The concentrated experimental period was from July 21 to August 31, 2025. After the experiments were completed, the data were organized, and preliminary results were reported. All these members participated in every aspect of the experiment.

The daily experimental schedule for the project is shown in the following table:

Table 1. Experimental Schedule for the Project

The specific experimental records are as follows:

1. Experimental Contents
   1. Prepare LB medium

      Preparation of LB Medium: According to the LB medium formula, 10g of tryptone, 5g of yeast extract, and 10g of sodium chloride (NaCl) are required per 1L. For solid medium, an additional 15 - 20g/L of agar powder is needed. Calculate proportionally according to this formula: To prepare 200 mL of liquid medium and 200 mL of solid medium, 2g of tryptone, 1g of yeast extract, and 2g of sodium chloride are required. For the solid medium, an additional 3 - 4g of agar powder is needed. Add and mix all the required raw materials, seal the bottle mouth, and sterilize at high temperature and high pressure, 121 degrees Celsius for 15-20 min. After cooling to 60℃, Kanamycin (Kana) was added to the culture medium until the final concentration of Kana was 50 mg/L. Specifically, the concentration of the Kana solution stock solution is 50 mg/ mL, and 100 microliters (μL) of the Kana solution stock solution should be added to every 100 mL of the culture medium.

   2. PCR amplification of genes

      A-Y: COL7A1 c.520G

      A-T: COL7A1 c.520G>A

      B-Y: COL7A1 c.6745C

      B-T: COL7A1 c.6745C>T

      Through the PCR gene amplification technology, the required DNA fragments. A-Y and B-Y are the wild sequences, corresponding to c.520G and c.6745C respectively. A-T and B-T are the mutant sequences, corresponding to c.520G>A and c.6745C>T. N is the control group. For B-Y, add 50 μL of ddH₂O, 2 μL of Primer-1, 25 μL of 2Taq Master Mix, and 1 μL of Template DNA; for B-T, add 50 μL of ddH₂O, 2 μL of Primer-2, 25 μL of 2Taq Master Mix, and 1 μL of Template DNA; for N, add 50 μL of ddH₂O, 2 μL of Primer-2, and 25 μL of 2×Taq Master Mix. Put it into a PCR instrument and set the following reaction program: keep at 95 degrees Celsius for 1 minute, then enter the cycling stage: 95 degrees Celsius for 30 seconds, 56 degrees Celsius for 30 seconds, 72 degrees Celsius for 4 minutes, cycGGGGCTGCAATTCTCCATGTGGCTGACCATGTCTTCCTGCCCCAGCTGGCCCGACCTGGTGTCCCCAAGGTCTGCATCCTGATCACAGACGGGAAGTCCCAGGACCTGGTGGACACAGCTGCCCAAAGGCTGAAGGGGCAGGGGGTCAAGCTAle 30 - 35 times. After the cycle ends, finally keep at 72 degrees Celsius for 5 minutes, and then keep at 12 degrees Celsius.

      The gene sequences are as follows:

      AsCpf1 sequence:

      ATGACCCAATTTGAAGGTTTTACCAATTTATACCAAGTTTCGAAGACCCTTCGTTTTGAACTGATTCCCCAAGGAAAAACACTCAAACATATCCAGGAGCAAGGGTTCATTGAGGAGGATAAAGCTCGCAATGACCATTACAAAGAGTTAAAACCAATCATTGACCGCATCTATAAGACTTATGCTGATCAATGTCTCCAACTGGTACAGCTTGACTGGGAGAATCTATCTGCAGCCATAGACTCCTATCGTAAGGAAAAAACCGAAGAAACACGAAATGCGCTGATTGAGGAGCAAGCAACATATAGAAATGCGATTCATGACTACTTTATAGGTCGGACGGATAATCTGACAGATGCCATAAATAAGCGCCATGCTGAAATCTATAAAGGACTTTTTAAAGCTGAACTTTTCAATGGAAAAGTTTTAAAGCAATTAGGGACCGTAACCACGACAGAACATGAAAATGCTCTACTCCGTTCGTTTGACAAATTTACGACCTATTTTTCCGGCTTTTATGAAAACCGAAAAAATGTCTTTAGCGCTGAAGATATCAGCACGGCAATTCCCCATCGAATCGTCCAGGACAATTTCCCTAAATTTAAGGAAAACTGCCATATTTTTACAAGATTGATAACCGCAGTTCCTTCTTTGCGGGAGCATTTTGAAAATGTCAAAAAGGCCATTGGAATCTTTGTTAGTACGTCTATTGAAGAAGTCTTTTCCTTTCCCTTTTATAATCAACTTCTAACCCAAACGCAAATTGATCTTTATAATCAACTTCTCGGCGGCATATCTAGGGAAGCAGGCACAGAAAAAATCAAGGGACTTAATGAAGTTCTCAATCTGGCTATCCAAAAAAATGATGAAACAGCCCATATAATCGCGTCCCTGCCGCATCGTTTTATTCCTCTTTTTAAACAAATTCTTTCCGATCGAAATACGTTATCCTTTATTTTGGAAGAATTCAAAAGCGATGAGGAAGTCATCCAATCCTTCTGCAAATATAAAACCCTCTTGAGAAACGAAAATGTACTGGAGACTGCAGAAGCCCTTTTCAATGAATTAAATTCCATTGATTTGACTCATATCTTTATTTCCCATAAAAAGTTAGAAACCATCTCTTCAGCGCTTTGTGACCATTGGGATACCTTGCGCAATGCACTTTACGAAAGACGGATTTCTGAACTCACTGGCAAAATAACAAAAAGTGCCAAAGAAAAAGTTCAAAGGTCATTAAAACATGAGGATATAAATCTCCAAGAAATTATTTCTGCTGCAGGAAAAGAACTATCAGAAGCATTCAAACAAAAAACAAGTGAAATTCTTTCCCATGCCCATGCTGCACTTGACCAGCCTCTTCCCACAACATTAAAAAAACAGGAAGAAAAAGAAATCCTCAAATCACAGCTCGATTCGCTTTTAGGCCTTTATCATCTTCTTGATTGGTTTGCTGTCGATGAAAGCAATGAAGTCGACCCAGAATTCTCAGCACGGCTGACAGGCATTAAACTAGAAATGGAACCAAGCCTTTCGTTTTATAATAAAGCAAGAAATTATGCGACAAAAAAGCCCTATTCGGTGGAAAAATTTAAATTGAATTTTCAAATGCCAACCCTTGCCTCTGGTTGGGATGTCAATAAAGAAAAAAATAATGGAGCTATTTTATTCGTAAAAAATGGTCTCTATTACCTTGGTATCATGCCTAAACAGAAGGGGCGCTATAAAGCCCTGTCTTTTGAGCCGACAGAAAAAACATCAGAAGGATTCGATAAGATGTACTATGACTACTTCCCAGATGCCGCAAAAATGATTCCTAAGTGTTCCACTCAGCTAAAGGCTGTAACCGCTCATTTTCAAACTCATACCACCCCCATTCTTCTCTCAAATAATTTCATTGAACCTCTTGAAATCACAAAAGAAATTTATGACCTGAACAATCCTGAAAAGGAGCCTAAAAAGTTTCAAACGGCTTATGCAAAGAAGACAGGCGATCAAAAAGGCTATAGAGAAGCGCTTTGCAAATGGATTGACTTTACGCGGGATTTTCTCTCTAAATATACGAAAACAACTTCAATCGATTTATCTTCACTCCGCCCTTCTTCGCAATATAAAGATTTAGGGGAATATTACGCCGAACTGAATCCGCTTCTCTATCATATCTCCTTCCAACGAATTGCTGAAAAGGAAATCATGGATGCTGTAGAAACGGGAAAATTGTATCTGTTCCAAATCTACAATAAGGATTTTGCGAAGGGCCATCACGGGAAACCAAATCTCCACACCCTGTATTGGACAGGTCTCTTCAGTCCTGAAAACCTTGCGAAAACCAGCATCAAACTTAATGGTCAAGCAGAATTGTTCTATCGACCTAAAAGCCGCATGAAGCGGATGGCCCATCGTCTTGGGGAAAAAATGCTGAACAAAAAACTAAAGGACCAGAAGACACCGATTCCAGATACCCTCTACCAAGAACTGTACGATTATGTCAACCACCGGCTAAGCCATGATCTTTCCGATGAAGCAAGGGCCCTGCTTCCAAATGTTATCACCAAAGAAGTCTCCCATGAAATTATAAAGGATCGGCGGTTTACTTCCGATAAATTTTTCTTCCATGTTCCCATTACACTGAATTATCAAGCAGCCAATAGTCCCAGTAAATTCAACCAGCGTGTCAATGCCTACCTTAAGGAGCATCCGGAAACGCCCATCATTGGTATCGATCGTGGAGAACGCAATCTAATCTATATTACCGTCATTGACAGTACTGGGAAAATTTTGGAGCAGCGTTCCCTGAATACCATCCAGCAATTTGACTACCAAAAAAAATTGGACAACAGGGAAAAAGAGCGTGTTGCCGCCCGTCAAGCCTGGTCCGTCGTCGGAACGATCAAAGACCTTAAACAAGGCTACTTGTCACAGGTCATCCATGAAATTGTAGACCTGATGATTCATTACCAAGCTGTTGTCGTCCTTGAAAACCTCAACTTCGGATTTAAATCAAAACGGACAGGCATTGCCGAAAAAGCAGTCTACCAACAATTTGAAAAGATGCTAATAGATAAACTCAACTGTTTGGTTCTCAAAGATTATCCTGCTGAGAAAGTGGGAGGCGTCTTAAACCCGTATCAACTTACAGATCAGTTCACGAGCTTTGCAAAAATGGGCACGCAAAGCGGCTTCCTTTTCTATGTACCGGCCCCTTATACCTCAAAGATTGATCCCCTGACTGGTTTTGTCGATCCCTTTGTATGGAAGACCATTAAAAATCATGAAAGTCGGAAGCATTTCCTAGAAGGATTTGATTTCCTGCATTATGATGTCAAAACAGGTGATTTTATCCTCCATTTTAAAATGAATCGGAATCTCTCTTTCCAGAGAGGGCTTCCTGGCTTCATGCCAGCTTGGGATATTGTTTTCGAAAAGAATGAAACCCAATTTGATGCAAAAGGGACGCCCTTCATTGCAGGAAAACGAATTGTTCCTGTAATCGAAAATCATCGTTTTACGGGTCGTTACAGAGACCTCTATCCCGCTAATGAACTCATTGCCCTTCTGGAAGAAAAAGGCATTGTCTTTAGAGACGGAAGTAATATATTACCCAAACTTTTAGAAAATGATGATTCTCATGCAATTGATACGATGGTCGCCTTGATTCGCAGTGTACTCCAAATGAGAAACAGCAATGCCGCAACGGGGGAAGACTACATCAACTCTCCCGTTAGGGATCTGAACGGGGTGTGTTTCGACAGTCGATTCCAAAATCCAGAATGGCCAATGGATGCGGATGCCAACGGAGCTTATCATATTGCCTTAAAAGGGCAGCTTCTTCTGAACCACCTCAAAGAAAGCAAAGATCTGAAATTACAAAACGGCATCAGCAACCAAGATTGGCTGGCCTACATTCAGGAACTGAGAAACTGA

