| Accession Number | Region | Group | Subgroup |
|---|---|---|---|
| AY535660.1 | Estonia | Group M | A, CRF03_AB |
| EU541617.1 | USA | Group M | B |
| AF224507.1 | South Korea | Group M | B |
| GU177863.1 | China | Group M | B | MW754307.1 | USA | Group M | B |
| KT284371.1 | USA | Group M | B, H |
| EU031915.1 | Malaysia | Group M | B, CRF01_AE |
| OK662987.1 | China | Group M | B, CRF01_AE |
| KC156129.1 | South Africa | Group M | C |
| MT195527.1 | Zambia | Group M | C |
| MT194478.1 | Zambia | Group M | C |
| MZ766722.1 | Botswana | Group M | C |
| MT194176.1 | Zambia | Group M | C |
| MZ766696.1 | Botswana | Group M | C |
| AY586549.2 | Cuba | Group M | G |
| AY970948.1 | Netherlands | Group M, N | H |
| FJ185260.1 | Vietnam | Group M | CRF01_AE |
| AF407419.1 | France | Group O | NA |
| AY623602.1 | Cameroon | Group O | NA |
| AY618998.1 | Cameroon | Group O | NA |
| Table 1: Table of HIV-1 sequences all retrieved from NBCI Database, listing accession numbers, geographic origins, group classifications, and subtypes. Pink shading indicates one conserved region found and shared by 11 sequences. Red shading indicates three conserved regions shared by a subset of 4 sequences. | |||
The purpose of evaluating the secondary structure and folding free energy of our top RNA strands is to make sure they can reliably bind to the Cas13a protein. If the RNA folds differently each time, it might interfere with the formation of the Cas13a–RNA complex (called the RNP complex).
Like in other CRISPR/Cas systems (Cas9, Cas12, etc.), the guide RNA (crRNA) needs to form a specific structure: a single stem loop. This loop is the docking site for the Cas protein. For our designs, the predicted RNA structures must consistently form this stem loop. Because stem loops are stable and form naturally with a low free energy (ΔG), they are energetically favorable and more reliable.
Below are our three most preferred sequences, with secondary structure predictions and corresponding graphs of free energy (ΔG) throughout each structure. You will notice that each free energy graph contains a large negative spike at some position on the RNA strand. This is indicative of our RNA stem loops, as their formation is very energetically favorable.
| Guide RNA | Sequence | MFE (ΔG) |
|---|---|---|
| gRNA 1 | UUUCUCUUACAGCAGGCCAUCCAACUAU | -41.8 kcal/mol |
| gRNA 2 | GGAGACUCCAUGACCCAAAUGCCA | -34.24 kcal/mol |
| gRNA 3 | CUCUCCUUCUAGCCUCCGCUAGUCAAA | -40.19 kcal/mol |
| Table 2: Summary of top gRNA candidates with folding stability metrics. | ||
Figure 1. Left column represents 2D analysis of crRNA folding using RNAfold. Key components consist of a single stem loop on each structure. Right column represents free energy of folding (ΔG) for each crRNA. Large spikes indicate major energetically-favorable folding conformations, such as stem loops.
These three gRNAs will next be synthesized and tested in our Cas13a cleavage assays using HIV mimic plasmids.