring the volume to 1 L. ②Solution B (0.2 M Na₂HPO₄): Dissolve 71.64 g of Na₂HPO₄·12H₂O or 28.39 g of Na₂HPO₄ in ultrapure water and bring the volume to 1 L. ③Preparation: Mix 39 mL of Solution A with 61 mL of Solution B. Precisely adjust the pH of the mixture to 7.0 using a pH meter. Dilute this 0.2 M mixture with an equal volume of ultrapure water to obtain the final 0.1 M Sodium Phosphate Buffer, pH 7.0.
(6)Buffer 2: acidic buffer ①Solution A (Citric Acid): Citric Acid (109.3 μM C₆H₈O₇) | 21.01mg Dissolve in ultrapure water and adjust the volume to 1000 mL. ②Solution B (Sodium Citrate): Sodium Citrate Dihydrate (100.0 μM Na₃C₆H₅O₇・2H₂O) | 29.41 mg Dissolve in ultrapure water and adjust the volume to 1000 mL. Buffer Preparation (pH 5.5-6.0): Mix 24.0 mL of Solution A with 76.0 mL of Solution B.
(7)Culture Medium: 10.0 g NaCl, 5.0 g Yeast Extract, 10.0 g Tryptone, 1.2 mL AMP (Working Concentration: 60%), 1 L ddH₂O
(8)Preparation of IPTG Solution: Dissolve 2.383 g of IPTG in 10 mL of sterile ddH₂O to obtain a 1 M IPTG solution. After filtration through a 0.22 μm filter membrane, the solution should be stored at -20 °C.
2.Culture Preparation: Small-scale and Large-scale Shake Flask Cultures
(1)Small-scale Culture (Small Shake): Inoculate 30 mL of LB liquid medium with 30 μL of bacterial culture harboring the target protein expression plasmid and 30 μL of a 100 mg/mL antibiotic stock solution. Incubate the culture at 37°C with shaking at 180 rpm for 12 hours.
(2)Large-scale Culture (Large Shake): Inoculate 1 L of LB liquid medium with the entire 30 mL of the small-scale culture and 1 mL of the 100 mg/mL antibiotic stock solution (selection antibiotic for the prokaryotic resistance marker on the plasmid). Incubate the culture at 37°C with shaking at 180 rpm.
3.Induction of Protein Expression and Cell Harvest
(1)Approximately 5 hours after initiating the large-scale culture, take a 300 μL aliquot of the bacterial culture and measure its optical density at OD590. When the OD590 value reaches the target range of 0.6 to 0.8, add 0.5 mL of the 1 M IPTG stock solution to the main culture to induce protein expression.
(2)Incubate the induced culture under the specified induction conditions: · Temperature: 16°C or 25°C · Agitation: 120 rpm · Duration: 16 hours Following induction, harvest the cells by centrifugation at 5000 rpm for 10 minutes. The resulting pellet constitutes the bacterial cell paste.
4.Cell Lysis and Clarification
(1)Resuspension: Resuspend the bacterial cell pellet using the Soluble Protein Lysis Buffer. Use a volume of buffer just sufficient to cover the pellet completely.
(2)High-Pressure Homogenization: Transfer the suspension to a high-pressure homogenizer. Perform cell disruption at 4°C for 20 minutes to obtain the protein lysate.
(3)Clarification Centrifugation: Centrifuge the lysate at 12,000 rpm for 50 minutes at 4°C to pellet cell debris.
(4)Supernatant Collection: Carefully transfer the resulting supernatant (clarified lysate) to a fresh centrifuge tube.
5.Purification of the Target Protein (GST-Tagged Fusion Protein)
(1)Batch Binding: Add pre-washed GST agarose purification resin to the clarified lysate. (The resin should be pre-equilibrated/washed with the soluble protein lysis buffer). Incubate the mixture at 4 °C with end-over-end rotation for 4 hours to allow the GST-tagged protein to bind to the resin.
(2)Column Preparation: After incubation, transfer the entire slurry (resin with bound protein) to a protein purification column.