      A-Y sequence:

      GGGGCTGCAATTCTCCATGTGGCTGACCATGTCTTCCTGCCCCAGCTGGCCCGACCTGGTGTCCCCAAGGTCTGCATCCTGATCACAGACGGGAAGTCCCAGGACCTGGTGGACACAGCTGCCCAAAGGCTGAAGGGGCAGGGGGTCAAGCTATTTGCTGTGGGGATCAAGAATGCTGACCCTGAGGAGCTGAAGCGAGTTGCCTCACAGCCCACCAGTGACTTCTTCTTCTTCGTCAATGACTTCAGCATCTTGAGGACACTACTGCCCCTCGTTTCCCGGAGAGTGTGCACGACTGCTGGTGGCGTGCCTGTGACCCGACCTCCGGATGACTCGACCTCTGCTCCACG

      A-T sequence:

      GGGGCTGCAATTCTCCATGTGGCTGACCATGTCTTCCTGCCCCAGCTGGCCCGACCTGGTGTCCCCAAGGTCTGCATCCTGATCACAGACGGGAAGTCCCAGGACCTGGTGGACACAGCTGCCCAAAGGCTGAAGGGGCAGGGGGTCAAGCTATTTGCTGTGAGGATCAAGAATGCTGACCCTGAGGAGCTGAAGCGAGTTGCCTCACAGCCCACCAGTGACTTCTTCTTCTTCGTCAATGACTTCAGCATCTTGAGGACACTACTGCCCCTCGTTTCCCGGAGAGTGTGCACGACTGCTGGTGGCGTGCCTGTGACCCGACCTCCGGATGACTCGACCTCTGCTCCACG

      B-Y sequence:

      CTTGCTGGCCCTGCAGGACCCCAAGGACCTTCTGGCCTGAAGGGGGAGCCTGGAGAGACAGGACCTCCAGGACGGGGCCTGACTGGACCTACTGGAGCTGTGGGACTTCCTGGACCCCCCGGCCCTTCAGGCCTTGTGGGTCCACAGGGGTCTCCAGGTTTGCCTGGACAAGTGGGGGAGACAGGGAAGCCGGGAGCCCCAGGTCGAGATGGTGCCAGTGGAAAAGATGGAGACAGAGGGAGCCCTGGTGTGCCAGGGTCACCAGGTCTGCCTGGCCCTGTCGGACCTAAAGGAGAAC

      B-T sequence:

      CTTGCTGGCCCTGCAGGACCCCAAGGACCTTCTGGCCTGAAGGGGGAGCCTGGAGAGACAGGACCTCCAGGACGGGGCCTGACTGGACCTACTGGAGCTGTGGGACTTCCTGGACCCCCCGGCCCTTCAGGCCTTGTGGGTCCACAGGGGTCTCCAGGTTTGCCTGGATAAGTGGGGGAGACAGGGAAGCCGGGAGCCCCAGGTCGAGATGGTGCCAGTGGAAAAGATGGAGACAGAGGGAGCCCTGGTGTGCCAGGGTCACCAGGTCTGCCTGGCCCTGTCGGACCTAAAGGAGAAC

      The primer sequence is as follows:

      Table 2. PCR Primer information

      Gene	Primer Name	Sequence (5’-3’)	Amplicon size
      ASCpf1	PCR-ASCpf1-F	AGCAAATGGGTCGCGGATCCATGACTCAGTTCGAA	3936 bp
      	PCR-AsCpf1-R	TGTCGACGGAGCTCGAATTCTTAGTTACGCAGTTC
      c .520G	PCR-c .520G-F	CAAATGGGTCGCGGATCCGGGGCTGCAATTCTCCA	362 bp
      	PCR-c .520G-R	CTTGTCGACGGAGCTCGAATTCCGTGGAGCAGAGG
      c .520G>A	PCR-c .520G>A-F	AAATGGGTCGCGGATCCGGGGCTGCAATTCTCCAT	362 bp
      	PCR-c .520G>A-R	TGTCGACGGAGCTCGAATTCCGTGGAGCAGAGGTC
      c.6745C	PCR-c.6745C-F	GCAAATGGGTCGCGGATCCCTTGCTGGCCCTGCAG	310 bp
      	PCR-c.6745C-R	CTTGTCGACGGAGCTCGAATTCGTTCTCCTTTAGG
      c.6745C>T	PCR-c.6745C>T-F	AAATGGGTCGCGGATCCCTTGCTGGCCCTGCAGGA	310 bp
      	PCR-c.6745C>T-R	GCTTGTCGACGGAGCTCGAATTCGTTCTCCTTTAG

   3. Inoculation of bacterial culture

      Add 3 mL of LB liquid culture medium and 3 μL of 50 mg/ mL Kana resistance solution to a sterile test tube, mix well, and inoculum 3 μL of TOP10 bacterial liquid containing pET28a plasmid. Then, incubate the inoculation liquid in a 37 ℃ shaker at 220 rpm for 12-16 hours.

Date: July, 2025

1. Experimental Contents
   1. Plasmid extraction

      Step 1: Scientists took 3 mL of the fifteen-hour cultured bacterial liquid and added it to a centrifuge tube. Then, it is centrifuged at 10,000 rpm (11,500×g) for 1 minute. The culture medium was then discarded as much as possible.

      Step 2: Scientists then added 250 μL of Buffer P1that contains RNase A, to the centrifuge tube with the bacterial pellet, and mixed well with a vortex oscillator. This process resuspended the bacteria.

      Step 3: Then, 250 μL of Buffer P2 is added to the centrifuge tube and is mixed with gentle inversion 8-10 times to lyse the bacteria fully.

      Step 4: Then, 350 μL of Buffer P3 is added to the centrifuge tube, and is mixed with gentle inversion 8-10 times to neutralize Buffer P2 thoroughly. At this point, there should be white flocculent precipitation. The tube is then centrifuged at 12,000 rpm (13,400×g) for 10 minutes.

      Step 5: Then, Scientists place the FastPure DNA Mini Columns in a 2 mL collection tube. The supernatant from the previous step is then transferred to the adsorption column with a pipette, and later centrifuged at 12,000 rpm (13,400×g) for 45 seconds. The waste liquid in the collection tube is then discarded. This process is meant for column loading and plasmid binding.

      Step 6: Scientists then added 500 μL of Buffer PW1 to the adsorption column, which was centrifuged at 12,000 rpm (13,400×g) for 45 seconds. The waste liquid is then discarded. This process is to wash off the protein.

      Step 7: 600 μL of Buffer PW2 diluted with anhydrous ethanol is then added to the adsorption column. Centrifuged at 12,000 rpm (13,400×g) for 45 seconds. The waste liquid is then discarded.

      Step 8: The process above is repeated twice, washing off the salt ions.

