1. Construction of the pET-28a-AsCpf1 plasmid

To construct the plasmid pET-28a-AsCpf1, PCR amplification of the AsCpf1 gene was performed. The pET-28a vector was then subjected to double digestion using BamH I and EcoR I enzymes. The gene fragment was ligated to the linearized vector using a homologous recombination method, followed by transformation into BL21 competent cells. Single colonies were picked from the transformation plate and verified by monoclonal PCR. The amplified products were further sequenced and analyzed by sequence alignment to confirm successful construction of the recombinant plasmid.



Figure 1. The plasmid construction process of pET-28a-AsCpf1



Figure 2. Results of pET-28a-AsCpf1 plasmid construction

Note:

A: Agarose gel electrophoresis results of PCR amplification of the AsCpf1 gene. M: 5K DNA Marker, N: negative control.

B: Double digestion results of pET-28a using BamH I and EcoR I.

C: Culture plate for transforming competent cells with recombinant plasmids.

D: Monoclonal PCR verification of transformation results.

E. Sequence alignment results of recombinant plasmid pET-28a-AsCpf1.

The construction process is illustrated in Figure 1. The relevant results of pET-28a-AsCpf1 plasmid construction are shown in Figure 2. As depicted in Figure 2A, the PCR amplification of the AsCpf1 gene produced a single band around 4000 bp, which aligns with the expected size of 3936 bp, confirming successful amplification of the AsCpf1 gene. The double digestion results of the pET-28a vector are presented in Figure 2B. Upon examination of the digestion products, the presence of the expected band size and comparison with other lanes verified successful digestion. Subsequently, the recombinant plasmid was transformed into BL21 competent cells, and the appearance of numerous single colonies on the transformation plate indicated a high transformation efficiency (Figure 2C). Transformation efficiency was further verified by monoclonal PCR, as shown in Figure 2D, where the expected band size was observed, confirming the presence of positive clones. Finally, sequence analysis (Figure 2E) revealed that the amplified fragment matched the predicted sequence, thus confirming the successful construction of the pET-28a-AsCpf1 plasmid.

2. Construction of the pET-28a-c.520G plasmid

To construct the plasmid pET-28a-c.520G, PCR amplification of the c.520G gene fragment was performed. The pET-28a vector was then subjected to double digestion using BamH I and EcoR I enzymes. The amplified gene fragment was ligated into the linearized vector using a homologous recombination method, followed by transformation into DH5α competent cells. Single colonies were picked from the transformation plate and verified by monoclonal PCR. The amplified products were then sequenced and analyzed by sequence alignment to confirm successful construction of the recombinant plasmid.



Figure 3. The plasmid construction process of pET-28a-c.520G



Figure 4. Results of pET-28a-c.520G plasmid construction

Note:

A: Agarose gel electrophoresis results of PCR amplification of the c.520G gene. M: 2K DNA Marker, N: negative control.

B: Double digestion results of pET-28a using BamH I and EcoR I.

C: Culture plate for transforming competent cells with recombinant plasmids.

D: Monoclonal PCR verification of transformation results.

E: Sequence alignment results of recombinant plasmid pET-28a-c.520G.

The construction process is illustrated in Figure 3. The relevant results of pET-28a-c.520G plasmid construction are shown in Figure 4. As depicted in Figure 4A, the PCR amplification of the c.520G gene produced a single band around 362 bp, which aligns with the expected size of 362 bp, confirming successful amplification of the c.520G gene. The double digestion results of the pET-28a vector are presented in Figure 4B. Upon examination of the digestion products, the presence of the expected band size and comparison with other lanes verified successful digestion. Subsequently, the recombinant plasmid was transformed into DH5α competent cells, and the appearance of numerous single colonies on the transformation plate in Figure 4C indicated a high transformation efficiency. Transformation efficiency was further verified by monoclonal PCR, as shown in Figure 4D, where the expected band size was observed, confirming the presence of positive clones. Finally, sequence analysis (Figure 4E) revealed that the amplified fragment matched the predicted sequence, thus confirming the successful construction of the pET-28a-c.520G plasmid.

