| SMU-Union-China-iGEM 2025

LGG GROWTH
CURVE
DETERMINATION

ELECTROPORATION
TRANSFORMATION

COLONY PCR

FLUORESCENT
VERIFICATION

INFLUENZA VIRUS HA
HEMAGGLUTINATION
ASSAY

ELISA

BACTERIAL CELL
MEMBRANE LYSIS

GFP EXPRESSION

PROMOTER EXPRESSION

BLUE LIGHT AND
NATURAL LIGHT
INDUCTION

REPRESSOR PROTEIN
INDUCTION

LGG Growth Curve Determination

Ⅰ. Basic Principles

When bacteria are inoculated into a liquid medium and the cell number is counted at regular intervals, a typical bacterial growth curve can be plotted, showing four distinct growth phases of bacteria over time.

Lag Phase: Slow or lack of growth due to the physiological adaptation of cells to culture conditions, or slow growth due to low initial cell density.

Log or Exponential Phase: The optimal growth rate is achieved, during which the cell number increases logarithmically over discrete time intervals.

Stationary Phase: Bacterial growth and death balance each other, resulting in no net increase in cell number. The decline in growth rate is typically due to nutrient depletion or accumulation of toxic waste components.

Decline or Death Phase: The death rate exceeds the growth rate, leading to a net loss of viable cells.

The turbidimetric method can be used to plot the growth curve of bacteria in broth or liquid medium. It is one of the simplest methods for analyzing growth trends. As the cell number in the sample increases, the transmission of light through the sample decreases. A spectrophotometer is used to track the changes in optical density over time.

Ⅱ. Experimental Materials and Preparation

1. Strain: Lactobacillus rhamnosus.

2. Culture media: MRS broth culture medium, MRS agar culture medium.

3. Instruments: sterile culture flasks, test tubes, constant temperature shakers or constant temperature incubators, spectrophotometers, pipettes, sterile pipettes, centrifuge tubes, etc.

Ⅲ. Experimental Procedures

1. Inoculation and Cultivation:

[Day 1] Revive bacteria, use a sterile loop to inoculate the bacteria onto an agar plate, and incubate at 37°C for 18-24 hours.

[Day 2] Pick a single colony from the MRS agar plate and inoculate it into a test tube containing 10 ml of autoclaved broth medium. Incubate the test tube at 37°C overnight.

[Day 3] Inoculate 0.1% overnight culture into a test tube containing 10 ml of autoclaved broth medium. Measure the OD value at 0 hours. Incubate at 37°C. Take a certain amount of the culture suspension every 1 hour and measure the optical density at a wavelength of 600 nm using a spectrophotometer until the reading becomes static.

2. Data Recording:

At the end of the experiment, plot the time in minutes on the X-axis against the optical density at 600 nm on the Y-axis to obtain the growth curve of bacteria. Repeat the experiment at least 3 times to reduce the error.

Ⅳ. Data Processing and Curve Plotting

1. Data Organization: Calculate the mean and standard deviation for each time point. If using OD values, confirm that they exhibit a linear relationship with bacterial concentration.

2. Curve Plotting: Use time as the abscissa (X-axis) and the logarithm of the OD value or the viable cell count as the ordinate (Y-axis). Plot the growth curve using software such as Excel, GraphPad Prism, or Origin.

3. Curve Analysis:

Lag Phase: Bacteria adapt to the environment; the OD value changes slowly.

Log Phase: Bacteria proliferate rapidly; the OD value increases exponentially.

Stationary Phase: The bacterial population reaches its maximum; the OD value stabilizes.

Death Phase: Bacteria die; the OD value declines.

Ⅴ. Precautions

1. Aseptic Technique: Ensure sterile procedures during inoculation and cultivation to avoid contamination.

2. Sampling Consistency: Maintain consistent sample volumes and time intervals during sampling.

3. Instrument Calibration: Calibrate the spectrophotometer in advance to ensure accurate OD measurements.

4. Experimental Repeats: Repeat the experiment at least three times to improve data reliability.

Ⅵ. Frequently Asked Questions and Solutions

1. Large Fluctuations in OD Values: Check for uniform sampling and proper instrument calibration. Increase the number of replicates to reduce error.