      Step 9: The adsorption column is then placed back in the collection tube and centrifuged at 12,000 rpm (13,400×g) for 1 minute to dry the adsorption column, removing the rest of the washing solution in the adsorption column.

      Step 10: The adsorption column is then placed in a new sterile 1.5 mL centrifuge tube. Then, 100 μL of Elution Buffer is added to the center of the membrane of the adsorption column. The column is then placed at room temperature for 2 minutes, and centrifuged at 12,000 rpm (13,400×g) for 1 minute to elute the DNA. This process washes off the protein.

      Step 11: The adsorption column is then discarded, and the DNA product is stored at -20℃ to prevent DNA degradation.

   2. Concentration testing using Nanodrop

      The concentrations of the plasmid samples were measured using Nanodrop.

   3. Linearization of the pET-28a plasmid

      Objective:

      Digest 1 μL of pET-28a plasmid using the restriction endonucleases EcoRI and BamHI.

      Setup:

      A total of three groups were prepared, with each group containing two reaction systems (six systems in total). Each reaction system had a final volume of 50 μL, consisting of the following components:

      • 10 μL of pET-28a plasmid
      • 1 μL of EcoRI
      • 1 μL of BamHI
      • 5 μL of CUM Smart Buffer
      • 33 μL of ddH₂O (double-distilled water)

      Procedure:

      The reaction mixtures were incubated at 37 ℃ for 10 minutes to complete the digestion and linearize the plasmid.

   4. Preparation of Agarose Gel

      Materials:

      1×TAE buffer, agarose powder.

      Equipment:

      Gel casting tray, gel comb, electronic balance, graduated cylinder, Erlenmeyer flask, micropipette Procedure:

      1. Calculation:

         For this experiment, a small gel casting tray is used, requiring 30 mL of TAE buffer and 0.45 g of agarose powder.

      2. Measurement:

         Weigh approximately 0.45 g of agarose powder using an electronic balance. Measure 30 mL of TAE buffer using a graduated cylinder and micropipette.

      3. Mixing:

         Add the agarose powder and TAE buffer into an appropriately sized Erlenmeyer flask. Gently swirl the flask until the agarose powder partially dissolves. Then, place the flask in a heating device (microwave) and heat until all agarose particles are completely dissolved. After heating, the solution should appear clear.

      4. Staining:

         Add 2 µL of nucleic acid stain to the solution and gently swirl until the solution shows a light pink color.

      5. Gel Casting:

         Slowly pour the prepared solution (agarose solution with nucleic acid stain) into the gel casting tray to avoid bubble formation, which can interfere with observation. Let the solution sit undisturbed until it solidifies into a gel.

   5. Agarose gel electrophoresis

      Agarose gel electrophoresis was used to analyze PCR products and restriction enzyme digestion products. Scientists first inserted 5 μL of each product into designated columns in order as follows.

      M: DNA Marker

      M A-Y A-Y A-Y N M A-T A-T A-T N M

      M B-Y B-Y B-Y N M B-T B-T B-T N M

      M AsCpf1 AsCpf1 AsCpf1 N M

   6. Purify PCR product and plasmid enzyme-digested product using Vazyme Gel DNA Extraction Mini kit

      Process:

      1. Transfer 50 μL enzyme-digested product and 100 μL PCR product into two different adsorption columns respectively, and then 12,000 rpm (13,800 ×g) centrifuge 40 seconds. DNA is adsorbed on the membrane of the adsorption column.
      2. Discard the filtrate and place the adsorption column in the collection tube. Add 300 μL of Buffer GDP to the adsorption column. Let it stand for 1 minute, and then 12,000 rpm (13,800 ×g) centrifuge for 40 seconds.
      3. Discard the filtrate and place the adsorption column in the collection tube. Add 700 μL Buffer GW (anhydrous ethanol has been added) to the adsorption column. Cover the lid, invert the collection tube 3 times to help thoroughly rinse off the salt adhering to the pipe wall, and then 12,000 rpm (13,800 ×g) centrifuge 40 seconds.
      4. Repeat step 3 to make sure the salt is completely removed.
      5. Discard the filtrate and place the adsorption column in the collection tube. 12,000 rpm (13,800 ×g) centrifuge for 2 minutes.
      6. Place the adsorption column in 1.5 mL sterilized centrifuge tubes. Add 30 μL ddH₂O into the middle of the adsorption column, place it for 2 minutes, and then 12,000 rpm (13,800 ×g) centrifuge 1 minute. Discard the adsorption column, detect the concentration of the products, and store the DNA at -20℃.
   7. Homologous Recombination-based Ligation

      Goal:

      Ligation of the linearized pET28a fragment and the gene fragment

      Procedure:

      Using the Vazyme C115 Clon Express Ultra One Step Cloning kit to achieve homologous recombination ligation.

      Calculation of 0.03pmol of Linearized vector pET-28a（5353bp):

      0.02×5353=106.5ng

      The volume of the linearized vector (10 µg/µL) to be added should be:

      106.5÷10≈10µL

      Calculation of insert fragments：

      AsCpf1: n=0.04×bp=0.04×3936=157.44ng

      v=n/c=157.44/180≈1µL

      A-Y：n=0.04×362=14.48µg

      v=n/c=14.48≈1µL

      A-T：n=0.04×362=14.48µg

      v=n/c=14.48≈1µL

      B-Y：n=0.04×310=12.4µg

      v=n/c=12.4/77.15≈1µL

      B-T：n=0.04×310=12.4µg

      v=n/c=12.4/79.05≈1µL

      1µL of each of the five recombinant products.

      Table 3. Homologous recombination ligation system

      Component	×1 (Total 10µL)	Amount Added (µL)
      2×Clon Express mix	5µL	5
      Linearized vector pET28a	0.03pmol=0.02×bp(µg)	4
      Insert fragments	0.006pmol=0.04×bp(ng)	1
      ddH2O	adjust the volume to 10µL	0

      Heat the 10 µL recombinant product at 50 ℃ for 20 min (to bind the insert fragments onto pET-28a).

      Then, AsCpf1, A-Y, A-T, B-Y, and B-T fragments were ligated into the linearized pET28a vector, respectively, forming new recombinant circular plasmids pET28a-AsCpf1, pET28a-A-Y, pET28a-A-T, pET28a-B-Y, and pET28a-B-T.

   8. Pouring LB Plates

      After the LB solid culture medium has cooled to approximately 60 ℃, add 200 µL of 50 mg/ mL Kana stock solution into 200 mL of LB solid culture medium, mix well, and pour into sterile plates until the surface is fully covered. A total of 12 plates were poured.

   9. Heat-Shock Transformation

      Goal：

      Insert the recombinant plasmid pET28a-AsCpf1 into BL21 cells to express the target protein.

      Insert the recombinant plasmids pET28a-AsCpf1, pET28a-A-Y, pET28a-A-T, pET28a-B-Y, and pET28a-B-T into DH5α cells to clone more DNA.

      1. Take 10 µL of the AsCpf1 recombinant product and add it to 100 µL of DH5α competent cells; then take another 10 µL of the AsCpf1 recombinant product and add it to 100 µL of BL21 competent cells.
      2. Incubate on ice for 30 min.
      3. Perform heat shock in a 42 ℃ water bath for 45 sec.
      4. Place on ice for 1 min.
      5. Add 900 µL of LB medium.
      6. Spread the cultures onto plates—distribute the two 100 µL bacterial suspensions onto 2 plates each using the spread plate method.
      7. Incubate the cultures at 37 ℃ for 12–16 h.
2. Results
   1. Concentration testing using Nanodrop

      Gene AsCpf1 has a concentration of 19.6 ng/μL. plasmid pET-28a has a concentration of 5.8 ng/μL.

      The concentrations of the plasmid samples were measured. to be 36.2 ng/μL, 37.0 ng/μL, 66.8 ng/μL, 69.5 ng/μL, 32.6 ng/μL, and 36.2 ng/μL, respectively.

   2. Gene amplification electrophoresis results

      AsCpf1 gene amplification electrophoresis results:

      

      In the electrophoresis gel, a distinct band around 3936 bp was observed, indicating the successful amplification of the AsCpf1 gene.

      A-Y gene amplification electrophoresis results:

      

      A distinct band around 362 bp was observed, indicating the successful amplification of the A-Y gene.

      A-T gene amplification electrophoresis results:

      

      A distinct band around 362 bp was observed, indicating the successful amplification of the A-T gene.

      B-Y gene amplification electrophoresis results:

      

      A distinct band around 310 bp was observed, indicating the successful amplification of the B-Y gene.

      B-T gene amplification electrophoresis results:

      

      A distinct band around 310 bp was observed, indicating the successful amplification of the B-T gene.

   3. Plasmid linearization results

      

      The recombinant pET28a-AsCpf1, pET28a-A-Y, pET28a-A-T, pET28a-B-Y, and pET28a-B-T plasmids, along with the linearized pET-28a fragment, and the AsCpf1, A-Y, A-T, B-Y, and B-T genes were electrophoresed on the same agarose gel. From the electrophoresis results, it is evident that the pET-28a vector was successfully linearized. And all genes were successfully amplified.