3. Construction of the pET-28a-c.520G>A plasmid

For the construction of the pET-28a-c.520 G>A plasmid, PCR amplification of the c .520G>A gene fragment was carried out. The pET-28a vector was then subjected to double digestion using BamH I and EcoR I enzymes to linearize it. The amplified c.520G>A fragment was ligated into the digested vector using a homologous recombination method, followed by transformation into DH5α competent cells. After plating, individual colonies were selected, and monoclonal PCR was performed for initial screening. The cloned products were sequenced and analyzed through sequence alignment to confirm the successful construction of the recombinant plasmid.



Figure 5. The plasmid construction process of pET-28a-c.520G>A



Figure 6. Results of pET-28a-c.520G>A plasmid construction

Note:

A: Agarose gel electrophoresis showing the PCR amplification of the c.520G>A gene. M: 2K DNA Marker, N: negative control.

B: Double digestion results of pET-28a vector using BamH I and EcoR I.

C: Transformation plate showing DH5α competent cells containing recombinant plasmids.

D: Monoclonal PCR results for transformation verification.

E: Sequence alignment results confirming the recombinant plasmid.

The process of plasmid construction is outlined in Figure 5. The detailed results for the pET-28a-c.520G>A plasmid construction are presented in Figure 6. As shown in Figure 6A, the PCR amplification of the c.520G>A gene generated a single band around 362 bp, which corresponds with the expected fragment size, confirming successful gene amplification. The results of the double digestion of the pET-28a vector are shown in Figure 6B, where the digestion products reveal the presence of the expected fragment sizes, confirming proper digestion. The transformation of the recombinant plasmid into DH5α cells resulted in the formation of numerous single colonies, as illustrated in Figure 6C, indicating high transformation efficiency. The transformation was further confirmed by monoclonal PCR, shown in Figure 6D, where the expected band size was detected, confirming the presence of positive clones. Lastly, sequence analysis in Figure 6E confirmed that the sequence of the amplified c.520G>A fragment matched the expected sequence, validating the successful construction of the pET-28a-c.520G>A plasmid.

4. Construction of the pET-28a-c.6745C plasmid

For the construction of the pET-28a-c.6745C plasmid, a PCR amplification was carried out to obtain the c.6745C gene fragment. The amplified product, which had a size of 310 bp, was inserted into a pET-28a vector that had been digested with BamH I and EcoR I enzymes. This was followed by ligation using a homologous recombination method, and the recombinant plasmid was then introduced into DH5α competent cells. After transformation, individual colonies were picked, and monoclonal PCR was used for verification. The amplified PCR products were sequenced and compared to confirm the successful creation of the recombinant plasmid.



Figure 7. The construction procedure of the pET-28a-c.6745C plasmid



Figure 8. Results of pET-28a-c.6745C plasmid construction

Note:

A: PCR amplification results of the c.6745C gene. M: 2K DNA Marker, N: negative control.

B: Double digestion of pET-28a vector with BamH I and EcoR I enzymes.

C: Colony formation on the plate after transformation with recombinant plasmids.

D: Monoclonal PCR verification of the transformation results.

E: Sequence alignment of the recombinant plasmid pET-28a-c.6745C.

The plasmid construction process is illustrated in Figure 7. The results for the pET-28a-c.6745C plasmid construction are shown in Figure 8. In Figure 8A, PCR amplification of the c.6745C gene produced a single band around 310 bp, which matched the expected size, confirming the successful amplification of the c.6745C gene. Figure 8B shows the results of the double digestion of the pET-28a vector. The digestion products revealed the expected band sizes, confirming the success of the digestion process. Following this, the recombinant plasmid was transformed into DH5α competent cells, and Figure 8C shows the appearance of numerous colonies on the plate, indicating efficient transformation. Monoclonal PCR verification in Figure 8D confirmed the presence of positive clones, as the expected band size was observed. Finally, the sequencing results shown in Figure 8E indicated that the amplified fragment perfectly aligned with the expected sequence, validating the successful construction of the pET-28a-c.6745C plasmid.