2. Abnormal Growth Curve: Check if culture medium composition, temperature, pH, and other conditions are suitable. Confirm whether the bacterial strain is contaminated or has mutated.

3. Premature Onset of Death Phase: Check if nutrients are depleted and whether supplementation is needed. Verify that the culture conditions are suitable for bacterial growth.

Electroporation Transformation

Ⅰ. LGG Competent Cell Preparation

Method 1:
1. Inoculate the activated bacterial strain into MRS medium and culture at 37°C, 200 rpm for 8 hours.
2. Subculture at a 1% inoculation ratio into SMRS medium containing 2% glycine. Culture at 37°C, 200 rpm for 8 hours.
3. Centrifuge at room temperature, 10000 rpm for 3 minutes to collect the bacterial cells.
4. Wash the cell pellet with SMM buffer.
5. Resuspend and enzymatically digest the cells using SMM buffer containing 30 mg/mL lysozyme at 37°C for approximately 30 minutes.
6. After digestion, wash the cells thoroughly 1-2 times with pre-chilled 15% glycerol.
7. Resuspend the cells in pre-chilled 15% glycerol, aliquot 80 μL per tube, and store at 4°C or -80°C for later use.

Method 2:
1. Resuspend 12 ml of an activated culture in the logarithmic growth phase in 1 ml of ice-cold ultrapure water, and wash twice.
2. Resuspend the cells in 1 ml of 50 mM EDTA and keep on ice for 5 minutes.
3. Wash once in ultrapure water.
4. Wash twice in 0.3 M sucrose solution.
5. Resuspend in 360 μl of 0.3 M sucrose and temporarily store at 4°C for subsequent electroporation.

Ⅱ. Plasmid Transformation via Electroporation

Note: Maintain low-temperature conditions on ice during electroporation
1. Take 80 μL of competent cells, add 1-2 μL of plasmid DNA (concentration 1 μg/μL), mix gently, and incubate on ice for 5 minutes.
2. Transfer the mixture into a pre-chilled 1 mm electroporation cuvette. Perform electroporation under the following conditions: Electric field strength 2 KV/cm, Resistance 200 Ω, Capacitance 25 μF.
3. Immediately after the pulse, add 1 mL of pre-chilled MRS broth (without Tween 80), mix gently, and incubate on ice for 5 minutes. Then, incubate at 28°C for 3 hours.
4. Spread 200/100 μL of the electroporated culture onto MRS solid medium plates containing erythromycin. Incubate at 37°C. Once single colonies appear, pick them for PCR verification.
5. As a negative control for colony PCR, spread competent cells that did not undergo electroporation onto a plate and pick single colonies after they grow.

Ⅲ. Precautions

Electroporation Cuvette Reuse and Cleaning

1. Post-Use Cleaning of Electroporation Cuvettes:

a. Water Rinse: After use, rinse the cuvette extensively with tap water to remove residual bacterial culture and other matter. Then, rinse multiple times with deionized water to replace the tap water.
Alternative: Perform ultrasonic cleaning with ultrapure water for about 30 minutes, twice, to remove contaminants from the cuvette gap.
b. Ethanol Soak: Soak the cuvette in a 75% ethanol solution for about 2 hours for initial sterilization.
Alternative: Perform ultrasonic cleaning with 75% ethanol for 30 minutes, twice.
c. Water Rinse: Remove the cuvette and rinse it with deionized water at least 3 times. Then, use a 1 mL pipette to repeatedly aspirate and dispense ddH₂O into the cuvette chamber more than 10 times. Shake dry. d. Dehydration with Absolute Ethanol: Fill the cuvette with absolute ethanol for dehydration.
e. Storage: Air-dry thoroughly under a laminar flow hood, place in a sterile container, and store at -20°C (to prevent microbial growth).