(3)Washing: Wash the resin within the column with 5 column volumes (CV) of GST wash buffer to remove unbound and non-specifically bound proteins.
(4)Elution: The bound target protein was eluted by applying GST protein elution buffer to the column in 1 mL aliquots, added slowly along the inner wall of the column. The eluate (the flow-through containing the target protein) was collected in 1.5 mL microcentrifuge tubes.
(5)Concentration Measurement and Pooling: The protein concentration of the collected elution fractions was measured using the Coomassie Blue staining method. Specifically, 5 μL of each protein eluate was added to 200 μL of Coomassie Blue solution, and the resulting color change was observed. Fractions exhibiting the highest protein concentrations (as indicated by the most intense blue color) were pooled for subsequent steps.Dialysis: Transfer the pooled, high-concentration protein solution into a dialysis bag for subsequent buffer exchange.
6.SDS-PASE
(1) Pretest Reagent Preparation (Prepare in Advance to Ensure No Precipitation)
①Electrophoresis Buffer (1 L, Prepare Fresh Before Use or Store at 4°C)
| Reagent Component | Volume/Amount | Notes |
|---|---|---|
| Ultra-pure water (ddH₂O) | 895 mL | - |
| 20% SDS Solution | 5 mL | If white precipitation occurs, heat at 50-60°C to dissolve before adding |
| 10× Tris-Glycine Buffer | 100 mL | Commercially available or self-prepared (10× formula: 30.3 g Tris base + 144 g glycine + 10 g SDS, bring to volume with ddH₂O to 1 L) |
②4× Protein Loading Buffer (Aliquot in Advance, Store at -20°C) Routine formula (10 mL): 2 mL 1 M Tris-HCl (pH 6.8), 4 mL 20% SDS, 2 mL β-mercaptoethanol (or DTT, reducing agent, optional, used to reduce protein disulfide bonds), 1 mL 0.1% bromophenol blue (indicator), 1 mL glycerol; make up to 10 mL with ddH₂O. For non-reducing gels, the reducing agent can be omitted.
(2) Sample Processing (Ensure Protein Denaturation to Avoid Aggregation)
①Take the protein sample to be tested and mix it at a ratio of "sample : 4× loading buffer = 3:1".
②Place the mixed sample in a metal bath, set the temperature to 100°C (or 95°C), and heat for 10 minutes to completely denature the protein
③Immediately remove the sample after heating, cool it at room temperature for 5 minutes, then centrifuge at 12000 rpm for 5 minutes. Take the supernatant for later use. Mix well and heat the sample in a metal bath (100°C) for 10 minutes.
(3)Gel Plate Preparation (Key: Select Separating Gel Concentration Based on Protein Molecular Weight)
①Separating Gel Preparation
| Stock solution | Final acrylamide concentration in separating gel (%) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 5 | 6 | 7 | 7.5 | 8 | 9 | 10 | 12 | 13 | 15 | |
| H₂O | 8.75 | 8.25 | 7.75 | 7.55 | 7.25 | 6.75 | 6.25 | 5.25 | 4.75 | 3.75 |
| 30% acrylamide/0.8 bisacrylamide | 2.50 | 3.00 | 3.50 | 3.75 | 4.00 | 4.50 | 5.00 | 6.00 | 6.50 | 7.50 |
| 4× TrisCl/SDS, pH 8.8 | 3.75 | 3.75 | 3.75 | 3.75 | 3.75 | 3.75 | 3.75 | 3.75 | 3.75 | 3.75 |
| TEMED | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 |
| 10% (w/v) AP | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
②Stacking Gel Preparation
| Stock solution | Volume (ml) | ||||
|---|---|---|---|---|---|
| 5 | 10 | 15 | 20 | ||
| 3.9% Acrylamide | H₂O | 3.05 | 6.1 | 9.15 | 12.2 |
| 30% acrylamide/0.8 bisacrylamide | 0.65 | 1.3 | 1.95 | 2.6 | |
| 4× Tris Cl/SDS, pH 8.8 | 1.25 | 2.5 | 3.75 | 5 | |
| TEMED | 0.013 | 0.025 | 0.038 | 0.05 | |
| 10% (w/v) AP | 0.0375 | 0.075 | 0.1125 | 0.150 | |
(4) Electrophoresis Operation (Control Voltage and Time to Prevent Protein Run-Off)
①Loading: Use a micropipette to take the processed sample supernatant (load 20-30 μL per well, adjust based on well volume), and load 10 μL of "protein molecular weight marker (Marker)" at the same time.
