Overview

APHiGO aims to combat aphid damage to citrus crops through safe and eco-friendly treatments, addressing the shortcomings of existing chemical methods that result in environmental pollution. As described on the project webpage, the application of chemical pesticides often leads to unavoidable chemical residues, jeopardizing the health and balance of organisms in the treated areas and even triggering the frightening consequences of chemical resistance. To demonstrate that APHiGO is a viable new approach for managing citrus aphid infestations, we have outlined our validation logic in detail on the Experiment website. In this section, we will comprehensively present the key results from each of the validation modules.

Detection Module

Detection Module Results

To monitor changes in aphid population density and thereby predict the optimal pesticide application time, we constructed an engineered Bacillus subtilis strain capable of responding to sucrose—one of the main components of honeydew (aphid excrement). We designed a recombinant plasmid pgrac100-MS that can convert sucrose into methyl salicylate (MeSA) and successfully transformed it into Bacillus subtilis 168Δ4. After induction with sucrose, quantitative analysis via liquid chromatography-mass spectrometry (LC-MS) showed that the MeSA yield reached 1.595 ng·mL⁻¹/OD under the induction concentration of 8%. This engineered bacterium lays the foundation for both the strain and quantitative method required for the early warning of citrus aphids.

View Details →

RNA interference therapy

RNA interference therapy Results RNA interference therapy Results

To screen for the RNA form with the highest insecticidal efficiency and its corresponding production method, we carried out the optimization of RNA production conditions and analyzed the silencing and lethal effects. By adopting the bidirectional promoter and multi-terminator production strategy described by Juliana da Rosa、SJ Ross et al., we successfully achieved the efficient preparation of RNA molecules. At the same time, the fourth-generation RNA molecule we constructed using two natural miRNA scaffolds from aphids, api-mir-71 and api-mir-3017a, exhibited a high aphid mortality rate of up to 60% after being applied at a concentration of 800 ng/μl for 120 hours.

View Details →

Delivery Module

VLP Delivery System Results

The susceptibility of RNA molecules to degradation during delivery is a major bottleneck restricting their clinical application. To improve RNA stability, we developed a virus-like particle (VLP)-based delivery system, specifically engineering MS2 VLPs capable of specifically packaging amiRNA via genetic engineering approaches. MS2 VLPs are non-replicating nanoparticles based on the capsid protein of bacteriophage MS2, exhibiting icosahedral symmetry. Herein, we successfully validated the integrity of the capsid structure of this delivery system and its effective resistance to nucleases, and further explored the feasibility of delivering it to the shoots of trees through trunk injection.

View Details →

Fungal Contact-Killing Module

Metarhizium Transformation Results

To enhance the virulence of Metarhizium, we modified Metarhizium via an Agrobacterium-mediated genetic transformation method to express target RNA molecules. This method is based on the ability of Agrobacterium to transfer the T-DNA region on its Ti plasmid into host cells, thereby achieving the integration of the target gene. During the transformation process, Agrobacterium delivers T-DNA into host cells through its secretion system and integrates the target gene into the Metarhizium genome, ensuring the stable expression of the target gene in the fungus. Here, we successfully verified the ability of the transformed Metarhizium to express the target RNA, and further analyzed the virulence of Metarhizium at the phenotypic level.

View Details →

Detection module

Background Information

In March 2025, we conducted a research survey in Shanwei, Guangdong Province—a region with a high incidence of citrus aphid infestations. It was found that citrus aphids are tiny in size and often hide on the undersides of leaves, making them difficult to detect. This frequently causes farmers to miss the optimal pesticide application time. Based on this observation, the team aimed to develop a biosensor component capable of responding to the population density of citrus aphids.
Aphids excrete honeydew immediately after feeding; the amount of honeydew is positively correlated with their population density, and one of its main components is sucrose Using this characteristic, we designed and constructed a biosensor that can respond to sucrose signals. Taking Bacillus subtilis—a biocontrol bacterium approved as a biopesticide—as the chassis, we implanted the following genetic components: ① a sucrose-sensing element; ② the pchBA gene cluster (which can convert chorismate, a metabolic product of sucrose, into salicylic acid (SA));③BSMT methyltransferase (which can convert salicylic acid into volatile MeSA) Furthermore, the methyl salicylate produced by this engineered bacterium can be recognized by hardware devices, enabling real-time monitoring of pest density. This fundamentally solves the problem of aphids being "difficult to detect" and advances the vision of precision agriculture and ecological sustainability.

Implementation Objectives

1. Construct an engineered Bacillus subtilis strain capable of expressing MeSA under sucrose induction.

2.Conduct a preliminary evaluation to determine whether the engineered strain can respond to changes in sucrose concentration, thereby expressing methyl salicylate at different concentrations.

Verification process

Plasmid construction

pgrac100 is a commonly used E. coli-Bacillus subtilis shuttle vector, containing two resistance genes (for ampicillin and chloramphenicol). When conducting protein expression in Bacillus subtilis, chloramphenicol can be used for screening.