2. Pre-Use Treatment of Previously Used Electroporation Cuvettes:

a. Water Rinse: Take the dry-stored cuvette from the freezer. Inside the laminar flow hood, add ddH₂O and use a 1 mL pipette to aspirate and dispense twice inside the chamber. Shake dry.
b. Ethanol Rinse: Inject 75% ethanol into the chamber and use a 1 mL pipette to aspirate and dispense twice. Shake dry.
c. UV Sterilization: Arrange the cuvettes upright directly under the UV lamp in the hood. Align the electrode gap parallel to the lamp tube, and orient the inner surface of the cuvette lid towards the UV lamp to ensure direct UV exposure to the interior. UV sterilize for ~20 minutes.
d. Sterile Water Rinse: Rinse the cuvette twice with sterile ddH₂O and shake dry.
e. Pre-cooling: Place the cuvette on ice for pre-cooling. Allow ventilation in the laminar flow hood to further dry the interior of the cuvette before proceeding with the subsequent transformation steps.

Colony PCR

Ⅰ. Experimental Materials

1. Biological Materials

Colonies to be tested: Transformed Lacticaseibacillus rhamnosus (Experimental group

Positive control: Escherichia coli containing the target plasmid

Negative control: Lacticaseibacillus rhamnosus with empty vector

2. Reagents

PCR Pre-mix: 2× Taq Master Mix (contains dye)

Primer pairs

Colony lysis solution: 20 mM NaOH containing 0.5% SDS

TE Buffer: 10 mM Tris-HCl, 1 mM EDTA

Agarose gel electrophoresis reagents: 1× TAE Buffer, 1.5% agarose gel (contains GelRed nucleic acid dye), DNA molecular weight standard

3. Equipment

PCR machine, Gel electrophoresis system, Gel imaging system, Constant temperature incubator, Micropipettes and sterile tips

Ⅱ. Experimental Procedure

① Experimental Preparation:

Turn on the metal bath and set it to 95°C. Prepare MRS agar plates with erythromycin resistance, a marker pen, lysis solution, EP tubes, sterilized pipette tips, etc.

② Colony Preparation (Aseptic Technique):

Pick single colonies from the transformation plate and pre-culture them at marked positions on a new MRS plate. Partition the bottom of the petri dish with a marker pen, inoculating only one colony type per sector. Strain names can be written on the lid, but sector divisions and numbers must be marked on the bottom of the dish. Use a 10μL pipette tip to pick a single colony, inoculate it onto the correspondingly labeled sector of the new plate to ensure transfer, and then place the tip with the attached colony directly into the lysis solution (the tip can be expelled into an EP tube containing lysis solution). Continue picking the next colony. Mark each tube to correspond with the marking on the new plate.

③ Colony Lysis & Template Preparation

1. Lysis Solution Method:

Add 20 μL of lysis solution (20 mM NaOH + 0.5% SDS) to a PCR tube/EP tube. Gently touch a colony with a sterilized 10μL pipette tip, first inoculate it onto the new plate, then resuspend it in the lysis solution. Heat at 95°C for 10 minutes, immediately place on ice for 2 minutes, add 180 μL of TE Buffer (or ddH₂O) to neutralize, centrifuge at 12,000 × g for 2 minutes, and use the supernatant as the template.

2. Boiling Method:

Suspend the colony in 50 μL of sterile water. Heat at 95°C for 10 minutes, centrifuge at 12,000 × g for 5 minutes, and use the supernatant as the template.

④PCR Reaction System

Component	Volume
2× Taq Master Mix	10 μL
Forward Primer (10 μM)	1 μL
Reverse primer (10 μM)	1 μL
Template DNA	2 μL
ddH₂O	6 μL

⑤PCR Reaction Program

Step	Temperature	Time	Number of Cycles
Initial denaturation	95 ℃	5 min	1
Denaturation	95 ℃	30 sec	30
Annealing	55 ℃	30 sec	—
Extension	72 ℃	45 sec/kb	—
Terminal extension	72 ℃	5 min	1
Save	4 ℃	∞	—

Note: Optimize the annealing temperature according to the primer Tm values.

⑥Electrophoresis Analysis

Prepare a 1% agarose gel containing nucleic acid dye. Load the samples and perform electrophoresis at 120 V. Conduct gel imaging analysis after 25-30 minutes.