5. Construction of the pET-28a-c.6745C>T plasmid

For the creation of the pET-28a-c.6745C>T plasmid, the PCR amplification was performed using the c.6745C>T gene fragment. The amplified product, which had a size of 310 bp, was then inserted into a pET-28a vector previously digested with BamH I and EcoR I enzymes. The ligation step was completed using a homologous recombination method, and the recombinant plasmid was subsequently introduced into DH5α competent cells. After transformation, individual colonies were selected and monoclonal PCR was conducted to verify the presence of the desired insert. The PCR products were sequenced and aligned to ensure the successful construction of the plasmid.



Figure 9. The construction process of the pET-28a-c.6745C>T plasmid



Figure 10. Results of the pET-28a-c.6745C>T plasmid construction

Note:

A: PCR amplification of the c.6745C>T gene. M: 2K DNA Marker, N: negative control.

B: Double digestion of pET-28a vector with BamH I and EcoR I.

C: Colony formation on the transformation plate after recombinant plasmid introduction.

D: Monoclonal PCR verification of the transformation.

E: Sequence alignment of the recombinant plasmid pET-28a-c.6745C>T.

The plasmid construction process is shown in Figure 9, with the corresponding results for the pET-28a-c.6745C>T plasmid construction displayed in Figure 10. As seen in Figure 10A, PCR amplification of the c.6745C>T gene generated a distinct band at 310 bp, confirming the successful amplification of the gene. The results of the double digestion of the pET-28a vector are presented in Figure 10B, where the expected band sizes were observed, validating successful digestion. After the recombinant plasmid was transformed into DH5α competent cells, Figure 10C demonstrates the appearance of several colonies on the transformation plate, confirming effective transformation. The monoclonal PCR results shown in Figure 10D further supported the presence of positive clones, as indicated by the expected band. Lastly, the sequence alignment results in Figure 10E confirmed that the amplified fragment matched the anticipated sequence, confirming the successful construction of the pET-28a-c.6745C>T plasmid.

1. Optimization of IPTG-induced expression at 16 ℃

To optimize the IPTG-induced expression of AsCpf1, pET-28a-AsCpf1-BL21 acterial cultures were grown to an OD₆₀₀ of 0.6, followed by IPTG induction at concentrations of 0 mM, 0.2 mM, 0.5 mM, 0.8 mM, 1 mM, and 2 mM. The cultures were then incubated at 16 ℃ with shaking for 20 hours. After induction, protein was purified using a protein purification kit, and both crude and purified protein samples were analyzed by SDS-PAGE.



Figure 11. IPTG-Induced Expression at 16 ℃ with different IPTG concentrations

The electrophoresis results (Figures 11A and 11B) showed clear overexpression of the target protein in the crude sample, with increasing IPTG concentrations leading to stronger protein bands. After purification, the impurities in the crude protein were almost entirely removed, leaving predominantly the target protein. The intensity of the bands in both the crude and purified samples followed a consistent trend with the increasing IPTG concentration. The sample induced with 0.8 mM IPTG exhibited the strongest band, both in the crude and purified forms, indicating that 0.8 mM IPTG is the optimal concentration for protein expression at 16 ℃.

2. Optimization of IPTG-induced expression at 37 ℃

For higher-temperature expression, cultures were induced with IPTG at concentrations of 0 mM, 0.2 mM, 0.5 mM, 0.8 mM, 1 mM, and 2 mM, after reaching an OD₆₀₀ of 0.6. The cultures were incubated at 37 ℃ with shaking for 3 hours. Afterward, protein was purified using the same protocol as the 16 ℃ induction, and the samples were analyzed by SDS-PAGE.



Figure 12. IPTG-Induced Expression at 37 ℃ with different IPTG concentrations

The electrophoresis gel for the 37 ℃ induction revealed weaker overall band intensities compared to the 16 ℃ induction (Figure 12). As the IPTG concentration increased, the band intensity did not show significant changes. However, the samples induced with 0.5 mM and 2 mM IPTG showed relatively stronger bands, suggesting these concentrations are optimal for expression at 37 ℃. Although purification reduced some of the impurities, the overall protein expression at 37 ℃ was obviously weaker than at 16 ℃.