We inserted the following genetic elements into the Multiple Cloning Site (MCS): ① sacB promoter, a sucrose-inducible promoter; ② Ribosome Binding Site (RBS); ③ pchA expression cassette: expresses isochorismate synthase, which catalyzes the conversion of chorismate to isochorismate; ④ pchB expression cassette: expresses isochorismate pyruvate lyase, which converts isochorismate into pyruvate and salicylate; ⑤ BSMT1 expression cassette: methylates salicylate to produce methyl salicylate (a volatile ester); ⑥ terminator.

pgrac100-MS recombinant plasmid

Fig 2-1. Schematic diagram of the pgrac100-MS recombinant plasmid.


Plasmid transformation

After constructing and amplifying the plasmid, we prepared competent cells of Bacillus subtilis 168Δ4 using the medium-alternating culture method and transformed both the empty vector and the recombinant plasmid into the cells. Single colonies clones were randomly picked from resistant plates, and after amplification, the plasmids were extracted for PCR and double digestion.Plasmid PCR showed that the empty vector control yielded a band at 1537 bp, while the recombinant plasmid showed the expected band at 1777 bp. The double digestion results each showed two bands corresponding to the plasmid vector and the digested fragment. The empty vector digestion product yielded a band at 776 bp, while the recombinant plasmid digestion product showed the expected band at 2968 bp. These results confirmed the successful construction and transformation of the recombinant plasmid.

pgrac100-MS recombinant plasmid transformation results

Fig 2-2. Results of pgrac100-MS recombinant plasmid transformation
(a) Growth of colonies on chloramphenicol-resistant plates after plasmid transformation.
(b) Agarose gel electrophoresis results of plasmid PCR and restriction digestion. M: DL5000 Marker; 1: PCR result of the empty vector, with the target band at 776 bp; 2: PCR result of the recombinant plasmid, with the target band at 2968 bp; 3: digestion result of the empty vector, with the target band at 1537 bp; 4: digestion result of the recombinant plasmid, with the target band at 1777 bp. The gel was prepared with 2% agarose and run at 120 V for 45 minutes.


Quantification of Methyl Salicylate by Liquid Chromatography-Mass Spectrometry

We induced the engineered Bacillus subtilis with sucrose at concentrations of 0%, 4%, and 8% (w/v) for 18 hours, and quantified methyl salicylate (MeSA) using liquid chromatography-mass spectrometry (LC-MS). Based on the standard curve, we confirmed after diluting 5 times the production of MeSA and determined the yields to be 1 ng·mL⁻¹/OD, 1.379 ng·mL⁻¹/OD, and 1.595 ng·mL⁻¹/OD, respectively.

methyl salicylate expression levels

Fig 2-3. Expression levels of methyl salicylate
(a) Standard curve of methyl salicylate.(b) Methyl salicylate concentrations induced by different sucrose concentrations (dilute 5 times and quantify). Since sucrose induction inhibits the growth of Bacillus subtilis to varying degrees, the expression levels were normalized using OD values to exclude the influence of cell number. The OD₆₀₀ values for induction at 0%, 4%, and 8% were 4.102, 3.263, and 2.194, respectively.


The PDF of the original file is provided below and can be viewed by clicking the link. The sample values represent the content after a 5-fold dilution.

Discussion

In this part of the experiment, we successfully constructed and transformed the pgrac100-MS recombinant plasmid, obtaining a genetically stable engineered Bacillus subtilis 168Δ4 strain. Through liquid chromatography-mass spectrometry (LC-MS), we initially verified that the constructed engineered strain can express MeSA.

However, in this experiment, the engineered Bacillus subtilis strain under 0% sucrose induction concentration was detected to produce 1 ng·mL⁻¹/OD of methyl salicylate, indicating that there is basal leakage in the system. Therefore, in subsequent experiments, we will test the methyl salicylate expression level of the empty vector and use it as a control. To further optimize this strain, we will attempt to introduce a more stringent sucrose operon, such as the suc dual regulation system, to reduce leaky expression.

In addition, on the basis of the qualitative verification in this module, we also initially confirmed that the engineered strain can respond to changes in sucrose concentration, thereby expressing methyl salicylate at different concentrations. In the future, we will establish a strict sucrose response gradient, and combine it with the aphid population density and the detection limit of the detection hardware to achieve a closed loop from qualitative response to quantitative early warning.

RNA interference therapy

Background Information

RNAi is an eukaryotic gene silencing mechanism that cuts RNA to form siRNA, assembles the RISC complex, and degrades target mRNA, leading to organism death. Due to its high specificity and environmental friendliness, RNAi has become a core technology for precise pest control in agriculture. It addresses key issues in citrus aphid management, such as pesticide resistance, environmental pollution, and poor stability of biological control methods. This module focuses on the entire RNAi process: screening essential aphid genes to ensure lethality; optimizing RNA design (upgrading from single-target dsRNA to dual/tri-fusion dsRNA, tri-shRNA, bi-amiRNA) to enhance efficiency and stability; utilizing bidirectional promoters and multiple terminators to achieve high-level dsRNA production and address transcription "read-through" issues; quantifying silencing efficiency via RT-qPCR and validating the effect of fourth-generation RNA through lethality tests. The goal is to optimize parameters and develop a practical control solution to support the green transformation of the citrus industry.