②Electrophoresis Parameter Setting: According to the conditions you provided, set a constant voltage of 60 V and start electrophoresis. After the bromophenol blue indicator (blue band) moves from the stacking gel to the separating gel, continue electrophoresis at 60 V (or adjust to 80 V if needed to shorten time, but avoid excessive voltage causing gel overheating). The total electrophoresis time is approximately 2 hours; stop electrophoresis when the bromophenol blue indicator moves to 1 cm from the bottom of the gel plate.
(5) Coomassie Brilliant Blue Staining
①Pre-Staining Preparation: Remove the gel after electrophoresis and rinse it quickly with ultra-pure water 1-2 times.
②Staining Operation: Pour in the "decolorization-free Coomassie Brilliant Blue Staining Solution", ensure the gel is completely submerged, and place it on a low-speed shaker at room temperature for 30 minutes. During this period, you can observe that the target protein bands gradually appear while the background fades simultaneously.
③Result Observation and Recording: Once the target protein bands are clear, directly transfer the gel to ultra-pure water and soak for 5-10 minutes, Compare with the Marker to determine whether the molecular weight of the target protein is consistent with the expected value.
7. Dialysis of the Soluble Protein
(1)Dialysis Setup: Load the dialysate (the protein sample from step 5) into a 10 kDa molecular weight cut-off (MWCO) dialysis bag.
(2)Dialysis: Dialyze the sample against a large volume of the Soluble Protein Dialysis Buffer at 4 °C under constant stirring or agitation.
(3)Buffer Exchange: After the initial 2 hours of dialysis, replace the external dialysis buffer with fresh, pre-chilled buffer. Continue to change the buffer every 2 hours thereafter.
(4)Dialysis Duration: Continue this process of buffer exchange for a total dialysis duration of 60 hours.
(5)Clarification: Following dialysis, centrifuge the dialyzed sample at 12,000 rpm for 30 minutes at 4 °C to remove any precipitated material.
(6)Sample Collection: Carefully transfer the resulting supernatant to a fresh centrifuge tube. This supernatant contains the purified, buffer-exchanged soluble protein.
II. Enzyme Activity Assay
In vivo Assay:
1. Reaction Setup: In a test tube, prepare a 10 mL reaction mixture containing 0.25% (w/v) ONPG. To individual tubes, add 1, 3, and 5 μL of the enzyme solution, which has been adjusted to a standardized concentration of 100 μg/mL. Ensure the final reaction volume is consistent across all tubes.
2. Reaction Initiation: Start the enzymatic reaction by adding an equal, precise volume of the corresponding purified enzyme preparation to each reaction tube. Mix thoroughly and immediately start a timer.
3. Incubation: Incubate all reaction tubes simultaneously in a constant-temperature water bath or metal bath set to the assay temperature (e.g., 37°C) for 0.5 hours. Ensure all tubes reach the reaction temperature at the same time before proceeding.
4. Reaction Termination: At the exact predetermined time point (e.g., after 30 min), immediately terminate the reaction in each tube by adding Stop Solution (e.g., 1 M Na₂CO₃). Use a stop solution-to-reaction mixture ratio of 0.5:1 (v/v). For example, add 0.5 mL of stop solution to a 1 mL reaction. Vortex vigorously to ensure complete termination.
5. Absorbance Measurement: Transfer the terminated reaction mixture to a cuvette. Measure the absorbance of each sample sequentially using a spectrophotometer at the appropriate wavelength (e.g., 420 nm for ONPG hydrolysis).
6. Analysis & Calculation: Calculate the specific activity of the enzyme based on the measured absorbance values, the reaction time, the protein concentration, and the molar extinction coefficient of the product (e.g., o-nitrophenol for ONPG).