3. Induction temperature optimization


Figure 13. IPTG-Induced Expression at different temperatures

Comparing the results of IPTG induction at 16 ℃ (Figure 13A) and 37 ℃ (Figure 13B), it was observed that protein expression was significantly higher at the lower temperature (16 ℃), especially at 0.8 mM IPTG. The overall band intensity at 16 ℃ was relatively high, and the purification process removed most impurities, leaving a clear target protein band. In contrast, protein expression at 37 ℃ was weaker, even with higher IPTG concentrations, indicating that the lower temperature (16 ℃) provides better conditions for AsCpf1 expression.

Overall Conclusion

Based on the results, induction at 16 ℃ with 0.8 mM IPTG was chosen as the optimal expression condition, as it provided the strongest expression bands, indicating a higher protein expression level.

Purified Cas12a (AsCpf1) protein was quantified and used to construct a dystrophic epidermolysis bullosa (DEB) detection platform targeting the c.520G>A and c.6745C>T mutation sites in COL7A1. This detection platform includes the extraction of cell-free fetal DNA (cfDNA), RPA amplification, Cas12a cleavage of the RPA products, and fluorescence detection of the Cas12a cleavage products.

It is noteworthy that to generate a significant signal difference between the normal and mutant sequences, we systematically increased the number of mismatched bases in the RPA primers. Different RPA primers were designed for RPA amplification. The optimal RPA primers were selected based on the fluorescence signals generated by Cas12a cleavage. Subsequently, a reliable detection platform was constructed using the selected primers. (The principle behind this design can be referenced in the "Our design" section of the Project Description.)

1. RPA reactions using different RPA primers

   Conducted RPA reactions for c.520G (normal sequence), c.520G>A (mutant sequence), c.6745C (normal sequence), and c.6745C>T (mutant sequence), respectively. The primers used for the RPA reaction are: RPA-1M-c.520G>A-F/R, RPA-2M-c.520G>A-F/R, RPA-3M-c.520G>A-F/R, RPA-4M-c.520G>A-F/R, RPA-1M-c.6745C>T-F/R, RPA-2M-c.6745C>T-F/R, RPA-3M-c.6745C>T-F/R, and RPA-4M-c.6745C>T-F/R. RPA primer information is listed in the table below.

   Table 1. RPA Primer information

   Gene	Primer Name	Sequence (5’-3’)	Amplicon size
   c .520G and c .520G>A	RPA-1M-c.520G>A-F	GACCTGGTGTCCCCAAGGTCTGCATCCTGA	215 bp
   	RPA-1M-c.520G>A-R	CAGTAGTGTCCTCAAGATGCTGAAGTCATTGA
   	RPA-2M-c.520G>A-F	GAAGGGGCAGGGGGTCAAGCTATTTGCTGTC	148 bp
   	RPA-2M-c.520G>A-R	GGAAACGAGGGGCAGTAGTGTCCTCAAGATG
   	RPA-3M-c.520G>A-F	GAAGGGGCAGGGGGTCAAGCTATTTGCTGAC	148 bp
   	RPA-3M-c.520G>A-R	GGAAACGAGGGGCAGTAGTGTCCTCAAGATG
   	RPA-4M-c.520G>A-F	GAAGGGGCAGGGGGTCAAGCTATTTGCTCAC	148 bp
   	RPA-4M-c.520G>A-R	GGAAACGAGGGGCAGTAGTGTCCTCAAGATG
   c.6745C and c.6745C>T	RPA-1M-c.6745C>T-F	CTGACTGGACCTACTGGAGCTGTGGGACTTC	164 bp
   	RPA-1M-c.6745C>T-R	CTCCCTCTGTCTCCATCTTTTCCACTGGCAC
   	RPA-2M-c.6745C>T-F	TTGTGGGTCCACAGGGGTCTCCAGGTTTGCCTGGC	113 bp
   	RPA-2M-c.6745C>T-R	AGGGCTCCCTCTGTCTCCATCTTTTCCACTG
   	RPA-3M-c.6745C>T-F	TTGTGGGTCCACAGGGGTCTCCAGGTTTGCCTGCT	113 bp
   	RPA-3M-c.6745C>T-R	AGGGCTCCCTCTGTCTCCATCTTTTCCACTG
   	RPA-4M-c.6745C>T-F	TTGTGGGTCCACAGGGGTCTCCAGGTTTGCCTCCT	113 bp
   	RPA-4M-c.6745C>T-R	AGGGCTCCCTCTGTCTCCATCTTTTCCACTG