Implementation Objectives

1. Verify the quality of plasmid linearization products by electrophoresis, confirm that multiple T7 terminators are more conducive to efficient dsRNA transcription than a single terminator, and provide a reference for high-efficiency RNA production.

2. Validate the effectiveness of procedures such as plasmid transformation, double-enzyme digestion linearization, and in vitro transcription, and optimize the transcription system to ensure the stable synthesis of target dsRNA.

3. Clarify the insecticidal activity of the four generations of RNA against aphids. Focus on verifying the synergistic insecticidal effect of fused dsRNA, and evaluate the advantages of tri-shRNA and bi-amiRNA to support product iteration.

Verification process

Optimization of a high-efficiency in vitro dsRNA production system

▼

The results showed that a transcription duration of 6 hours enabled relatively high yield in a short time. By optimizing the template with 3-tandem terminators and reverse-designed 3-tandem terminators, the phenomenon of transcription read-through was reduced. Compared with the template without terminators, the yield of dsRNA synthesized via in vitro transcription using the 3-tandem terminator template was increased.

Figure 3-3

Fig 3-3. (a) Significance analysis of transcription product concentrations for NT, 1T, 2T, and 3T templates at 1-fold dilution; (b) significance analysis of transcription product concentration for NT, 1T, 2T, and 3T templates at 5-fold dilution; (c) significance analysis of transcription product concentration for NT, 1T, 2T, and 3T templates at 10-fold dilution; (d) linear regression curves showing the relationship between dilution ratio and concentration.

If you are interested, please click here to learn more about our detailed experimental procedures.

Single-target dsRNA Stage

▼

For the verification of dsCYP450 and dsCP, nuclease-free water was used as the control, and aphid nymphs were treated with the corresponding dsRNA solutions at 800 ng/μl. The aphid pretreatment, preparation of feeding devices, and culture conditions were all consistent with those of the CHS dsRNA experiment, ensuring the efficiency of dsRNA absorption and the comparability of data. Results calculated using the same mortality correction formula showed that at 120 hours, the corrected mortality rate of aphids in the 800 ng/μl dsCP treatment group reached 30%, which was significantly higher than the 20.48% of dsCHS at the same concentration; the corrected mortality rate of the dsCYP450 treatment group further increased to 31.4%, showing the strongest lethal activity among the three single-target dsRNAs.

Figure3-10

Fig 3-10. (a): Cumulative mortality rates of Toxoptera citricida (brown citrus aphids) treated with 400 ng/μl dsCHS and 800 ng/μl dsCHS, compared with the control group, at 6 h, 12 h, 24 h, 36 h, 48 h, 60 h, 72h, 84h, 96h, 108h and 120 h post-treatment. Figure (b): Cumulative mortality rates of Toxoptera citricida (brown citrus aphids) treated with 800 ng/μl dsCHS, 800 ng/μl dsCYP450, and 800 ng/μl dsCP, compared with the control group, at 6 h, 12 h, 24 h, 36 h, 48 h, 60 h, 72h, 84h, 96h, 108h and 120 h post-treatment.

If you are interested, please click here to learn more about our detailed experimental procedures.

Fused multi-target dsRNA

▼

The results showed that after 5 days, the corrected mortality rate of aphids in the dsF2 treatment group reached 40.8%, which was significantly higher than that of the single-target dsRNA (maximum 31.4%); the corrected mortality rate in the dsF3 treatment group further increased to 44.9%, which was not only superior to the single-target dsRNA but also higher than the dual-fusion dsRNA (Fig 3-15. (a)). These findings fully confirm the synergistic effect of the dual-target RNAi strategy and further highlight the stronger insecticidal advantage of triple-target synergy.

Figure 3-15

Figure 3-15.(a): Cumulative mortality rates of brown citrus aphids treated with 800 ng/μl dual-fusion dsRNA (dsF2) or triple-fusion dsRNA (dsF3) at 6 h, 12 h, 24 h, 36 h, 48 h, 60 h, 72 h, 84 h, 96 h, 108 h, and 120 h, compared with the control. Figure (b): Relative expression levels of CHS and CYP450 in brown citrus aphids treated with 800 ng/μl dsF2 for 120 h, compared with the control.Error bars represent the standard deviation (SD) derived from at least three biological replicates. All datasets were statistically analyzed using a Student's t-test (*P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001). Figure (c): Relative expression levels of CHS, CYP450, and CP19(CP) in brown citrus aphids treated with 800 ng/μl dsF3 for 120 h, compared with the control.Error bars represent the standard deviation (SD) derived from at least three biological replicates. All datasets were statistically analyzed using a Student's t-test (*P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001).

If you are interested, please click here to learn more about our detailed experimental procedures.

Multitandem short hairpin RNA stage

▼

The results showed that after 120 h (5 days), the corrected mortality rate of aphids in the tri-shRNA treatment group reached 49.5% (Fig 3-18.), demonstrating effective killing of aphids and showing better insecticidal efficacy compared with the triple-fusion dsRNA (44.9%), thus providing a technical basis for subsequent RNAi product iteration.