Whole-cell Assay:
Given that bifidobacteria are anaerobic, after successfully validating lactase activity in vitro in E. coli and subsequent plasmid transformation into Bifidobacterium, an ONPG Liquid Assay can be employed without the need to extract the enzyme from the cells.
1. 0.75 mol/L ONPG Solution:
(1) Dissolve 80 mg of ONPG in 15 mL of distilled water.
(2) Add 5 mL of buffer prepared as follows: · Dissolve 6.9 g of NaH₂PO₄ in 45 mL of distilled water. · Adjust the pH to 7.0 using 30% NaOH. · Bring the final volume of the buffer to 50 mL with distilled water.
(3)Store the ONPG solution at 4°C. The solution should be colorless; discard it if it turns yellow, indicating degradation.
2. ONPG Liquid Assay Protocol:
(1) Inoculate a large loopful (a generous amount) of a pure bacterial culture into a tube containing ONPG medium.
(2) Incubate the inoculated tube at 37°C for 1 to 3 hours or up to 24 hours. · Interpretation: · Positive Result (β-galactosidase present): Development of a yellow color (ortho-nitrophenol) within 3 hours. · Negative Result (β-galactosidase absent): No color change (remains colorless) even after 21-24 hours of incubation.
Calcium Transfection of E. coli DH5α
——CaCl₂ Method
1.Use an inoculating loop to take a small amount of bacterial solution from the correctly sequenced bacterial culture and streak it on an agar plate for 12 hours of cultivation.
2.Pick a single colony, inoculate it into 5 mL of liquid LB medium, label it appropriately, and incubate it in a shaker at 37°C for 16 hours.
3.Transfer 0.1 mL of the bacterial solution from the above LB culture to 10 mL of fresh LB medium. Incubate it in a shaker at 37°C for about 2 hours. Dilute the bacterial solution tenfold, then sample it in a clean bench to measure the OD value until the OD value reaches around 0.4.
4.Place the target bacterial culture in a shaker at 16°C and incubate for about 1 hour until the OD value reaches 0.5.
5.Dispense 10 mL of the bacterial solution into 10 sterile 1.5 mL centrifuge tubes and let them stand on ice for 30 minutes.
6.Centrifuge at 4200 rpm at 4°C for 10 minutes. After centrifugation, place the tubes back on ice, quickly pour off the supernatant, and aspirate the residual liquid in the tubes using a pre-chilled pipette tip. Add 40 μL of a mixed solution containing 80 mmol/L MgCl₂ and 20 mmol/L CaCl₂ to each tube; the contents of multiple tubes can be combined into a single centrifuge tube if necessary.
7.Let the bacterial suspension (after adding the mixed solution) stand on ice for 30 minutes.
8.Aspirate the residual liquid in the tubes with a pre-chilled pipette tip. Add 160 μL of a mixed solution consisting of 15% glycerol and 100 mmol/L CaCl₂ to each tube, and resuspend the bacterial pellet by gently swirling the tube on ice.
9.Store the transformed bacterial solution in a -80°C refrigerator for long-term preservation.
10.Take out the competent cells from the -80°C refrigerator, thaw them on ice, add 5 - 8 μL of plasmid DNA, and incubate on ice for 20 minutes.
11.Perform heat shock at 42°C for 45 seconds, then immediately place the tubes in an ice box and let them stand for 2 minutes.
12.Add 600 μL of LB medium without antibiotics and incubate with shaking at 37°C for 45 minutes to allow bacterial recovery.
13.Centrifuge at 4000 rpm for 12 minutes, discard most of the supernatant (leave approximately 200 μL of the supernatant), and spread the remaining bacterial suspension onto an agar plate. Label the plate clearly.
14.Invert the plate and incubate at 37°C for 12 hours.
15.Perform colony PCR (bacterial PCR) to verify the results.
Experimental Reflections
During the chemical transformation of Escherichia coli, we encountered a series of issues, which we have reflected on and addressed as follows:
1.In the first round of cultivation, E. coli overgrew the Petri dish, making it impossible to isolate single colonies, and there were many false positives. This indicated that we had spread too much bacterial solution onto a single Petri dish. In subsequent experiments, we reduced the concentration of competent cells and increased the amount of ampicillin per unit volume of liquid medium, which successfully controlled this phenomenon.