   1. RPA product electrophoresis results for c.520G and c.520G>A
   

   Figure 14. RPA product electrophoresis results for c.520G and c.520G>A

   Note: A: c.520G>A

   In the electrophoresis image above, it can be observed that when using four different pairs of RPA primers, the target bands corresponding to the c.520G and c.520G>A templates are visible in the lanes of the RPA products, while the blank control group shows no bands (Figure 14). This indicates that both the normal and mutated sequences were successfully amplified, and there is no aerosol contamination. When using the RPA-1M-c.520G>A-F/R and RPA-2M-c.520G>A-F/R primers, the band intensity is brighter, whereas the bands corresponding to the RPA-3M-c.520G>A-F/R and RPA-4M-c.520G>A-F/R primers are relatively weaker. This is due to the latter primers introducing more mismatched sites, which can somewhat affect the RPA amplification efficiency

   2. RPA product electrophoresis results for c.6745C and c.6745C>T
   

   Figure 15. RPA product electrophoresis results for c.6745C and c.6745C>T

   Note: B: c.6745C>T

   The RPA amplification results for the c.6745C and c.6745C>T templates are similar to those for the c.520G and c.6745C>T templates. As seen in the electrophoresis image above, when using four different pairs of RPA primers, the RPA products corresponding to the c.6745C and c.6745C>T templates show target bands, while no bands are observed in the blank control group (Figure 15). This indicates that both the normal and mutated sequences were successfully amplified, and there is no aerosol contamination. When using the RPA-1M-c.6745C>T-F/R and RPA-2M-c.6745C>T-F/R primers, the band intensity is brighter, whereas the bands corresponding to the RPA-3M-c.6745C>T-F/R and RPA-4M-c.6745C>T-F/R primers are relatively weaker. This is due to the latter primers introducing more mismatched sites, which can somewhat affect the RPA amplification efficiency.

2. Cas12a cleavage of RPA products

   RPA amplification products of c.520G (normal sequence), c.520G>A (mutant sequence), c.6745C (normal sequence), and c.6745C>T (mutant sequence) using different primers were used in the Cas12a cleavage reaction. Among these, the c.520G and c.520G>A products were used for detecting the c.520G>A mutation site, while the c.6745C and c.6745C>T products were used for detecting the c.6745C>T mutation site.

   1. Cas12a cleavage fluorescence results of RPA products corresponding to different RPA primers for c.520G and c.520G>A

   

   Figure 16. Cas12a cleavage fluorescence results of RPA products corresponding to different RPA primers for c.520G and c.520G>A

   Based on the results from real-time fluorescence monitoring and endpoint fluorescence detection (Figure 16), for the c.520G>A mutation site, using the RPA-1M-c.520G>A-F/R primers, both normal and mutant sequences exhibited strong fluorescence signals. Although the signal from the mutant sequence was stronger than that of the normal sequence, there was no significant difference between them, indicating that this primer pair does not meet the detection requirements. When using RPA-2M-c.520G>A-F/R, the normal sequence showed almost no fluorescence signal, while the mutant sequence exhibited a strong fluorescence signal, effectively distinguishing between the mutant and normal sequences. Therefore, this primer can be used for the detection of the c.520G>A mutation associated with DEB. However, no fluorescence signal was observed when using RPA-3M-c.520G>A-F/R and RPA-4M-c.520G>A-F/R, suggesting that the excessive mismatches introduced by these primers prevented the crRNA from recognizing the target DNA sequence, thus failing to activate Cas12a cleavage activity.

   In conclusion, RPA-2M-c.520G>A-F/R primers were selected for the detection of the c.520G>A mutation site.