Date: July, 2025

Goal:

1. Observe the growth of bacteria on the transformation plates
2. Verify whether the bacteria strain contains the target plasmid
3. Inoculation the bacterial solution
4. Preparation of agarose gel
5. Analysis of colony identification results by agarose gel electrophoresis
6. Prepare LB medium
7. Prepare 200 mL of glycerol with a concentration of 40% (Prevent bacteria from being pierced and killed by ice during refrigeration.)
8. Prepare 5 mL Kana⁺ at a concentration of 50 mg / mL (Make the required plasmid purer)
9. Picking bacteria and Shaking bacteria. (Obtain single colonies and expand culture)

1. Experimental Contents
   1. Observe bacterial culture plates

      Observe the growth of bacteria on the transformation plates and take photos to record them.

   2. Monoclonal PCR

      Use a sterilized 10 μL pipette to pick a single colony and transfer it onto the wall of the PCR tube as the DNA template. Pick four A-T, A-Y, B-T, and B-Y genes and six AsCpf1-DH5α and AsCpf1-BL21 genes. Mix with a vortex mixer, then centrifuge with a centrifuge. Make eight PCRs according to the formula of 12.5 μL 2×Taq Master Mix, 1 μL forward primer, 1 μL reverse primer, 10.5 μL double-distilled water, and DNA template. Heat them at a temperature of 95 degrees Celsius for 3 min and 95 degrees Celsius for 30 s, 56 degrees Celsius for 30 s, 72 degrees Celsius for 4 min, these three steps repeat for 35 times as a cycle, and then 72 degrees Celsius for 5 min and 12 degrees Celsius in an infinite loop.

   3. Single colony culture

      Use the same pipette tip used to pick up the single colony on the plate into 3 mL of LB liquid culture medium (kana, 50 mg/L) and make the same mark as the PCR tube. Place the inoculated tube in a 37℃ shaker for 12-16 hours (220 rpm).

   4. Preparation of agarose gel

      Add agarose and TAE buffer to the flask and mix well. Boil in a microwave oven and add dye. Mix well to avoid bubbles. Pour into the gelatin plate with the plate and insert the comb.

      Table 4. Agarose gel formulation

      	small gel	medium gel	big gel
      agarose	0.45g	075g	1.5g
      TAE buffer	30mL	50mL	100mL
      dye	2μL	4μL	8μL

   5. PCR gel electrophoresis

      To identify whether there is the target gene in the bacteria (containing inserted fragments), agarose gel electrophoresis is used to analyze the results of colony identification. For A and B, first add Marker, then add wild type, Marker after, then mutant type, finally Marker. Put the gel into the electrophoresis apparatus for electrophoresis for around 15 min. After it's over, get the imaging system to observe the results.

   6. Preparation of culture medium

      For inoculating the bacterial solution, cultivate a large number of pET-28a-AsCpf1-BL21 bacteria. To prepare 200 mL LB liquid medium, it is required 200 mL dd H₂O, 2 g tryptone, 2.5 g yeast extract, 2 g NaCl. After preparation, displace the liquid into the place at 121 ℃ for 15-20 min (sterilization).

   7. Prepare 40% glycerol

      Prepare 200 mL of glycerin with a concentration of 40%: 80 mL glycerol plus 120 mL of ddH₂O, then high-temperature and high-pressure sterilization (121 ℃, 20 min).

   8. Prepare Kana⁺

      Prepare Kana⁺ at a concentration of 50 mg /mL: Each group prepares 5 mL kanamycin sulfate solution, and the concentration should be 50 mg/mL, so each group weighs 250 mg of kanamycin sulfate. Add 250 mg kanamycin sulfate powder into 5 mL ddH₂O. When the powder is dissolved in 5 mL, mix it by vortex, then use a syringe and a 0.22 micrometer filter membrane to filter for sterilization, and collect the filtrate. Make proper marks for subsequent use. (Added into LB medium)

   9. Picking and shaking bacteria:

      Inoculating bacterial liquid. Use the same pipette tip used for picking bacteria in the plate medium to pipette into 3 mL of LB liquid medium (Kana⁺, 50 mg/L), and mark it with the same mark as the corresponding PCR tube. Incubate the inoculated test tube on a shaker at 37 ℃ for 12–16 h (220 rpm). pET-28a-AsCpf1-BL21, 4 tubes (For protein expression). pET-28a-AsCpf1-DH5α 2 tubes each (For preservation and plasmid extraction). pET-28a-A-Y-DH5α, pET-28a-A-T-DH5α, 2 tubes each (For preservation and plasmid extraction). pET-28a-B-Y-DH5α, pET-28a-B-T-DH5α (For preservation and plasmid extraction). Pick 2 tubes of AsCpf1 - BL21 bacteria for each group.

2. Results

   Bacteria grow well on transformation plates, with single colonies appearing. All recombinant plasmids were successfully transformed.

Date: July, 2025

1. Experimental Contents
   1. Observation of the growth of the bacterial cultures
   2. Bacterial culture preservation

      500 µL of bacterial culture and 500 µL of 40% glycerol are added to a sterile centrifuge tube, mixed thoroughly, and stored at −80 ℃. Two tubes of each pET28a-AsCpf1, pET28a-A-Y, pET28a-A-T, pET28a-B-Y, and pET28a-B-T. Four tubes of AsCpf1-DH52 and AsCpf1-BL21.

   3. Extraction of recombinant plasmids

      The aim was to extract plasmid DNA from E. coli: pET28a-AsCpf1, pET28a-A-Y, pET28a-A-T, pET28a-B-Y, and pET28a-B-T. The following process was repeated for all five groups.

      Step 1: 3 mL of the 12-hour cultured bacterial liquid was added to a centrifuge tube. The sample was centrifuged at 10,000 rpm (11,500 ×g) for 1 minute. The culture medium was then discarded as much as possible.

      Step 2: 250 μL of Buffer P1 (containing RNase A) was added to the centrifuge tube containing the bacterial pellet, and mixed well using a vortex mixer. This step resuspended the bacteria.

      Step 3: 250 μL of Buffer P2 was added to the centrifuge tube and mixed gently by inverting the tube 8–10 times to fully lyse the bacteria.

      Step 4: 350 μL of Buffer P3 was added to the centrifuge tube and gently inverted 8–10 times to neutralize Buffer P2. White flocculent precipitation should appear. The tube was then centrifuged at 12,000 rpm (13,400 ×g) for 10 minutes.

      Step 5: The supernatant from the previous step was transferred to a FastPure DNA Mini Column placed in a 2 ml collection tube. The column was centrifuged at 12,000 rpm (13,400 ×g) for 45 seconds. The waste liquid in the collection tube was discarded. This step is for column loading and plasmid binding.

      Step 6: 500 μL of Buffer PW1 was added to the adsorption column, and the column was centrifuged at 12,000 rpm (13,400 ×g) for 45 seconds. The waste liquid was discarded. This step washes off proteins.

      Step 7: 600 μL of Buffer PW2 (diluted with anhydrous ethanol) was added to the adsorption column, and the column was centrifuged at 12,000 rpm (13,400 ×g) for 45 seconds. The waste liquid was discarded.

      Step 8: The washing process from Step 7 was repeated twice to wash off salt ions.

      Step 9: The adsorption column was placed back in the collection tube and centrifuged at 12,000 rpm (13,400 ×g) for 1 minute to dry the column, removing any remaining washing solution.

      Step 10: The adsorption column was placed in a new sterile 1.5 ml centrifuge tube. 40 μL of Elution Buffer was added to the center of the membrane in the adsorption column. The column was left at room temperature for 2 minutes and then centrifuged at 12,000 rpm (13,400 ×g) for 1 minute to elute the plasmid DNA.

      Step 11: The adsorption column was discarded, and the extracted plasmid DNA was stored at -20 ℃ to prevent degradation.

      This process successfully extracted plasmid DNA for further analysis and experiments.

   4. Preparation of LB Liquid Medium

      Objective:

      To provide competent cells with an optimal growth environment and the necessary nutrients.

      Step 1: Eight tubes of 20 mL LB liquid medium (containing 50 mg/L kanamycin) were prepared.

      Step 2: Using the formula n = c × v and c₁·v₁ = c₂·v₂, the required volume of kanamycin stock solution was calculated: v1=(c2*v2)/c1=(50 mg/L*20*10^-3 L)/50 mg/L=20 µL.

      Step 3: 20 µL of 50 mg/L kanamycin stock solution was added to each 20 mL LB liquid medium tube.

   5. Preparation of LB Liquid Medium

      Objective:

      Culture the BL21 strain containing pET-AsCpf1 at 37 ℃.

      Step 1: Inoculate each 20 mL LB culture tube with 1 mL of the overnight culture containing pET-AsCpf1 at a 5% inoculation rate (prepared in Experiment 4, containing 50 mg/L kanamycin).

      Step 2: Incubate the culture at 37 ℃ with shaking at 220 rpm to promote bacterial growth and amplification.