2.In the second round of cultivation, the OD value of the E. coli sample was too low, suggesting that the cultivation time was insufficient. After identifying this issue, we prolonged the cultivation time of E. coli.
3.During the second round of cultivation, we also observed partial aggregation of E. coli, which implied uneven spreading of the bacterial solution during plating. In subsequent experiments, we ensured that the bacterial solution was completely dissolved in the solid LB medium before sealing the plate for cultivation. The results of these subsequent experiments confirmed our hypothesis.
Adhesion system detection experiment
Caco-2 Cell Assay
1.Inoculate Caco-2 cells into a black 96-well plate with a transparent bottom, then incubate at 37°C in a humidified 5% CO₂ incubator under atmospheric oxygen tension concentration for 24 - 48 hours until the cells reach 80% confluence.
2.Gently wash the cells twice with PBS (pH 7.4) which is pre-warmed to 37°C.
3.Add 100 μL of the prepared Escherichia coli DH5α bacterial suspension to each well of the washed 96-well plate.
4.Add an equal volume of PBS to the control group.
5.Place the 96-well plate again at 37°C in a 5% CO₂ atmosphere for anaerobic incubation for 1 - 2 hours (determined by pre-experiments).
6.Divide the wells of the 96-well plate into two groups, Group A and Group B. For Group A, gently aspirate and discard the bacterial suspension using a pipette, taking special care not to touch the cells at the bottom of the wells during the operation. For Group B, wash the wells 3 times with pre-warmed PBS or LB medium. During each wash, slowly add 100 μL of the liquid along the well wall, then slowly aspirate it out.
7.Confirming the cell status in each experimental well is normal under bright field, while wells with abnormal cells were discarded.
8.Set the exposure time of the fluorescence microscope to 200 ms uniformly. Randomly select ≥5 fields of view from each well.
9.Capture high-resolution images using a 20× or 40× objective lens.
10.Process the captured fluorescence images using image analysis software, and quantify the fluorescence intensity to indirectly obtain the adhesion amount of bacteria.
Filter Paper-Immobilized Protein Assay
1.Cut qualitative filter paper into 2 cm × 2 cm squares, ensure each piece of filter paper is of the same size.
2. Place them in a Petri dish, sterilize by autoclaving (121°C, 20 min), and dry them in a sterile ultra-clean bench.
3. Under sterile conditions, 50 - 100 μL of the prepared porcine gastric mucin solution (0.5 - 2 mg/mL, dissolved in sterile PBS pH 7.2 - 7.4) was aspirated, and evenly drop it onto each sterilized filter paper to ensure the filter paper is completely soaked without liquid dripping. Place the filter papers with the dropped solution in a sterile Petri dish, and incubate them in a 37°C constant-temperature incubator for 2 - 4 hours or at 4°C overnight.
4. (Optional) Add 1% bovine serum albumin (BSA) solution to the filter papers with immobilized mucin for blocking for 30 minutes, then gently rinse the filter papers 2 - 3 times with sterile PBS, and aspirate the residual liquid after each rinse.
5. Adjust the concentration of Escherichia coli DH5α (passaged to the 5th generation and transformed with the pgap+Brer and pgap+MucBP plasmids) to 10⁸ CFU/mL, using sterile PBS (pH 7.2 - 7.4) or normal saline. Aspirate 100 - 200 μL of the bacterial suspension and slowly drop it onto each filter paper with immobilized mucin to ensure the bacterial suspension evenly covers the surface of the filter paper.
6. Place the filter papers inoculated with the bacterial suspension in a sterile Petri dish containing LB medium, and incubate in a 37°C anaerobic incubator for 1 - 2 hours. After incubation, use sterile tweezers to pick up the filter papers, gently place them in a Petri dish filled with sterile PBS, and shake gently for 30 seconds per wash, repeating 3 - 5 times.