   2. Cas12a cleavage fluorescence results of RPA products corresponding to different RPA primers for c.6745C and c.6745C>T

   

   Figure 17. Cas12a cleavage fluorescence results of RPA products corresponding to different RPA primers for c.6745C and c.6745C>T

   For the c.6745C>T mutation site, real-time fluorescence monitoring and endpoint fluorescence detection results showed that using the RPA-1M-c.6745C>T-F/R, RPA-2M-c.6745C>T-F/R, and RPA-3M-c.6745C>T-F/R primers, both normal and mutant sequences exhibited strong fluorescence signals. Although the signal from the mutant sequence was stronger than that of the normal sequence, there was no significant difference between them, meaning these primers do not meet the detection requirements. However, when using RPA-4M-c.6745C>T-F/R, the normal sequence showed almost no fluorescence signal, while the mutant sequence showed a strong fluorescence signal, successfully distinguishing between the mutant and normal sequences (Figure 17). This primer can thus be used for detecting the c.6745C>T mutation site associated with DEB. Notably, when using the RPA-4M-c.6745C>T-F/R primer, the fluorescence signal from the mutant sequence significantly decreased. This is because the mismatches introduced by the RPA primer reduced the efficiency of crRNA recognition of the target DNA sequence, leading to a substantial decrease in Cas12a cleavage efficiency.

   In conclusion, RPA-4M-c.6745C>T-F/R primers were selected for the detection of the c.6745C>T mutation site.

Conclusion

A successful RPA-Cas12a detection platform was established for the detection of dystrophic epidermolysis bullosa (DEB) mutations at the c.520G>A and c.6745C>T sites in COL7A1. After evaluating multiple RPA primer pairs, the optimal primers were selected based on their ability to generate distinct fluorescence signals following Cas12a cleavage. For the c.520G>A mutation, the RPA-2M-c.520G>A-F/R primers were chosen as they provided a clear differentiation between the mutant and normal sequences. Similarly, for the c.6745C>T mutation, the RPA-4M-c.6745C>T-F/R primers were selected, effectively distinguishing the mutant sequence from the normal one. The constructed detection platform, incorporating cfDNA extraction, RPA amplification, Cas12a cleavage, and fluorescence detection, is reliable for detecting these two mutations associated with DEB.

Building upon the results of the previous experiment, the primers RPA-2M-c.520G>A-F/R and RPA-4M-c.6745C>T were selected for subsequent experiments. Due to varying cleavage efficiencies of Cas12a at the two mutation sites, as well as the need to enhance detection performance, the reaction time for Cas12a cleavage was optimized. Specifically, for the c.520G>A mutation, cleavage times (at 42 ℃) were set at 0, 1, 2, 3, 4, and 5 minutes. For the c.6745C>T mutation, a real-time fluorescence device was used to monitor the impact of enzyme cleavage time on detection performance, with a reaction time of 60 minutes.

1. Optimization of Cas12a cleavage reaction time for c.520G and c.520G>A



Figure 18. Optimization of Cas12a cleavage reaction time for c.520G and c.520G>A

Based on the results from real-time fluorescence monitoring and endpoint fluorescence detection, for the c.520G>A mutation site, a Cas12a cleavage reaction time of 1 minute was sufficient to effectively distinguish between the mutant and normal sequences (with the mutant signal being more than 3 times that of the normal sequence). As the reaction time increased, both the normal and mutant sequence signals increased, with the signal from the mutant sequence showing a notably more significant enhancement, while the normal sequence signal increased more slowly. Between reaction times of 1 to 5 minutes, the normal and mutant sequences could be distinguished, indicating effective detection. Notably, at 3 minutes, the fluorescence signal difference between the normal and mutant sequences was the most pronounced (Figure 18). Given that the sample concentration of the normal sequence was 10⁹ copies/μL, a relatively high sample level, the lack of strong fluorescence signals from the normal sequence was due to the difficulty of matching the RPA-amplified normal sequence with the crRNA, rather than low sample concentration.

Therefore, 3 minutes was determined to be the optimal Cas12a cleavage reaction time for detecting the c.520G>A mutation site.