Figure 3-18

Figure 3-18.Cumulative mortality rates of brown citrus aphids at 6 h, 12 h, 24 h, 36 h, 48 h, 60 h, 72 h, 84 h, 96 h, 108 h, and 120 h after treatment with 800 ng/μl tri-shRNA and in the control group.

If you are interested, please click here to learn more about our detailed experimental procedures.

bi-Artificial miRNA stage

▼

The results showed that after 120 h (5 days), the corrected mortality rate of aphids in the bi-amiRNA treatment group reached as high as 60.2% (Fig 3-22.), demonstrating the optimal insecticidal efficacy among the four generations of RNA molecules.

Figure 3-22

Fig 3-22. Cumulative mortality rates of brown citrus aphids at 6 h, 12 h, 24 h, 36 h, 48 h, 60 h, 72 h, 84 h, 96 h, 108 h, and 120 h after treatment with 800 ng/μL bi-amiRNA and in the control group (CTRL).

If you are interested, please click here to learn more about our detailed experimental procedures.

Summary

In this study, by optimizing the high-efficiency in vitro dsRNA production system, it was found that the use of multi-terminator templates significantly increased the yield of dsRNA, and 6 hours was determined as the optimal transcription duration. Furthermore, four generations of RNA molecules were designed and their insecticidal effects on citrus aphids were verified. The data in the table below clearly shows the mortality rate and silencing efficiency of each generation of RNA molecules. Among them, the fourth-generation artificial miRNA (bi-amiRNA) exhibited the highest aphid mortality rate after 120 hours, reaching 60.2%. These results provide an important basis for the development of efficient and specific RNAi-based control strategies against citrus aphids.

Table: Summary Table of RNAi Therapeutic Outcomes

Figure 3-24

Delivery System

Background Information

Virus-like particles (VLPs) are hollow protein nanoparticles self-assembled from one or more structural proteins of viruses. They are highly similar to natural viruses in size, shape, and surface structure, but the most fundamental difference is that they completely lack the viral genetic material (DNA or RNA); thus, they possess no replication or infection capabilities and exhibit high biosafety.

The core advantage of VLPs stems from their unique property of being "virus-like but not viruses": the highly ordered and repetitively arranged antigenic epitopes on their surface can be efficiently recognized by the immune system, thereby triggering strong humoral and cellular immune responses—making them an ideal platform for vaccine development. Currently, vaccines based on VLP technology, such as human papillomavirus (HPV) vaccines and hepatitis B vaccines, have been successfully marketed and widely used worldwide. Beyond prophylactic vaccines, VLPs also show great potential as multifunctional nanocarriers. Their internal cavity can load and protect nucleic acid drugs (mRNA, siRNA, shRNA), and they can achieve cell- or tissue-targeted delivery through engineering modifications like surface display technology. Therefore, they hold broad prospects in fields such as targeted drug therapy and gene editing. Among them, VLPs derived from MS2 viruses can specifically bind to nucleic acids with pac sequences and rapidly assemble into a polymer composed of 180 capsid proteins (CP).

This year, the SZU-China team successfully constructed a VLP vector platform using MS2 phage capsid proteins. Through surface display technology, they co-displayed the TAT transmembrane peptide (which enhances cell penetration) and the GBP3.1 peptide (which specifically targets aphid intestinal cells) on the particle surface, thereby endowing this VLP system with the function of cross-species targeted delivery. In this section, we will present the characterization of the engineered VLPs and their stress resistance.

Implementation Objectives

We aim to construct a virus-like particle (VLP)-based RNA delivery system to address the key challenge of RNA being easily degraded during delivery to aphids. We will prepare VLPs capable of efficiently packaging target RNA through genetic engineering methods and focus on evaluating their capsid integrity and resistance to exogenous nucleases, thereby providing experimental evidence for the development of a stable and efficient RNA delivery platform.

Verification process

Plasmid construction and Characterization of Protein

▼

The results showed that the eluate containing the target protein exhibited a distinct bright band at the predicted position, which is consistent with our prediction that the His-tagged VLPs have a molecular weight of approximately 29 kDa. This preliminarily confirms that we have successfully obtained the His-tagged VLP proteins.

Fig 4-5. SDS-PAGE analysis

Fig 4-5. SDS-PAGE analysis of the purified target protein expressed by pACYCDuet_1-CP-Histag-CP-amiRNA stained with Coomassie Brilliant Blue. Lane MW is the protein molecular weight marker; Lane 1 is the bacterial culture supernatant, Lane 2 is the flow-through during purification; Lanes 3 and 4 are the washing solutions in the purification process of the target protein, and Lanes 5–9 are the purified eluates. The theoretical molecular weight of the target protein is 28333.00 Da (approximately 28 kDa), and the actual size of the electrophoretic band is about 28 kDa, which is consistent with the theoretical molecular weight.

If you are interested, please click here to learn more about our detailed experimental procedures.