7. Drain the water from the washed filter papers with sterile tweezers, and place them flat on the surface of a sterilized Petri dish containing solid medium (ensure the filter papers are in close contact with the medium to avoid air bubbles). Each filter paper corresponds to one Petri dish, and mark them properly. Incubate in a 37°C anaerobic incubator for 48 - 72 hours until colonies are clearly visible.
8. After incubation, observe and count the number of colonies (CFU) grown on each filter paper, then evaluate the adhesion capacity of bacteria to mucin by comparing colony counts across different filter papers.
| Group | Experimental Content |
|---|---|
| Experimental | Mucin-immobilized filter paper + target bacterial suspension |
| Negative Control | Blank filter paper (without mucin immobilization) + target bacterial suspension |
| Bacterial Suspension Concentration Control | Direct plating of the same batch of target bacterial suspension (without filter paper contact) |
| Blank Medium Control | Only solid medium, no filter paper or bacterial suspension |
quorum sensing
Vibrio harveyi BB170 report strain tested for AI-2 activity
1.Culture medium configuration
（1）2216E Seawater agar solid (1L): agar 15.0g (liquid medium is not included), 121℃, sterilized for 15min.
（2）AB culture medium: Dissolve the following components in 960 mL distilled water: 2.0 g acid-hydrolyzed casein (vitamin-free), 7×10^3 mg MgSO4·7H2O 12.3g, and 17.5 g NaCl. Adjust pH to 7.5 using 3 M KOH, then sterilize at 121℃°C for 20 minutes. After cooling to room temperature, add sterile solutions under aseptic conditions: 10mL filtered and sterilized 1 M potassium phosphate buffer (pH 7.0),10 mL 0.1 M arginine, and 20 mL 50% glycerol for fluorescence intensity measurement.
（3）DPD configuration-use as you prepare: Component concentration/volume Step DPD pure product 1 mg Weigh 1 mg DPD solvent sterile AB medium dissolve DPD in 1 mL sterile AB medium to prepare a stock solution of 1 mg/mL (use as you prepare to avoid degradation).
AL-2 (Luxc gene detection)
1.After burning the top with alcohol, sterile water was quickly dripped on it, and then it was crushed with forceps and 0.5mL sterile water was sucked into the freeze-drying tube. After full dissolution, 200μL/ individual was injected into the plate, and the coating was uniform. The plate was cultured at 30℃ until single colony was grown.
2.20% glycerol, -20℃ can be frozen for half a year. If it is used in time, it can be cultured for two generations and then used for experiments. Directly pick a single colony and transfer it to 5mL 2216E seawater liquid culture medium for further use.
3.Preparation of sterile culture supernatants at different time points (engineered bacteria, wild-type bacteria and V harveyi)
Bacillus bifidus ：
（1）Bifidobacteria were cultured in MRS medium until reaching the logarithmic growth phase. After inoculation at 1% concentration, cultures were further incubated for 10,13,16,19,22, and 25 hours. Bacterial suspensions from each time point were divided into two portions: one was measured for OD600nm value, while the other was transferred to sterilized 5mL centrifuge tubes and centrifuged at 6000 rpm for 20 minutes. The bacterial sludge was discarded, and the supernatant was filtered through a sterile 0.22 μm filter into 1.5mL centrifuge tubes.
（2）The sterile supernatant of wild-type Bifidobacterium was collected by the same method and cultured for 30℃ with MRS medium for 16 h.
（3）The Eharveyi BBl70 sterile supernatant was collected from AB medium 30℃ and incubated at 16h by the same method.
（4）The sterilized AB medium and MRS medium were filtered using a 0.22 μm sterilizing filter. The sterile supernatants were stored in a-20℃C freezer.
colibacillus ：
（1）E. coli was cultured in LB medium until reaching the logarithmic growth phase. After inoculation at 1% concentration, cultures were further incubated for 1, 3, 5, 7, 9, 11, and 13 hours. Bacterial suspensions from each time point were divided into two portions: one for measuring OD600nm value, and the other transferred to sterilized 5mL centrifuge tubes. The suspension was centrifuged at 6000 rpm for 20 minutes, followed by discarding the bacterial sludge. The supernatant was filtered through a sterile 0.22 μm filter cartridge into 1.5mL centrifuge tubes.