2. Optimization of Cas12a cleavage reaction time for c.6745C and c.6745C>T



Figure 19. Optimization of Cas12a cleavage reaction time for c.6745C and c.6745C>T

Based on the results from real-time fluorescence monitoring, for the c.6745C>T mutation site, the efficiency of Cas12a cleavage of RPA-amplified products was relatively low, which is consistent with the results observed during RPA primer screening. This is due to the introduction of additional mismatched sites by the RPA primers, which reduced the recognition efficiency of crRNA and the cleavage efficiency of Cas12a (Figure 19). As the reaction time increased, the signal from the mutant sequence continuously increased, reaching its maximum at 58 minutes, while the signal from the normal sequence remained unchanged over time.

Therefore, 60 minutes was determined to be the optimal Cas12a cleavage reaction time for detecting the c.6745C>T mutation site.

Conclusion:

For the c.520G>A and c.6745C>T mutation sites, the RPA primers selected for the c.6745C>T mutation introduced more mismatched bases compared to the primers for the c.520G>A mutation, resulting in a greater impact on crRNA recognition and Cas12a cleavage efficiency. As a result, the fluorescence signal for c.6745C>T was relatively lower. However, based on the current results, the detection of the c.6745C>T mutation site can still be successfully carried out.

For the two mutation sites c.520G>A and c.6745C>T, RPA amplification, Cas12a cleavage reaction, fluorescence detection, and test strip analysis were performed on normal and mutant sequences under optimized conditions.

1. Feasibility analysis for fluorescence detection platform


Figure 20. Feasibility analysis for fluorescence detection platform

As shown in Figure 20, for the c.520G>A and c.6745C>T mutation sites, the fluorescence signals from the mutant sequences were significantly higher than those from the normal sequences, indicating that the optimized fluorescence detection system can effectively distinguish between normal and mutant sequences. This detection system is feasible.

2. Feasibility analysis for test strip detection platform



Figure 21. Feasibility analysis for test strip detection platform

As shown in Figure 21, for the c.520G>A and c.6745C>T mutation sites, the test strips for the mutant sequences display both a control line (C line) and a distinct test line (T line), while the normal sequences and blank controls only show the control line (C line). This indicates that the optimized test strip detection system can effectively distinguish between normal and mutant sequences, demonstrating the feasibility of this detection system.

Conclusion:

Both the fluorescence and test strip detection platforms effectively distinguish between normal and mutant sequences at the c.520G>A and c.6745C>T mutation sites. The optimized systems demonstrated clear differentiation, confirming their feasibility for mutation detection.

For the two mutation sites c.520G>A and c.6745C>T, to investigate the analytical sensitivity of the detection system, plasmid samples containing different copy numbers of the mutated sequences were subjected to RPA amplification, Cas12a cleavage reaction, fluorescence detection, and test strip analysis under optimized conditions.

The plasmid concentrations used were: 10⁸ copies/μL, 10⁵ copies/μL, 10⁴ copies/μL, 10³ copies/μL, 10² copies/μL, 10¹ copies/μL, and 10⁰ copies/μL.

1. RPA product electrophoresis results for molecular sensitivity analysis for c.520G>A and c.6745C>T


Figure 22. RPA product electrophoresis results for molecular sensitivity analysis for c.520G>A and c.6745C>T

In the electrophoresis gel (Figure 22), the RPA amplification products of samples 10⁸, 10⁶, and 10⁵ copies/µL showed bands that were consistent with the expected size. As the plasmid concentration decreased, the electrophoretic bands of the RPA products gradually weakened until they disappeared. This is due to the limited analytical capacity of RPA amplification combined with agarose gel electrophoresis. In summary, the appearance of the target band in the high-concentration samples and the absence of bands in the blank control group indicate that the RPA amplification reaction proceeded normally.

2. Sensitivity analysis results of the fluorescence detection platform for c.520G>A



Figure 23. Sensitivity analysis results of the fluorescence detection platform for c.520G>A

Analysis of the fluorescence detection results for the c.520G>A site revealed that as the plasmid concentration decreased, the fluorescence signal showed an overall decreasing trend. The fluorescence value of the 10³ copies/µL sample showed a significant difference compared to the negative control, whereas the 10² copies/µL sample did not (Figure 23). This indicates that the detection limit of the fluorescence detection system for the c.520G>A site is 10³ copies/µL.