   6. Monitor bacterial growth by measuring OD₆₀₀ values.

      This experiment aimed to monitor bacterial growth by regularly measuring the OD600 value of the culture using a microplate reader until it reached 0.6, indicating the log phase of growth. The procedure began with inoculation. 200 µL of bacterial suspension was transferred from the inoculation tube into a clear microplate well (LB medium) using a pipette. The mixture was thoroughly mixed and labeled as the experimental group (“CK”). The first OD600 measurement was taken immediately after inoculation. Subsequent measurements were taken at 30 minutes, 1 hour, 1.5 hours, 2 hours, 2.5 hours, and 3 hours after inoculation. Before each sampling, the culture was mixed to ensure uniformity. Once the OD600 value reached or exceeded 0.6, measurements were stopped, and the final data was recorded. Throughout the experiment, the culture was continuously shaken on a shaker, and all procedures were performed under aseptic conditions to avoid contamination.

   7. Protein expression induced by different IPTG concentrations at 37 ℃

      This experiment aimed to induce high-level protein expression at 37 ℃ using various IPTG concentrations.

      Six IPTG concentrations were used: 0 mM, 0.2 mM, 0.5 mM, 0.8 mM, 1 mM, and 2 mM, corresponding to sample IDs 37-1 through 37-6.

      The required volume of IPTG was calculated using the dilution formula: n=C1×V1=C2×V2.

      For example, for sample 37-2, which required a final IPTG concentration of 0.2 mM in 20 mL (V1 = 20 × 10³ µL, C1 = 0.2 mM), and with the IPTG stock concentration at 0.5 M (C2 = 0.5 × 10³ mM), the calculated volume (V2) was: V2 = (0.2×20×10³)/(0.5×10³) = 8 µL. Thus, 8 µL of IPTG was added to the 20 mL culture.

      All samples were then incubated at 37 ℃ with shaking at 220 rpm for 3 hours.

   8. Protein Expression Induced by Different IPTG Concentrations at 16 ℃

      This experiment also aimed to induce high-level protein expression, but at a lower temperature (16 ℃).

      Six IPTG concentrations were used: 0 mM, 0.2 mM, 0.5 mM, 0.8 mM, 1 mM, and 2 mM, corresponding to sample IDs 16-1 through 16-6.

      As in Experiment 7, IPTG volumes were calculated using the formula: n=C1×V1=C2×V2. For instance, for sample 16-2, which required a final IPTG concentration of 0.2 mM in 20 mL, and a stock solution of 0.5 M: V2 = (0.2×20×10³)/(0.5×10³) = 8 µL. Therefore, 8 µL of IPTG was added.

      The cultures were incubated at 16 ℃ with shaking at 220 rpm for 20 hours.

2. Results
   1. Monoclonal PCR validation results

      

      All the electrophoresis results showed bands corresponding to the expected size of the inserted fragments, indicating successful construction and transformation of the recombinant plasmid. The monoclonal PCR validation results demonstrated that the amplified AsCpf1 gene fragment was successfully inserted into the pET-28a vector. PCR analysis confirmed the presence of multiple positive clones, which were further verified through sequencing to ensure the accuracy of the recombinant plasmids. The results indicate that the target gene was successfully cloned and lays a foundation for subsequent protein expression. Meanwhile, the electrophoresis results also confirmed the successful construction of the A-Y, A-T, B-Y, and B-T gene-related recombinant plasmids, which are now available for further analysis.

   2. Results of bacterial OD600 measurement

      Table 5. Bacterial OD6₀₀ measurement results

      		0 h	0.5 h	1 h	1.5 h	2 h	2.5 h	3 h
      Group 37 ℃	OD600 Value	0.248	0. 254	0.293	0.364	0.472	0.606	-
      Group 16 ℃	OD600 Value	0.189	0.238	0.276	0.336	0.445	0.550	0.586

      IPTG induction was performed after the OD₆₀₀ value of the culture reached 0.6.

Date: July, 2025

1. Experimental Contents
   1. Collect bacterial sedimentation

      Centrifuge at 4 ℃, 5000 rpm for 15 min, and discard the upper culture medium.

   2. Large-scale purification of His-tag protein (AsCpf1)
   1. Bacterial lysis
   1. Add 5 mL of 1×PBS buffer to the bacterial sedimentation and fully resuspend the bacteria.
   2. Add 40 μL of lysozyme to a final concentration of 1 mg/ mL, mix well, and place on ice for 10 min.
   3. Sonicate the bacteria on ice. Set the sonication power to 50%, turn on for 3 s and turn off for 3 s, and process for 5 min.
   4. If the sonicated lysate is very viscous, repeatedly aspirate with a fine-needle syringe to shear the viscous genomic DNA. (optional)
   2. Collect bacterial lysate

      Centrifuge at 4 ℃, 5000 rpm for 10 min, collect the supernatant of the bacterial lysate, and place it on ice.

   3. Equilibrate protein purification resin:

      Take 1 mL of well-mixed 50% Beyogold His-tag Purification Resin, centrifuge at 4 ℃ (1000 ×g, 10 s), and discard the storage solution. Add 0.5 mL of non-denaturing lysis buffer to equilibrate the gel resin, centrifuge, discard the liquid, and equilibrate 1-2 more times, discarding the liquid each time.

   4. Purify the protein
   1. Mix 5 mL (all) of the bacterial lysate supernatant with the equilibrated Resin, and shake slowly at 4 ℃ for 60 min.
   2. Load the mixture of bacterial lysate and Resin into an empty affinity chromatography column.
   3. Open the cap at the bottom of the purification column, allow the liquid to flow out under gravity, and collect about 20 µL of the flow-through for analysis.
   4. Wash the column 5 times, adding 0.5-1 mL of non-denaturing washing buffer each time.
   5. Elute the target protein 6-10 times, using 0.5 mL of non-denaturing elution buffer each time.
   3. Preparation of SDS-PAGE 10% protein gel (1.00 mm thick) using SDS-PAGE Color Preparation kit
      1. Assemble the gel-making mold properly.
      2. Make a lower-layer gel by adding 2.7 mL of lower pre-mixed buffer reagents and SDS, and 55 μL improved coagulant into a glue mixing cup, stirring gently until evenly mixed and not generating bubbles.
      3. Add the lower-layer gel solution to the gel-making mold and keep the liquid level 1.5 cm away from the upper edge of the glass plate. Cover the solution with a layer of ethanol to keep the gel surface smooth and free of bubbles.
      4. Place it at room temperature for 8 minutes and wait for the gel to solidify.
      5. Make the upper layer gel by adding 1.5 mL lower pre-mixed buffer reagents and SDS, and 40 μL improved coagulant into a new glue mixing cup, stirring gently until evenly mixed and not generating bubbles.
      6. Add the upper layer gel solution to the gel-making mold above the lower layer gel until the gel solution reaches the top of the glass plate, then slowly insert the 1.00 mm thick comb into the gel and avoid air bubbles.
      7. Leave it for 15 minutes and wait for the upper gel to solidify. Gently remove the comb. Use a pipette or syringe to aspirate the electrophoresis buffer and rinse the sample wells clean.
   4. Prepare the protein loading solution

      Extract 16 μL purified protein under every concentration into a PCR tube alternatively, and add 4 μL 5× loading buffer into each tube. Boil at 100 ℃ for 10 minutes. After centrifugation, the supernatant is used for sample loading (Do not suck up the sediment).

      The different concentrations include:

      37 ℃: 0 mM, 0.2 mM, 0.5 mM, 0.8 mM, 1 mM, 2 mM

      16 ℃: 0 mM, 0.2 mM, 0.5 mM, 0.8 mM, 1 mM, 2 mM

   5. Prepare Tris-Glycine-SDS Buffer

      Prepare Tris-Glycine-SDS Buffer used for SDS-PAGE electrophoresis by adding a packet of Tris-Glycine-SDS Buffer powder into 1 L ddH₂O and mixing them evenly.

   6. SDS-PAGE Gel Electrophoresis
      1. Remove the SDS-PAGE gel from the gel casting plate.
      2. Place it into the inner chamber of the electrophoresis tank, with two gels facing each other and the shorter plates inward.
      3. Add SDS-PAGE electrophoresis buffer to the inner chamber.
      4. Slowly and vertically pull out the comb upward with both hands.
      5. Load samples into each well of the gel in the following order: Marker, 0 mM, 0.2 mM, 0.5 mM, 0.8 mM, 1 mM, and 2 mM. The used marker band range was 10–180 kDa, and the predicted size of the target protein is 151.65 kDa.
      6. Run the gel at 180 V for 40 minutes in the electrophoresis tank.
   7. SDS-PAGE Gel Staining
      1. Use a gel spatula to separate the gel from the sides of the casting plate, then carefully lift and remove the post-electrophoresis SDS-PAGE gel.
      2. Stain the gel overnight with Coomassie Brilliant Blue R-250 fast staining solution (due to the staining solution being too dilute) under gentle shaking.
   8. Destaining (Do it the next day.)

      Destain the gel slowly with pure water on a horizontal shaker.

   9. Observation of SDS-PAGE gel (Do it the next day.)

      Photograph the stained and destained SDS-PAGE gel on a white background and save the images.