Characterization of MS2 VLPs

▼

In this experiment, we characterized the assembly of MS2 VLPs particles. Through TEM detection, individual particles showed uniform spherical structures with clear boundaries. These particle morphologies demonstrate that amiRNA and proteins can effectively assemble into VLPs nanoparticles.

TEM images of MS2 VLPs

Fig 4-8. Transmission Electron Microscopy (TEM) images of purified histidine-tagged MS2 phage-like particles (histidine-tagged VLPs). The scale bar represents 100 nanometers.

If you are interested, please click here to learn more about our detailed experimental procedures.

Verification of MS2 VLPs Function

▼

The results showed that, after treatment with Benzonase Nuclease at 37°C for 10 min, the naked RNA was completely degraded; under the same conditions, the RNA encapsulated within MS2 capsid proteins remained significantly protected, indicating that VLP particles exhibit remarkable stability against nucleases.

Nuclease resistance of VLPs

Fig 4-9. Agarose gel image showing the nuclease resistance of the assembled products.The gel was stained with Super Red nucleic acid dye to detect amiRNA. Lanes MW (leftmost and rightmost lanes) contain a DNA ladder (molecular weight marker). Lanes 1–4 contain 50 µM virus-like particles (VLPs) treated with 100 U/mL Benzonase nuclease at 37 °C for 0 min, 10 min, 20 min, and 30 min, respectively. Lanes 6–9 contain 500 nM amiRNA treated under the same conditions as the VLPs (100 U/mL Benzonase nuclease, 37 °C) for 0 min, 10 min, 20 min, and 30 min, respectively. Lane 5 is a blank control, and Lane 10 is a control containing capsid protein (CP) dimers without amiRNA.The results show that Lanes 1–4, corresponding to VLPs, exhibit a bright RNA band above 1000 bp. Because the RNA encapsulated within the capsid proteins has a large overall size, its migration speed in the gel is slower. It can be observed that the shorter the nuclease treatment time, the more distinct the band becomes. After nuclease treatment, VLP aggregates depolymerize and release amiRNA, thus a bright amiRNA band can be observed in the 100–200 bp range. Again, the shorter the nuclease treatment time, the brighter this band appears. Notably, under the condition of 0 min nuclease treatment, the RNA is encapsulated within the protein capsid, making it difficult to observe discrete RNA bands. Furthermore, the RNA content in Lane 1 (VLPs treated for 0 min) is higher than that in Lane 6 (amiRNA treated for 0 min). This is presumably because RNA is prone to degradation in the natural environment, and the amiRNA degraded rapidly during loading and electrophoresis. A comparison of the two groups of lanes reveals that RNA encapsulated in VLPs still exhibits a better protective effect in a high-nuclease environment.

If you are interested, please click here to learn more about our detailed experimental procedures.

Discussion

This collection of studies provides solid theoretical and experimental evidence for the core hypothesis—“MS2 Virus-Like Particles (VLPs) modified with GBP3.1 (aphid midgut-targeting peptide) and TAT (cell-penetrating peptide) enable efficient delivery of silencing small RNAs”—through systematic experiments spanning plasmid construction, VLP characterization, and functional validation.Based on the results in this section and the results regarding the tracking-based validation of the functions of GBP3.1 and the TAT cell-penetrating peptide (CPP) on the proof of concept (PoC) wiki page, we believe that achieving this objective is fully feasible.

The MS2 VLP system constructed in this study exhibits distinct advantages. Compared to traditional delivery methods (e.g., direct dsRNA spraying or unmodified VLPs), this system more effectively protects nucleic acids from degradation and significantly enhances cell-specific uptake efficiency due to the targeting capability of GBP3.1. In addition, unlike chemically synthesized polymeric nanocarriers, all components of this system possess excellent biodegradability and biocompatibility. Notably, VLP technology platforms have been extensively explored for drug delivery in humans, indicating that the system developed herein is an environmentally and human-friendly technology with broad application potential across multiple fields.

Currently, MS2 VLPs have been successfully self-assembled in Escherichia coli (E. coli). Transmission Electron Microscopy (TEM) observations revealed that their morphology does not consist of uniformly dispersed individual spherical particles; instead, they tend to aggregate in clusters. This finding is consistent with the report by LaNell A. Williams et al. (2024), who identified the stoichiometric ratio of components in the assembly system as a key factor determining VLP morphology. We hypothesize that the complexity of the intracellular environment in E. coli makes MS2 VLP difficult to precisely control this ratio, leading to the formation of capsid clusters. This represents one of the limitations of using in vivo expression systems for MS2 VLP production. Given this, the dimers of recombinant MS2 VLPs may hold great potential for RNA packaging in vitro. It is also crucial to evaluate the RNA protection efficacy of both VLP capsid clusters and dispersed morphologies. Importantly, the conformation of proteins fused to MS2 VLP dimers and their insertion sites appear to exert a significant influence on assembly stability. The final morphology of MS2 VLPs strongly depends on the conformation of the chimeric protein and its insertion site on the capsid, as well as the density of the targeting peptide. In-depth investigation into the regulatory mechanisms of these factors on VLP assembly will greatly expand the compatibility of MS2 VLPs with heterologous proteins. Notably, the use of covalent ligation systems such as SpyTag/SpyCatcher can effectively circumvent assembly challenges caused by the size or properties of fusion proteins, making this a highly promising solution.