Plasmid Target Fragment and Primer Information

Module	Serial Number	Resistance	expression	Plasmid Size	Primer Name	Sequence (5' to 3')
Sensing Module	1	Erythromycin	8852-eGFP	352bp	Pnps-F Pnps-R	CGGATTTTACGCCGTGTACTGG GACTAACGGCAACCCACTGTCC
	2	Erythromycin	8852-eGFP	728bp	medi8852-F medi8852-R	CTGTCTTCCTACACTCACTG TGGCAGGGTAAAGTCAGTA
Response Module	3	Erythromycin	8852-mCherry	714bp 839bp	8852-F 8852-R ZT-pho-F pho-R	CAGGTCTGGTTAAACCGTCTC CTTTGATTTCTACCTTGGTGCC CACGTGCTGTAATTTGAAGC CTGTCGAAGTATTGCTGGTAC
	4	Erythromycin	1G01-mCherry	822bp 839bp	1G01'-F 1G01'-R ZT-pho-F pho-R	GTTCAGCTGGTCGAATCTGG GATGGCCATGTTATCCTCCTC CACGTGCTGTAATTTGAAGC CTGTCGAAGTATTGCTGGTAC
Security Module	5	Erythromycin	MazF	618bp	ZT-MazF'-F MazF'-R	TGTCAGATAGGCCAATGACTG CCAATCAGTACGTAAAATTTGGC
	6	Erythromycin	CI-qR-GFP-srrA	867bp	CI-R ZT-CI-F	TATATTACAGCTCCAGATCTACCG CACTGACTAGCGATAACTTTCC
	6	Erythromycin	YF1-FixJ-FixK2-GFP	835bp	FixJ-YF1-F ZT-FixJ-YF1-R	TTTCTTCACCACCAAGGACAC GGTCGACAATGAGTGAGCTAAC
	7	Erythromycin	GFP	1072bp	ZT-GFP-F GFP-R	CAACACGTGCTGTAATTTGAAGC CACTTGTACAGCTCGTCCATG
	8	Erythromycin	RNAthermo-GFP	1110bp	ZT-GFP-F GFP-R	CAACACGTGCTGTAATTTGAAGC CACTTGTACAGCTCGTCCATG
	9	Erythromycin	TlpA-pTlpA-GFP	853bp	ZT-pTlpA-GFP-F GFP-R	CATAAGGGAGAGCGTCGAGATC CACTTGTACAGCTCGTCCATG
	10	Erythromycin	TlpA-pTlpA-GFP	1456bp	ZT-TlpA-F tlpA-R	CGGCGTAGAGGATCGAGATCT CTGGCCACCGGTCTGTTTATTG

Fluorescent Verification

Plasmid Expression, Secretion Localization, and Viral Response Kinetics in Genetically Engineered Probiotics

Ⅰ. Experimental Materials

Strains and Plasmids:

Recombinant Lacticaseibacillus rhamnosu, Empty vector control strain

Virus and Reagents:

Inactivated influenza A virus (H1N1-PR8 strain), MRS medium, Erythromycin, PBS buffer, etc.

Equipment:

Blue light gel excision instrument, Fluorescent microplate reader, Constant temperature shaker, Centrifuge, etc.

Ⅱ. Experimental Procedure

Bacterial Culture:

Inoculate recombinant and control strains into 5 mL of MRS medium containing antibiotics, and culture overnight at 37°C.

Centrifuge at 5000 × g for 10 min to collect the bacterial cells. Wash the pellet three times with PBS.

Fluorescence Expression:

Inoculate the recombinant bacteria into a 96-well plate with black walls and a clear bottom, using 200μL per well.

Place the plate under UV or blue light to observe fluorescence plasmid expression either at different time points under the same treatment conditions or under different treatments at the same time point.

Use ImageJ for fluorescence intensity data analysis: Extracellular fluorescence intensity = Total fluorescence - Intracellular fluorescence.

Influenza Virus HA Hemagglutination Assay

The hemagglutination inhibition (HI) assay is a traditional serological method used to detect antibodies in serum that can inhibit the hemagglutination activity of influenza A viruses. This assay is based on the property of the influenza A hemagglutinin (HA) to bind to red blood cells, causing agglutination. If antibodies against HA are present in the serum, they will inhibit the viral hemagglutination. By measuring the maximum dilution of serum that inhibits agglutination, the antibody level can be quantified.