2. Results

   SDS-PAGE gel was stained overnight, and the results were observed the next day.

Date: July, 2025

1. Experimental Contents
   1. Preparation of SDS-PAGE gels and SDS-PAGE gel electrophoresis

      The gel was damaged, so SDS-PAGE gel electrophoresis was performed again with purified protein.

      For detailed operating steps, refer to yesterday's instructions. The simplified operating steps are as follows:

   1. Preparation of SDS-PAGE gel.
   2. Preparation of protein loading solution.
   3. Preparation of Tris-glycine-SDS buffer.
   4. SDS-PAGE electrophoresis.
   5. Staining of SDS-PAGE gel.
   6. Decolorization of gel.
   7. Observe and save the results of the SDS-PAGE gel.
   2. Conduct an RPA experiment.

      The primers used for the RPA reaction are: RPA-1M-A-F/R, RPA-2M-A-F/R, RPA-3M-A-F/R, RPA-4M-A-F/R, RPA-1M-B-F/R, RPA-2M-B-F/R, RPA-3M-B-F/R, and RPA-4M-B-F/R. RPA primer information is listed in the table below.

      Table 6. RPA Primer information

      Gene	Primer Name	Sequence (5’-3’)	Amplicon size
      c .520G and c .520G>A	RPA-1M-c.520G>A-F	GACCTGGTGTCCCCAAGGTCTGCATCCTGA	215 bp
      	RPA-1M-c.520G>A-R	CAGTAGTGTCCTCAAGATGCTGAAGTCATTGA
      	RPA-2M-c.520G>A-F	GAAGGGGCAGGGGGTCAAGCTATTTGCTGTC	148 bp
      	RPA-2M-c.520G>A-R	GGAAACGAGGGGCAGTAGTGTCCTCAAGATG
      	RPA-3M-c.520G>A-F	GAAGGGGCAGGGGGTCAAGCTATTTGCTGAC	148 bp
      	RPA-3M-c.520G>A-R	GGAAACGAGGGGCAGTAGTGTCCTCAAGATG
      	RPA-4M-c.520G>A-F	GAAGGGGCAGGGGGTCAAGCTATTTGCTCAC	148 bp
      	RPA-4M-c.520G>A-R	GGAAACGAGGGGCAGTAGTGTCCTCAAGATG
      c.6745C and c.6745C>T	RPA-1M-c.6745C>T-F	CTGACTGGACCTACTGGAGCTGTGGGACTTC	164 bp
      	RPA-1M-c.6745C>T-R	CTCCCTCTGTCTCCATCTTTTCCACTGGCAC
      	RPA-2M-c.6745C>T-F	TTGTGGGTCCACAGGGGTCTCCAGGTTTGCCTGGC	113 bp
      	RPA-2M-c.6745C>T-R	AGGGCTCCCTCTGTCTCCATCTTTTCCACTG
      	RPA-3M-c.6745C>T-F	TTGTGGGTCCACAGGGGTCTCCAGGTTTGCCTGCT	113 bp
      	RPA-3M-c.6745C>T-R	AGGGCTCCCTCTGTCTCCATCTTTTCCACTG
      	RPA-4M-c.6745C>T-F	TTGTGGGTCCACAGGGGTCTCCAGGTTTGCCTCCT	113 bp
      	RPA-4M-c.6745C>T-R	AGGGCTCCCTCTGTCTCCATCTTTTCCACTG

      The RPA reaction tubes contain white powder, which is the recombinant enzyme associated with the RPA reaction. The total volume of the RPA reaction is 50 μL, consisting of 2.5 μL of upstream primer, 2.5 μL of downstream primer, 2 μL of activator (magnesium acetate), 20 μL of solvent, 21 μL of deionized water, and 2 μL of DNA template or deionized water (for the control group). It is important to note that 2 μL of magnesium acetate should be added to the tube caps.

      For both A and B groups, each primer pair corresponds to three amplification reactions, with templates being plasmids containing normal sequences, plasmids with mutated sequences, and a blank control, respectively. After adding all components into the RPA reaction tubes containing the powder, close the tube caps and mix thoroughly. After briefly centrifuging, the mixture was incubated at 42 ℃ for 20 minutes.

   3. Preparation of 3% agarose gel

      Prepare the mesoporous agarose gel according to the following formula: 1.5 grams of agarose, 50 milliliters of TAE buffer, and 5 microliters of staining solution. Add the TAE buffer and agarose to a conical flask and mix thoroughly. Heat the mixture in a microwave until the solution becomes clear and boils. Then, add the staining solution and mix well.

      Pour the mixture into a medium-sized gel casting tray and insert a medium-sized comb. Allow the gel to cool before use.

   4. Deactivating enzymes in RPA products

      Inactivate the enzyme in RPA products according to the formula of 10 µL RPA products and 2 µL loading buffer, heat it at 65 ℃ for 5 min to denature the enzyme, and keep it at 12 ℃ until used.

      RPA product agarose gel electrophoresis

   5. RPA product agarose gel electrophoresis

      Load the processed RPA product samples into the wells of the gel, add DNA markers to the first and last wells of the gel, and run electrophoresis at 80 V for 1 hour.

   6. Observation of electrophoresis results using a gel imaging system
2. Results
   1. SDS-PAGE gel electrophoresis results for 16 ℃ induced expression

      

      The electrophoresis results of the crude protein demonstrate clear overexpression of the target protein (The left picture). Additionally, the intensity of protein bands in both the crude and purified protein samples follows a consistent trend with changes in IPTG concentration. After purification, the impurities present in the crude protein are nearly completely removed, leaving only the target protein.

      The results of induction at 16 ℃ with different IPTG concentrations are shown in the figure above. Upon examining the electrophoresis gel, it was observed that the overall band intensity was relatively high. As the IPTG concentration increased, the band intensity first increased and then stabilized. Under 16 ℃ cultivation conditions, the sample induced with 0.8 mM IPTG exhibited the strongest electrophoresis band, indicating that 0.8 mM IPTG is the optimal expression condition for cultivation at 16 ℃.

   2. SDS-PAGE gel electrophoresis results for 37 ℃ induced expression

      

      The results of induction at 37 ℃ with different IPTG concentrations are shown in the figure above. Upon examining the electrophoresis gel, it was observed that the overall band intensity was weaker. As the IPTG concentration increased, the band intensity did not show significant changes. Under 37 ℃ cultivation conditions, the samples induced with 0.5 mM and 2 mM IPTG showed relatively stronger bands, indicating that 0.5 mM and 2 mM IPTG are the optimal expression conditions for cultivation at 37 ℃.

      Overall Conclusion

      Based on the results, induction at 16 ℃ with 0.8 mM IPTG was chosen as the optimal expression condition, as it provided the strongest expression bands, indicating a higher protein expression level.

   3. RPA product electrophoresis results for c.520G and c.520G>A

      

      Note: A: c.520G>A

      In the electrophoresis image above, it can be observed that when using four different pairs of RPA primers, the target bands corresponding to the c.520G and c.520G>A templates are visible in the lanes of the RPA products, while the blank control group shows no bands. This indicates that both the normal and mutated sequences were successfully amplified, and there is no aerosol contamination. When using the RPA-1M-c.520G>A-F/R and RPA-2M-c.520G>A-F/R primers, the band intensity is brighter, whereas the bands corresponding to the RPA-3M-c.520G>A-F/R and RPA-4M-c.520G>A-F/R primers are relatively weaker. This is due to the latter primers introducing more mismatched sites, which can somewhat affect the RPA amplification efficiency

   4. RPA product electrophoresis results for c.6745C and c.6745C>T

      

      Note: B: c.6745C>T

      The RPA amplification results for the c.6745C and c.6745C>T templates are similar to those for the c.520G and c.6745C>T templates. As seen in the electrophoresis image above, when using four different pairs of RPA primers, the RPA products corresponding to the c.6745C and c.6745C>T templates show target bands, while no bands are observed in the blank control group. This indicates that both the normal and mutated sequences were successfully amplified, and there is no aerosol contamination. When using the RPA-1M-c.6745C>T-F/R and RPA-2M-c.6745C>T-F/R primers, the band intensity is brighter, whereas the bands corresponding to the RPA-3M-c.6745C>T-F/R and RPA-4M-c.6745C>T-F/R primers are relatively weaker. This is due to the latter primers introducing more mismatched sites, which can somewhat affect the RPA amplification efficiency.

Date: July, 2025

1. Experimental Contents
   1. Screening of Effective RPA Primers by Cas12a cleavage reactions

      Objective:

      To screen RPA primers that can distinguish between normal and mutant sequences based on the fluorescence signal from Cas12a cleavage products. The selected primers will be used to construct a detection platform.

      Procedure:

   1. RPA Amplification

      Using different RPA primers, RPA amplification was carried out with c.520G, c.520G>A, c.6745C, and c.6745C>T sequences as templates. The amplification results were then validated.

      For detailed procedures, refer to yesterday's experiment.

   2. Cas12a Cleavage of RPA Products

      For each primer group, the corresponding RPA products for the c.520G and c.520G>A templates, as well as the c.6745C and c.6745C>T templates, were subjected to Cas12a cleavage reactions (with a fluorescence signal reporting probe FAM-ssDNA-BHQ1).