In conclusion, the MS2 VLP system is poised to evolve into a modular RNA-based biopesticide delivery platform. Its application prospects are not limited to aphid control; by simply replacing the targeting peptide (e.g., with specific ligands targeting other pests or pathogens), the platform can be rapidly adapted to diverse biological scenarios. Therefore, establishing a modified modular platform for MS2 VLPs holds significant potential, demonstrating remarkable versatility and flexibility.

Fungal Contact-Killing Module

Background Information

As a type of natural entomopathogenic fungus, Metarhizium anisopliae (commonly known as green muscardine fungus) can germinate after its spores come into contact with the cuticle of brown citrus aphids. The germinated spores then differentiate to form a specialized infection structure—appressoria—which further penetrates the aphid’s cuticle, invades the hemolymph, and proliferates extensively. During this process, M. anisopliae secretes metabolites such as destruxins, which can disrupt the aphid’s tissue structure and ultimately lead to the aphid's death.Therefore, M. anisopliae has been registered as an environment-friendly biopesticide in many countries worldwide, and is currently widely used in the agricultural production of various crops such as citrus and rice.

Figure 5-1. Flowchart of Metarhizium Infecting Brown Citrus Aphids

Fig 5-1. Flowchart of Metarhizium Infecting Brown Citrus Aphids

However, the infection process of Metarhizium takes a certain amount of time, while brown citrus aphids reproduce extremely rapidly—this makes traditional biopesticides unable to completely eliminate the pests. In contrast, using genetic engineering to modify fungal strains for expressing host-derived small RNAs can effectively overcome the drawback of slow infection speed, achieving the desired pest control effect, especially during the local outbreak and migration of aphids.

Therefore, the SZU-China team designed dsRNAs targeting three genes of brown citrus aphids (the CHS gene, CYP450 gene, and CP19 gene), inserted them into the T-DNA region of the Ti plasmid, and then introduced them into Metarhizium via Agrobacterium-mediated transformation. After transformation, the target genes were integrated into the Metarhizium genome, enabling the stable expression of dsRNAs in Metarhizium anisopliae and ensuring their effective function.

Implementation Objectives

1. Using an Agrobacterium-mediated transformation method, the target fragment expressing the fusion dsRNA was inserted into the genome of Metarhizium anisopliae, enabling its stable expression in Metarhizium.

2. Clarify the infection effect of Metarhizium anisopliae on brown citrus aphids.

Verification process

Construction of plasmid pBar_PtrpC-dsF3

For the validation of the component function, we chose to carry it in the T-DNA of the pBar vector (kindly provided by Professor Duo Lai from Shenyang Agricultural University). This region contains a tryptophan constitutive promoter and a glufosinate resistance gene, which are used to screen for successfully transformed strains.Furthermore, the dsRNA we designed was inserted downstream of the tryptophan constitutive promoter (PtrpC), and transcription termination is mediated by the downstream tryptophan terminator (ttrpC) (see Fig 5-2.). Ultimately, we constructed a plasmid with a length of 10,376 bp, in which the T-DNA fragment will be inserted into the genome of Metarhizium via Agrobacterium-mediated transformation.This dsRNA is transcribed from an expression cassette consisting of a forward DNA sequence, a stem-loop, and a reverse DNA sequence, enabling simultaneous targeting of three genes in brown citrus aphids.

Figure 5-2. Schematic representation of the pBar_PtrpC-dsF3 plasmid

Fig 5-2. Schematic diagram of the plasmid pBar_PtrpC-dsF3-TtrpC.

Agrobacterium-mediated genetic transformation

The plasmid was first transformed into Agrobacterium. Successfully transformed Agrobacterium strains were able to grow normally on medium containing kanamycin, whereas strains transformed with the empty pBar vector could not grow. Single colonies from the resistant medium were picked for PCR verification, yielding amplified sequences of 711 bp and 955 bp in length (Fig 5-3. (a)), confirming that the transformed Agrobacterium carried the target plasmid. Under induction with acetosyringone (AS) and MES, Agrobacterium transferred the Ti plasmid into spores of Metarhizium anisopliae. After glufosinate resistance screening, successfully transformed Metarhizium strains were able to grow normally on SDAY medium containing cefotaxime and glufosinate, whereas Metarhizium transformed with the empty pBar vector could not grow (Fig 5-3. (b)).Twenty milligrams of mycelia from normally growing single-colony Metarhizium were used for genomic DNA extraction for PCR verification and for total RNA extraction for RT-PCR verification. The results showed that genomic amplification using primers F: gcccttcctccctttatttc and R: ctgacatcgacaccaacgat produced two distinct bands on a 1% agarose gel, with lengths of 711 bp and 955 bp (Fig 5-3. (c)). RT-PCR on RNA using the same primers yielded a distinct band of 80 bp on a 3% agarose gel (Fig 5-3. (d)), demonstrating that the T-DNA fragment had been inserted into the Metarhizium genome and was able to stably transcribe dsRNA.