3. Sensitivity analysis results of the test strip detection platform for c.520G>A



Figure 24. Sensitivity analysis results of the test strip detection platform for c.520G>A

Observing the test strip results in Figure 24 for the c.520G>A site, it was found that as the plasmid concentration decreased, the strength of the T line on the test strip showed an overall decreasing trend. The 10³ copies/µL sample displayed a clear T line, while the 10² copies/µL sample did not. This indicates that the detection limit of the test strip system for the c.520G>A site is 10³ copies/µL.

4. Sensitivity analysis results of the fluorescence detection platform for c.6745C>T



Figure 25. Sensitivity analysis results of the fluorescence detection platform for c.6745C>T

The fluorescence detection results for the c.6745C>T site in Figure 25 showed that as the plasmid concentration decreased, the fluorescence signal overall exhibited a decreasing trend. The fluorescence value of the 10⁵ copies/µL sample showed a significant difference from the negative control, while the 10⁴ copies/µL sample displayed some fluorescence, but the data analysis revealed no significant difference compared to the negative control. This suggests that the detection limit of the fluorescence detection system for the c.6745C>T site is 10⁵ copies/µL.

5. Sensitivity analysis results of the test strip detection platform for c.6745C>T



Figure 26. Sensitivity analysis results of the test strip detection platform for c.6745C>T

Observing the test strip results for the c.6745C>T site, it was found that as the plasmid concentration decreased, the strength of the T line on the test strip also showed a decreasing trend. As shown in Figure 26, the 10⁴ copies/µL sample displayed a clear T line, while the 10³ copies/µL sample did not. This indicates that the detection limit of the test strip system for the c.6745C>T site is 10⁴ copies/µL.

Conclusion:

The molecular sensitivity analysis reveals that the fluorescence detection system for the c.520G>A site has a detection limit of 10³ copies/µL, while the test strip system has the same limit. For the c.6745C>T site, the fluorescence detection system has a limit of 10⁵ copies/µL, and the test strip system has a limit of 10⁴ copies/µL.

For the two target sites, c.520G>A and c.6745C>T, standard plasmids containing both mutated and non-mutated sequences at varying concentrations (≥10⁴ copies/µL) were randomly mixed. A total of 12 random samples were prepared, and the constructed method was used for analysis. All random samples were subjected to RPA amplification, Cas12a cleavage reaction, fluorescence detection, and test strip analysis under optimized conditions. Positive and negative controls were also set up in the experiment. PCR amplification is used to verify the presence of relevant genes (it cannot distinguish whether they are mutant sequences).

1. Random sample analysis for c.520G>A and c.6745C>T (fluorescence detection platform and test strip detection platform)



Figure 27. Random sample analysis results for c.520G>A and c.6745C>T

The results of the random sample analysis for the c.520G>A and c.6745C>T targets are displayed in Figure 27. Both the fluorescence detection and test strip detection methods yielded consistent results, effectively distinguishing the presence or absence of mutated sequences. This indicates that the detection system can analyze actual samples.

2. PCR validation of random samples


Figure 28. PCR validation results of random samples for c.520G>A and c.6745C>T

Based on the comparison of PCR results (shown in Figure 28) with fluorescence and test strip detection results, the following conclusions can be drawn:

1. COL7A1 c.520G>A

Samples 2, 3, 5, 7, 8, 10, 11, and 12 contain the COL7A1 c.520 near gene segment. Among these, samples 2, 3, 7, 10, and 11 contain the COL7A1 c.520G>A (mutated sequence), while samples 5, 8, and 12 contain the COL7A1 c.520G (non-mutated sequence). Samples 1, 4, 6, and 9 do not contain the COL7A1 c.520 near gene segment.

2. COL7A1 c.6745C>T

Samples 2, 3, 5, 7, 10, 11, and 12 contain the COL7A1 c.6745C near gene segment. Among these, samples 2, 3, 7, 10, and 11 contain the COL7A1 c.6745C>T (mutated sequence), while samples 5 and 12 contain the COL7A1 c.6745C (non-mutated sequence). Samples 1, 4, 6, 8, and 9 do not contain the COL7A1 c.6745C near gene segment.

These results confirm that the detection system can accurately identify both the presence of the targeted gene segments and the mutations associated with COL7A1.