      In the Cas12a cleavage reaction system, for the c.520G and c.520G>A templates, crRNA-c.520G>A was used; for the c.6745C and c.6745C>T templates, crRNA-c.6745C>T was used.

      The 20 µL Cas12a cleavage reaction system includes:

      • 2 µL 10x Reaction Buffer
      • 0.67 µL 10 µM Cas12a protein
      • 0.4 µL 10 µM crRNA
      • 2 µL 10 µM ssDNA reporter
      • 2 µL RPA product
      • 0.25 µL RNase Inhibitor
      • 12.68 µL DEPC-treated water

      Each reaction was performed in triplicate.

      The reaction mixture was incubated at 40 ℃. For reactions with crRNA-c.520G>A, the reaction conditions were 40 ℃ for 5 minutes, followed by 85 ℃ inactivation for 10 minutes. For reactions with crRNA-c.6745C>T, the reaction conditions were 40 ℃ for 60 minutes, followed by 85 ℃ inactivation for 10 minutes. After cooling the reaction products to room temperature, the results were analyzed.

   3. Fluorescence Detection

      Objective:

      To observe the fluorescence results and screen RPA primers that can effectively distinguish between normal and mutant sequences.

      Procedure:

      1. Add 180 µL of ddH₂O to each Cas12a cleavage products.
      2. Transfer the entire 200 µL solution into the wells of a non-transparent 96-well enzyme reaction plate.
      3. Perform fluorescence measurement using a microplate reader.

      Excitation wavelength: 492 nm,

      Emission wavelength: 522 nm.

   2. Optimization of Reaction Time

      Objective:

      To optimize the Cas12a cleavage reaction time to enhance the performance of the detection platform.

      Procedure:

      Based on the results of the previous experiment, the selected primers, RPA-2M-c.520G>A-F/R and RPA-4M-c.6745C>T, will be used for the subsequent experiments.

      Use RPA primers to amplify normal sequences and mutant sequences, and set up blank control groups. For c.520G and c.520G>A, each RPA product is subjected to six replicate Cas12a cleavage reactions. Each group included normal sequences, mutant sequences, and blank controls. The same samples were subjected to different Cas12a cleavage reaction times, followed by an 85 ℃ enzyme inactivation step. The reaction times (at 42 ℃) were set as 0 min, 1 min, 2 min, 3 min, 4 min, and 5 min.

      For c.6745C and c.6745C>T, the real-time fluorescent reaction device was used to monitor the effect of enzyme cleavage time on detection performance. The reaction time was 60 min.

      This section of the investigation includes the following experiments:

      1. RPA amplification
      2. Protein degradation in RPA products
      3. Agarose gel electrophoresis of RPA products
      4. Cas12a cleavage of RPA products
      5. Fluorescent detection of diluted Cas12a cleavage products

      These experiments have been conducted before. For detailed steps, it can be referenced from previous experiments.

   3. Feasibility analysis of the detection platforms

      Objective:

      To investigate the feasibility of an optimized detection system for single-base mutations associated with dystrophic epidermolysis bullosa (DEB).

      Brief description:

      For the two mutation sites c.520G>A and c.6745C>T, RPA amplification, Cas12a cleavage reaction, fluorescence detection, and test strip analysis were performed on normal and mutant sequences under optimized conditions.

      Procedure:

      1. Fluorescence detection system
      1. RPA amplification
      2. Protein degradation in RPA products
      3. Agarose gel electrophoresis of RPA products
      4. Cas12a cleavage of RPA products
      5. Fluorescent detection of diluted Cas12a cleavage products

      These experiments have been conducted before. For detailed steps, it can be referenced from previous experiments.

      2. Test strip detection system
      1. RPA amplification
      2. Protein degradation in RPA products
      3. Agarose gel electrophoresis of RPA products
      4. Cas12a cleavage of RPA products

      For strip testing, FAM-ssDNA-Biotin was substituted for ssDNA in the Cas12a cleavage reaction, compared to the fluorescent detection method.

      5. Test strip analysis of Cas12a cleavage products

      5 μL of Cas12a cleavage products were placed on the sample pad of the test strip. The test strip was then placed in 70 μL of 1× PBS buffer (containing 0.01% Tween-20) for chromatography. The appearance of a T line was observed within 2 min to determine the result.

      These experiments have been conducted before. For detailed steps, it can be referenced from previous experiments.

   4. Gradient dilution of plasmids

      According to calculations, for pET-28a-c.520G>A and pET-28a-c.6745C>T, 10 ng of plasmid contains 10⁹ copies of the target sequence. First, obtain a plasmid sample containing 10⁹ copies/μL, then perform a 10-fold serial dilution to obtain 10⁹ copies/μL, 10⁸ copies/μL, 10⁷ copies/μL, 10⁶ copies/μL, 10⁵ copies/μL, 10⁴ copies/μL, 10³ copies/μL, 10² copies/μL, 10¹ copies/μL, and 10⁰ copies/μL of pET-28a-c.520G>A and pET-28a-c.6745C>T plasmid samples.

2. Results
   1. Cas12a cleavage fluorescence results of RPA products corresponding to different RPA primers for c.520G>A

      

      Based on the results from real-time fluorescence monitoring and endpoint fluorescence detection, for the c.520G>A mutation site, using the RPA-1M-c.520G>A-F/R primers, both normal and mutant sequences exhibited strong fluorescence signals. Although the signal from the mutant sequence was stronger than that of the normal sequence, there was no significant difference between them, indicating that this primer pair does not meet the detection requirements. When using RPA-2M-c.520G>A-F/R, the normal sequence showed almost no fluorescence signal, while the mutant sequence exhibited a strong fluorescence signal, effectively distinguishing between the mutant and normal sequences. Therefore, this primer can be used for the detection of the c.520G>A mutation associated with DEB. However, no fluorescence signal was observed when using RPA-3M-c.520G>A-F/R and RPA-4M-c.520G>A-F/R, suggesting that the excessive mismatches introduced by these primers prevented the crRNA from recognizing the target DNA sequence, thus failing to activate Cas12a cleavage activity.

      In conclusion, RPA-2M-c.520G>A-F/R primers were selected for the detection of the c.520G>A mutation site.

   2. Cas12a cleavage fluorescence results of RPA products corresponding to different RPA primers for c.6745C>T

      

      For the c.6745C>T mutation site, real-time fluorescence monitoring and endpoint fluorescence detection results showed that using the RPA-1M-c.6745C>T-F/R, RPA-2M-c.6745C>T-F/R, and RPA-3M-c.6745C>T-F/R primers, both normal and mutant sequences exhibited strong fluorescence signals. Although the signal from the mutant sequence was stronger than that of the normal sequence, there was no significant difference between them, meaning these primers do not meet the detection requirements. However, when using RPA-4M-c.6745C>T-F/R, the normal sequence showed almost no fluorescence signal, while the mutant sequence showed a strong fluorescence signal, successfully distinguishing between the mutant and normal sequences. This primer can thus be used for detecting the c.6745C>T mutation site associated with DEB. Notably, when using the RPA-4M-c.6745C>T-F/R primer, the fluorescence signal from the mutant sequence significantly decreased. This is because the mismatches introduced by the RPA primer reduced the efficiency of crRNA recognition of the target DNA sequence, leading to a substantial decrease in Cas12a cleavage efficiency.

      In conclusion, RPA-4M-c.6745C>T-F/R primers were selected for the detection of the c.6745C>T mutation site.

   3. Optimization of Cas12a cleavage reaction time for c.520G and c.520G>A

      

      Based on the results from real-time fluorescence monitoring and endpoint fluorescence detection, for the c.520G>A mutation site, a Cas12a cleavage reaction time of 1 minute was sufficient to effectively distinguish between the mutant and normal sequences (with the mutant signal being more than 3 times that of the normal sequence). As the reaction time increased, both the normal and mutant sequence signals increased, with the signal from the mutant sequence showing a notably more significant enhancement, while the normal sequence signal increased more slowly. Between reaction times of 1 to 5 minutes, the normal and mutant sequences could be distinguished, indicating effective detection. Notably, at 3 minutes, the fluorescence signal difference between the normal and mutant sequences was the most pronounced. Given that the sample concentration of the normal sequence was 10⁹ copies/μL, a relatively high sample level, the lack of strong fluorescence signals from the normal sequence was due to the difficulty of matching the RPA-amplified normal sequence with the crRNA, rather than low sample concentration.

      Therefore, 3 minutes was determined to be the optimal Cas12a cleavage reaction time for detecting the c.520G>A mutation site.

   4. Optimization of Cas12a cleavage reaction time for c.6745C and c.6745C>T

      

      Based on the results from real-time fluorescence monitoring, for the c.6745C>T mutation site, the efficiency of Cas12a cleavage of RPA-amplified products was relatively low, which is consistent with the results observed during RPA primer screening. This is due to the introduction of additional mismatched sites by the RPA primers, which reduced the recognition efficiency of crRNA and the cleavage efficiency of Cas12a. As the reaction time increased, the signal from the mutant sequence continuously increased, reaching its maximum at 58 minutes, while the signal from the normal sequence remained unchanged over time.