Figure 5-3. Schematic representation of the verification process Figure 5-3. Schematic representation of the verification process

Fig 5-3. Validation results of Metarhizium engineered via Agrobacterium-mediated transformation for dsF3 production. (a) Agarose gel electrophoresis results of PCR verification for Agrobacterium transformed with the pBar_PtrpC-dsF3-TtrpC plasmid. M, DNA molecular weight marker (from top to bottom: 2000 bp, 1000 bp, 750 bp, 500 bp, 300 bp, 100 bp). 1–5, PCR results of transformed Agrobacterium AGL1 colonies. +, PCR result of the positive control plasmid. −, negative control. (b) Growth of transformed Metarhizium after transfer from M-100 medium to SDAY medium containing glufosinate. Mpbar, Metarhizium transformed with the empty vector. Mpbar-dsRNA-1 and Mpbar-dsRNA-2, Metarhizium transformed with the pBar_PtrpC-dsF3-TtrpC plasmid. (c) Agarose gel electrophoresis results of genomic PCR for transformed Metarhizium. M, DNA molecular weight marker (from top to bottom: 2000 bp, 1000 bp, 750 bp, 500 bp, 300 bp, 100 bp). 1, Genomic PCR of Mpbar-dsRNA-1. 2, Negative control for Mpbar-dsRNA-1. 3, Genomic PCR of Mpbar-dsRNA-2. 4, Negative control for Mpbar-dsRNA-2. 5, Genomic PCR of wild-type Metarhizium. 6, Negative control for wild-type Metarhizium. +, PCR result of the positive control plasmid. (d) Agarose gel electrophoresis results of RT-PCR using total RNA extracted from successfully transformed Metarhizium. M, DNA molecular weight marker (from top to bottom: 1000 bp, 700 bp, 500 bp, 400 bp, 300 bp, 200 bp, 100 bp). 1–5, RT-PCR results of Mpbar-dsRNA-1. −, RT-PCR result of wild-type Metarhizium.

Phenotypic Results of Infection by Engineered Metarhizium

To further confirm the virulence of the modified Metarhizium against brown citrus aphids, we scaled up the culture of the verified successfully transformed strains to prepare spore suspensions. The spore suspension was adjusted to a concentration of 1×10⁷ spores/mL. Tender citrus branches were placed in EP tubes filled with distilled water and fixed inside 50 mL centrifuge tubes. Brown citrus aphids were immersed in the spore suspension for 15 seconds, then transferred to the tender branches for cultivation.

It was observed that after 3 days, white mycelia grew on the aphid body surface and the aphids’ movement was restricted. After 6 days, the aphids died, the mycelia decreased, and green spores began to appear on their body surface. After 9 days, the aphid cadavers were fully covered with spores (see Fig 5-4.).

Figure 5-4 Part 2

Fig 5-4. Phenotypic results of brown citrus aphids infected by engineered Metarhizium. (a) Physiological state of brown citrus aphids without Metarhizium infection.(b) Physiological state of brown citrus aphids 3 days after infection with spores of the engineered Metarhizium.(c) Physiological state of brown citrus aphids 6 days after infection with spores of the engineered Metarhizium.(d) Physiological state of brown citrus aphids 9 days after infection with spores of the engineered Metarhizium.

Discussion

There are various types of natural fungi capable of infecting brown citrus aphids; however, their infection process takes too long, resulting in low pathogenicity against brown citrus aphids. Currently, the control effect of fungal preparations on brown citrus aphids is mostly unsatisfactory. Therefore, it is of great significance to improve the pathogenicity of fungal strains against brown citrus aphids through molecular approaches.

Metarhizium anisopliae was genetically modified via Agrobacterium-mediated transformation to express dsRNA that silences the CHS, CYP450, and CP19 genes of brown citrus aphids during infection, thereby enhancing the pathogenicity of the transgenic Metarhizium against brown citrus aphids. In this study, we successfully characterized the expression of this dsRNA and the phenotypic phenomena of brown citrus aphids infected by the engineered Metarhizium. However, due to time constraints, we aim to characterize the silencing effect of the transgenic Metarhizium on the three key genes of brown citrus aphids and determine its stability and biological activity in future research.

Based on the design of a responsible project, we expect to establish a model of the engineered Metarhizium biopesticide spreading in the field and infecting aphid populations, which simulates the process of the fungus spreading from treated plants to adjacent plants and causing infections. This result will provide guidance for farmers to determine the optimal spraying time, spraying location, and spraying dosage, enabling efficient, economical, and environmentally friendly aphid control. For detailed modeling, please refer to the "model" section.

Considering the safety issues of genetically modified microorganisms (GMOs) in application, we designed a safety switch system by referring to the designs of the previous NYMU_Taipei team and Hangzhou-SDG team and combining our own needs to ensure the safety of the engineered fungi. For detailed design, please refer to the "design" section.