（2）LB medium was collected in the same way and the sterile supernatant of wild-type Bifidobacterium was collected for 30℃ oscillating culture for 5h.
（3）The Eharveyi BBl70 sterile supernatant was collected from AB medium 30℃ and incubated at 16h by the same method.
（4）The sterilized AB medium and LB medium were filtered using a 0.22 μm sterile filter. The sterile supernatants were stored in a-20℃C freezer.
4.Luminescence detection: V.harveyi was inoculated into AB medium for 30℃ oscillation culture for 16h, and then incubated in AB medium at a ratio of 2% for 30℃ oscillation culture until turbidity (OD6000.7-1.2)
5.Fresh AB medium was diluted 1:5000 and then shaken and mixed.
6.The engineered bifidobacterium and wild type, V. harveyi BBl70, AB culture medium and MRS culture medium or LB culture medium were mixed with the diluted cultures in a volume ratio of 1:99 and continued to be shaken at 30℃.
7.Within 0-6 h, 200μL to 96 black enzyme label plate was taken every 30min, and the fluorescence intensity value was measured by chemiluminescence mode of multifunctional enzyme label instrument.
8.Samples and controls were taken in duplicate. Each test was repeated twice.
ccdB toxicity verification
1.Working concentration gradient (final concentration): 0 μM, 0.1 μM, 0.5 μM, 1 μM, 5 μM, 10 μM (3 replicates per concentration)
2. condition of culture -Escherichia coli: LB, 37℃ to OD₆₀₀=0.4 -Bifidobacteria: MRS+ 0.05% cysteine, anaerobic, 37℃ to OD₆₀₀ =0.4
3.AI-2 treatment with gradient concentration DPD: E. coli was incubated at 37℃ for 30 min, while Bifidobacterium was operated in an anaerobic chamber AI-2 processing with gradient concentration DPD: Escherichia coli was incubated at 37℃ for 30 min, while Bifidobacterium was operated in an anaerobic chamber
4.Time sampling: OD600 values were sampled at 0h,2h,4h,6h,8h,12h and 24h to draw the growth curve.
Verify the correlation between ccdB and AL-2 systems
1.The corresponding E. coli receptive cells were taken out from the-80℃ refrigerator, thawed on an ice box at room temperature, and marked.
2.The 100 μL of the thawed competent cells were divided into two portions, each of which was 50 μL, and 2.5 μL of Luxs and ccdB plasmids were added respectively. The cells were placed on an ice bath for 10 min.
3.After the ice bath, the 42℃ metal bath was thermally shocked for 90s, and then it was immediately placed on an ice box to continue the ice bath for 2 min.
4.After the ice bath, 950 μL of LB medium was added to each electroporation tube. The tubes were then placed on a shaker at 37℃°C with a rotational speed of 180 rpm for 1 hour. Following the incubation period, the mixture was centrifuged for 5 minutes using a centrifuge operating at 1000 rpm.
5.After centrifugation, about 900 μL of the supernatant was discarded and about 100 μL of the supernatant was left in each tube. The liquid and the bacteria were gently mixed by beating, and all of them were added to the LB antibiotic-resistant plate. The liquid was spread evenly with a spreading rod until it was completely dry. The plate was cultured overnight at 37℃.
6.Single colonies were picked from the overnight culture plate and PCR was performed to screen for the preliminary engineered bacteria with dual plasmids
7.After inoculation at 1%, the culture was continued for 14h, and the OD600 value was sampled every 30min to record the data and draw a figure.
8.The dual-plasmid engineered bacterial strain and the control strain (wild-type with empty plasmid) were inoculated into LB liquid medium. After incubation at 37℃°C and 180 rpm for 1 hour, 10 μL aliquots were taken every 30 minutes and diluted to 10^-6 dilution using sterile physiological saline. The diluted cultures were evenly spread on LB antibiotic-resistant agar plates. After 16-hour incubation at 37℃°C, colonies between 30-300 were counted from selected plates to determine viable bacterial counts at different time points.