      Therefore, 60 minutes was determined to be the optimal Cas12a cleavage reaction time for detecting the c.6745C>T mutation site.

      Summary:

      For the c.520G>A and c.6745C>T mutation sites, the RPA primers selected for the c.6745C>T mutation introduced more mismatched bases compared to the primers for the c.520G>A mutation, resulting in a greater impact on crRNA recognition and Cas12a cleavage efficiency. As a result, the fluorescence signal for c.6745C>T was relatively lower. However, based on the current results, the detection of the c.6745C>T mutation site can still be successfully carried out.

   5. Feasibility analysis (fluorescence detection)

      

      As shown in the figure, for the c.520G>A and c.6745C>T mutation sites, the fluorescence signals from the mutant sequences were significantly higher than those from the normal sequences, indicating that the optimized fluorescence detection system can effectively distinguish between normal and mutant sequences. This detection system is feasible.

   6. Feasibility analysis (test strip detection)

      

      As shown in the figure, for the c.520G>A and c.6745C>T mutation sites, the test strips for the mutant sequences display both a control line (C line) and a distinct test line (T line), while the normal sequences and blank controls only show the control line (C line). This indicates that the optimized test strip detection system can effectively distinguish between normal and mutant sequences, demonstrating the feasibility of this detection system.

1. Experimental Contents
   1. Molecular sensitivity analysis

      Objective:

      Investigate the sensitivity of the optimized detection system for analyzing single-nucleotide mutations associated with dystrophic epidermolysis bullosa (DEB).

      Brief description:

      For the two mutation sites c.520G>A and c.6745C>T, to investigate the analytical sensitivity of the detection system, plasmid samples containing different copy numbers of the mutated sequences were subjected to RPA amplification, Cas12a cleavage reaction, fluorescence detection, and test strip analysis under optimized conditions.

      The plasmid concentrations used were: 10⁸ copies/μL, 10⁵ copies/μL, 10⁴ copies/μL, 10³ copies/μL, 10² copies/μL, 10¹ copies/μL, and 10⁰ copies/μL.

      Procedure:

      1. Fluorescence detection system
      1. RPA amplification
      2. Protein degradation in RPA products
      3. Agarose gel electrophoresis of RPA products
      4. Cas12a cleavage of RPA products
      5. Fluorescent detection of diluted Cas12a cleavage products

      These experiments have been conducted before. For detailed steps, it can be referenced from previous experiments.

      2. Test strip detection system
         1. RPA amplification
         2. Protein degradation in RPA products
         3. Agarose gel electrophoresis of RPA products
         4. Cas12a cleavage of RPA products

         For strip testing, FAM-ssDNA-Biotin was substituted for ssDNA in the Cas12a cleavage reaction, compared to the fluorescent detection method.

         5. Test strip analysis of Cas12a cleavage products

         5 μL of Cas12a cleavage products were placed on the sample pad of the test strip. The test strip was then placed in 70 μL of 1× PBS buffer (containing 0.01% Tween-20) for chromatography. The appearance of a T line was observed within 2 min to determine the result.

         These experiments have been conducted before. For detailed steps, it can be referenced from previous experiments.

   2. Random Sample Analysis

      Objective:

      To investigate the actual sample analysis capability of the optimized detection system for detecting mutation sites associated with dystrophic epidermolysis bullosa (DEB).

      Brief description:

      For the two target sites, c.520G>A and c.6745C>T, standard plasmids containing both mutated and non-mutated sequences at varying concentrations (≥10⁴ copies/µL) were randomly mixed. A total of 12 random samples were prepared, and the constructed method was used for analysis. All random samples were subjected to RPA amplification, Cas12a cleavage reaction, fluorescence detection, and test strip analysis under optimized conditions. Positive and negative controls were also set up in the experiment. PCR amplification is used to verify the presence of relevant genes (it cannot distinguish whether they are mutant sequences).

      Procedure:

      1. Fluorescence detection system
         1. RPA amplification
         2. Protein degradation in RPA products
         3. Agarose gel electrophoresis of RPA products
         4. Cas12a cleavage of RPA products
         5. Fluorescent detection of diluted Cas12a cleavage products

         These experiments have been conducted before. For detailed steps, it can be referenced from previous experiments.

      2. Test strip detection system
         1. RPA amplification
         2. Protein degradation in RPA products
         3. Agarose gel electrophoresis of RPA products
         4. Cas12a cleavage of RPA products

         For strip testing, FAM-ssDNA-Biotin was substituted for ssDNA in the Cas12a cleavage reaction, compared to the fluorescent detection method.

         5. Test strip analysis of Cas12a cleavage products

         5 μL of Cas12a cleavage products were placed on the sample pad of the test strip. The test strip was then placed in 70 μL of 1× PBS buffer (containing 0.01% Tween-20) for chromatography. The appearance of a T line was observed within 2 min to determine the result.

         These experiments have been conducted before. For detailed steps, it can be referenced from previous experiments.

2. Results
   1. RPA product electrophoresis results for molecular sensitivity analysis for c.520G>A and c.6745C>T

      In the electrophoresis gel, the RPA amplification products of samples 10⁸, 10⁶, and 10⁵ copies/µL showed bands that were consistent with the expected size. As the plasmid concentration decreased, the electrophoretic bands of the RPA products gradually weakened until they disappeared. This is due to the limited analytical capacity of RPA amplification combined with agarose gel electrophoresis. In summary, the appearance of the target band in the high-concentration samples and the absence of bands in the blank control group indicate that the RPA amplification reaction proceeded normally.

   2. Molecular sensitivity analysis for c.520G>A (fluorescence detection)

      

      Analysis of the fluorescence detection results for the c.520G>A site revealed that as the plasmid concentration decreased, the fluorescence signal showed an overall decreasing trend. The fluorescence value of the 10³ copies/µL sample showed a significant difference compared to the negative control, whereas the 10² copies/µL sample did not. This indicates that the detection limit of the fluorescence detection system for the c.520G>A site is 10³ copies/µL.

   3. Molecular sensitivity analysis for c.520G>A (test strip detection)

      

      Observing the test strip results for the c.520G>A site, it was found that as the plasmid concentration decreased, the strength of the T line on the test strip showed an overall decreasing trend. The 10³ copies/µL sample displayed a clear T line, while the 10² copies/µL sample did not. This indicates that the detection limit of the test strip system for the c.520G>A site is 10³ copies/µL.

   4. Molecular sensitivity analysis for c.6745C>T (fluorescence detection)

      

      Analysis of the fluorescence detection results for the c.6745C>T site showed that as the plasmid concentration decreased, the fluorescence signal overall exhibited a decreasing trend. The fluorescence value of the 10⁵ copies/µL sample showed a significant difference from the negative control, while the 10⁴ copies/µL sample displayed some fluorescence, but the data analysis revealed no significant difference compared to the negative control. This suggests that the detection limit of the fluorescence detection system for the c.6745C>T site is 10⁵ copies/µL.

   5. Molecular sensitivity analysis for c.6745C>T (test strip detection)

      

      Observing the test strip results for the c.6745C>T site, it was found that as the plasmid concentration decreased, the strength of the T line on the test strip also showed a decreasing trend. The 10⁴ copies/µL sample displayed a clear T line, while the 10³ copies/µL sample did not. This indicates that the detection limit of the test strip system for the c.6745C>T site is 10⁴ copies/µL.

   6. Random sample analysis for c.520G>A and c.6745C>T (fluorescence detection and test strip detection)

      

      The results of the random sample analysis for the c.520G>A and c.6745C>T targets are displayed in the figure. Both the fluorescence detection and test strip detection methods yielded consistent results, effectively distinguishing the presence or absence of mutated sequences. This indicates that the detection system has the capability to analyze actual samples.

   7. PCR validation of random samples

      Based on the comparison of PCR results with fluorescence and test strip detection results, the following conclusions can be drawn:

      1. COL7A1 c.520G>A

      Samples 2, 3, 5, 7, 8, 10, 11, and 12 contain the COL7A1 c.520 near gene segment. Among these, samples 2, 3, 7, 10, and 11 contain the COL7A1 c.520G>A (mutated sequence), while samples 5, 8, and 12 contain the COL7A1 c.520G (non-mutated sequence). Samples 1, 4, 6, and 9 do not contain the COL7A1 c.520 near gene segment.

      

      2. COL7A1 c.6745C>T

      Samples 2, 3, 5, 7, 10, 11, and 12 contain the COL7A1 c.6745C near gene segment. Among these, samples 2, 3, 7, 10, and 11 contain the COL7A1 c.6745C>T (mutated sequence), while samples 5 and 12 contain the COL7A1 c.6745C (non-mutated sequence). Samples 1, 4, 6, 8, and 9 do not contain the COL7A1 c.6745C near gene segment.

      

      These results confirm that the detection system can accurately identify both the presence of the targeted gene segments and the mutations associated with COL7A1.

1. Organize data and summarize experiments