After culturing the influenza virus, we typically determine the titer of the cultured virus via the hemagglutination assay. The hemagglutinin (HA) on the surface of the influenza virus can cause agglutination of specific red blood cells, allowing for rapid estimation of the influenza virus titer.

1. Incubate the engineered bacteria and wild-type bacteria with inactivated influenza A virus at 37°C for 2 hours.

2. Take the 1% chicken red blood cell (RBC) suspension, centrifuge at 1000 rpm for 10 min, discard the supernatant, and resuspend/wash the pellet with PBS. Repeat this process three times until hemolyzed cells are removed and the supernatant appears clear after centrifugation.

3. Add 50 μL of PBS to each well of a V-bottom microtiter plate. Add 50 μL of each sample to be tested to the wells of the first row, using three wells per sample type.

4. Using a multichannel pipette, serially dilute the mixture by transferring 50 μL from the wells in the first row to the corresponding wells in the subsequent rows (a 2-fold serial dilution across 8 rows). Discard 50 μL from the final row after mixing, so that all wells contain a final volume of 50 μL.

5. Add 50 μL of the RBC suspension to each well. Let the plate stand at room temperature for 30 minutes and then observe the results.

6. For result interpretation, lift the plate and tilt it at an angle towards the ground. Observe the wells from the back. In wells where agglutination did not occur, the RBCs will stream down in a tear-shaped pattern due to gravity. Record the observations.

Note: Retain one row of wells without any added virus sample as a negative control. No agglutination should occur in these control wells.

ELISA

Enzyme-Linked Immunosorbent Assay

It is used for the quantitative detection of specific antibodies against influenza A virus in serum. The ELISA method offers advantages of high sensitivity and high throughput. By measuring the amount of antibody binding, the strength of the immune response to the virus in the host can be assessed.

1. Coating: inactivated influenza A virus in 1* PBS to a total volume of 10ml. Add 100μl per well to a 96-well ELISA plate. Incubate overnight at 4°C.

2. Washing: Wash the plate 5 times with washing buffer (1* PBST: 1L PBS + 500μl Tween-20). Tap the plate dry after washing.

3. Blocking: Prepare 20ml of 5% skimmed milk. Add 200μl per well. Incubate overnight at 4°C.

4. Washing: Wash the plate 5 times with washing buffer (1* PBST). Tap the plate dry.

5. Primary Antibody: Add 100μl of PBS to each well. Add 100μl of engineered bacterial culture and wild-type bacterial culture (with similar OD₆₀₀ readings) to the wells of the first row. Mix well, then transfer 100μl from the first row to the second row. Continue this serial dilution across the plate. Place the entire plate in a sterile 37°C incubator and incubate for 2 hours.

6. Washing: Wash the plate 5 times with washing buffer (1* PBST). Tap the plate dry.

7. Secondary Antibody: Add 100μl per well of 5% skimmed milk containing His-tag antibody. Incubate in a sterile 37°C incubator for 1 hour.

8. Washing: Wash the plate 5 times with washing buffer (1* PBST). Tap the plate dry.

9. Color Development: Add 100μl of chromogenic substrate solution per well. Develop color in the dark for 15 minutes.

10. Stop Reaction: Add 50μl of stop solution per well. Measure the OD₄₅₀.

Bacterial Cell Membrane Lysis

1. Centrifuge 10ml of bacterial culture, discard the supernatant, and transfer the pellet to a 50ml centrifuge tube.

2. Add 15ml of lysis buffer and resuspend the pellet thoroughly using a pipette.

3. Secure the centrifuge tube in a beaker filled with ice and a small amount of ice water. Set the ultrasonic cell disruptor parameters: Power 30%, Total Time 30 minutes, Pulse: ON for 2s, OFF for 8s. Select a 6mm ultrasonic probe tip and immerse it approximately 2cm below the liquid surface at the center. Begin cell lysis.