Overlook

This year, the SZU-igem team has verified through multi-module experiments that the Aphigo Intelligent Citrus Aphid Management System is practical and valuable. The detection module uses engineered Bacillus subtilis to convert aphid honeydew signals into quantifiable MeSA gas, solving the "difficulty in detection" problem; the RNAi therapy module, after four generations of improvements, has increased the aphid mortality rate from 31.4% to 60.2%, and the optimized system is conducive to large-scale production; the delivery system uses MS2 VLPs as carriers to ensure the stable and efficient delivery of RNAi molecules; the fungal contact-killing module enables engineered Metarhizium to play a dual role, providing targeted prevention and control during the aphid outbreak period.

These achievements form a complete governance process of "early warning triggering → RNAi defense activation → fungal enhanced elimination," breaking through the limitations of traditional chemical pesticidesand conventional biological control. This system helps citrus growers achieve precise pest control, reduce costs and risks, and provides an innovative model of "synthetic biology + digital agriculture" for the green management of agricultural pests and diseases, thereby promoting the sustainable transformation of the citrus industry.

In the future, we are committed to transforming this innovative achievement into broader and deeper practical applications. With technology as the brush and green development as the ink, we will paint a new chapter of ecological harmony and industrial prosperity on the canvas of global agriculture, making the Aphigo Intelligent Management System a solid shield for safeguarding global agricultural ecological security and food security.

References

Click to EXPAND the content

[1]Le, D. T., & Müller, K. M. (2021). In Vitro Assembly of Virus-Like Particles and Their Applications. Life (Basel, Switzerland), 11(4), 334. https://doi.org/10.3390/life11040334

Ashley, C. E., Carnes, E. C., Phillips, G. K., Durfee, P. N., Buley, M. D., Lino, C. A., Padilla, D. P., Phillips, B., Carter, M. B., Willman, C. L., Brinker, C. J., Caldeira, J.doC., Chackerian, B., Wharton, W., & Peabody, D. S. (2011). Cell-specific delivery of diverse cargos by bacteriophage MS2 virus-like particles. ACS nano, 5(7), 5729–5745. https://doi.org/10.1021/nn201397z

Zakeri, B., Fierer, J. O., Celik, E., Chittock, E. C., Schwarz-Linek, U., Moy, V. T., & Howarth, M. (2012). Peptide tag forming a rapid covalent bond to a protein, through engineering a bacterial adhesin. Proceedings of the National Academy of Sciences of the United States of America, 109(12), E690–E697. https://doi.org/10.1073/pnas.1115485109

Cui, C., Wang, Y., Liu, J., Zhao, J., Sun, P., & Wang, S. (2019). A fungal pathogen deploys a small silencing RNA that attenuates mosquito immunity and facilitates infection. Nature communications, 10(1), 4298. https://doi.org/10.1038/s41467-019-12323-1

de Groot, M., Bundock, P., Hooykaas, P. et al. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat Biotechnol 16, 839–842 (1998).

Chemla, Y., Sweeney, C.J., Wozniak, C.A. et al. Design and regulation of engineered bacteria for environmental release. Nat Microbiol 10, 281–300 (2025).

Ashley, C. E., Carnes, E. C., Phillips, G. K., Durfee, P. N., Buley, M. D., Lino, C. A., ... & Peabody, D. S. (2011). Cell-specific delivery of diverse cargos by bacteriophage MS2 virus-like particles. ACS nano, 5(7), 5729-5745.

Rohovie MJ, Nagasawa M, Swartz JR. Virus-like particles: Next-generation nanoparticles for targeted therapeutic delivery. Bioeng Transl Med. 2017 Jan 19;2(1):43-57.

Williams, L. A., Neophytou, A., Garmann, R. F., Chakrabarti, D., & Manoharan, V. N. (2024). Effect of coat-protein concentration on the self-assembly of bacteriophage MS2 capsids around RNA. Nanoscale, 16, 3121–3132. https://doi.org/10.1039/D3NR03292B

Chen, Y., Shi, Y., Wang, Z., An, X., Wei, S., Andronis, C., Vontas, J., Wang, J.-J. and Niu, J. (2025) dsRNAEngineer: a web-based tool of comprehensive dsRNA design for pest control. Trends in Biotechnology.

Vert, J. P., Foveau, N., Lajaunie, C., & Vandenbrouck, Y. (2006). An accurate and interpretable model for siRNA efficacy prediction. BMC Bioinformatics, 7, 520. https://doi.org/10.1186/1471-2105-7-520

Weber, J. L., & Myers, G. W. (1997). Human whole-genome shotgun sequencing. Genome Research, 7(5), 401–409. https://doi.org/10.1101/gr.7.5.401

Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R. J., Sutton, G. G., ... Zhu, X. (2001). The sequence of the human genome. Science, 291(5507), 1304–1351. https://doi.org/10.1126/science.1058040

Marçais, G., Pellow, D., Bork, D., Orenstein, Y., Shamir, R., & Kingsford, C. (2017). Improving the performance of minimizers and winnowing schemes. Bioinformatics, 33(14), i110–i117. https://doi.org/10.1093/bioinformatics/btx235