4. After lysis, wipe the probe with 75% ethanol and rinse with ddH₂O, then dry.

5. Centrifuge the lysate at 4000 rpm for 5 minutes. Collect the supernatant.

GFP Expression

Regulated Expression of Heat-Induced TlpA

1. Picking Colonies:

Pick colonies from a solid agar plate, categorizing them into experimental group, negative control group, and positive control group. Inoculate the picked colonies into 5 ml of MRS medium containing erythromycin. Culture overnight at 30°C.

2. Inoculation and Divided Induction:

Take the overnight culture and inoculate 1% of it into 5 ml of MRS medium containing erythromycin. Incubate statically at 30°C for 10 hours.

3. Fluorescence Intensity and OD₆₀₀ Measurement:

Divide the culture for induction at different temperatures (30°C, 37°C, 45°C). Simultaneously, prepare a 96-well plate with 190μl PBS per well. After 3 hours of induction, add 10μl of each sample to the wells. Measure fluorescence intensity and OD₆₀₀ using a microplate reader. Use MRS medium as a negative control.

4. Data Analysis:

Use the formula Fl/OD = [Fl(sample) - Fl(blank)] / [OD₆₀₀(sample) - OD₆₀₀(blank)] to correct for background fluorescence. Repeat the experiment three times, calculate the average, and remove outliers.

GFP Expression

Regulated Expression of Heat-Induced RNA (ROSE)

1. Picking Colonies

Pick colonies from the solid agar plate, categorizing them into experimental group, negative control group, and positive control group. Inoculate the picked colonies into 5 ml of MRS medium containing erythromycin. Culture overnight at 28°C.

2. Inoculation and Divided Induction

Take the overnight culture and inoculate 1% of it into 5 ml of MRS medium containing erythromycin. Incubate statically at 28°C for 12 hours.

3. Fluorescence Intensity and OD₆₀₀ Measurement

Divide the culture for induction at different temperatures (28°C, 30°C, 37°C). Simultaneously, prepare a 96-well plate with 190μl PBS per well. At time points 0.5h, 1h, 3h, and 5h after induction, add 10μl of each sample to the wells. Measure the fluorescence intensity and OD₆₀₀ values using a microplate reader. Use MRS medium as a negative control.

4. Data Analysis

Promoter Expression

Small Molecule Peptide (IF) Induction Experiment

1. Pick a positive transformation clone and inoculate it into 5 ml of MRS broth medium containing erythromycin. Culture overnight at 37°C.

2. Dilute the culture 1:100 into 50 ml of MRS broth medium containing erythromycin. Culture at 37°C for 8 hours.

3. Add synthetic IF-673, setting up concentration gradients: 0 ng/ml (control), 25 ng/ml, 50 ng/ml, 100 ng/ml. Continue incubation at 37°C for 30 minutes. Select the appropriate concentration gradient for subsequent induction experiments.

Blue Light and Natural Light Induction

Functional Verification of YF1-FixJ-FixK2-GFP

(YF1-FixJ-FixK2-GFP)

1. Picking Colonies

2. Inoculation and Divided Induction

Take the overnight culture and inoculate 1% of it into MRS medium containing erythromycin. Culture statically in darkness for 8 hours.

3. Fluorescence Intensity and OD₆₀₀ Measurement

Monitor the change in OD₆₀₀ value and measure the fluorescence intensity / OD₆₀₀ value using a microplate reader.

Prepare a 96-well plate, adding 190μl PBS to each well. 3 hours later, add 10μl of sample to each well. Measure the fluorescence intensity / OD₆₀₀ value using the microplate reader, using MRS medium as a negative control.

4. Data Analysis

Repressor Protein Induction

Functional Verification of the CI-pR-GFP

1. Picking Colonies

2. Inoculation and Divided Induction

Take the overnight culture and inoculate 1% of it into MRS medium containing erythromycin. After static culture for 8 hours, add the IF-673 inducer.

3. Fluorescence Intensity and OD₆₀₀ Measurement

Closely monitor the change in OD₆₀₀ value and measure the fluorescence intensity / OD₆₀₀ value using a microplate reader.

Prepare a 96-well plate, adding 190μl PBS to each well. 3 hours later, add 10μl of sample to each well, and measure the fluorescence intensity / OD₆₀₀ value using the microplate reader, using MRS medium as a negative control.

4. Data Analysis