Contributions
Aptamer Part Collection

Basic Parts

Part Name Part Number Part Type Description
P5 Progesterone-Binding Aptamer BBa_25RL79ZC Oligo [SO:0000696] A single-stranded DNA aptamer that binds progesterone with high affinity (KD = 2.03 ± 3.24 nM).
P6 Progesterone-Binding Aptamer BBa_259N4X3Q Oligo [SO:0000696] A single-stranded DNA aptamer that binds progesterone with high affinity (KD = 0.57 ± 0.84 nM).
P4G03 Progesterone-Binding Aptamer BBa_25H6M60Q Oligo [SO:0000696] A single-stranded DNA aptamer that binds progesterone with high affinity (KD = 9.63 ± 3.12 nM).
QG5 Progesterone-Binding Aptamer BBa_25LT3YB0 Oligo [SO:0000696] A single-stranded DNA aptamer that binds progesterone with high affinity (KD = 5.29 ± 2.9 nM).
Aptamer Part Collection

Aptamer Library Design

To choose the best aptamers for our final plasmid, we compared four progesterone-binding aptamer candidates: P5, P6, [1] GQ5 [2], and P4G03 [3]. To qualitatively understand the binding between the aptamer candidates and progesterone, we developed a fluorescent binding assay to assess the ability of each candidate to bind progesterone. We were unable to find a single method for this assay, so we adapted methods from ThermoFisher [4-6], Bio-Rad [7], and those of Aniela Wochner and Jörn Glökl [8]. For our assay, we created streptavidin-coated 96-well plates to immobilize biotinylated progesterone. Aptamer candidates and anti-aptamers were tagged on the 5' overhangs with different fluorescent tags. After the assay is completed, the resulting fluorescence differentiates the aptamer from the anti-aptamer and qualitatively measures their interactions with each other and with our target. The candidates with the most fluorescent enrichment will be used in the final plasmid design. We generated aptamers with 5' fluorescent tags from oligonucleotide fragments using PCR for use in fluorescence binding assays. The 5'-6FAM fluorescent tags [9] were attached to the aptamer, and the 5'-CY5 tags [10] were attached to the anti-aptamer to visualize differences in binding. We selected four high-affinity progesterone-binding aptamer sequences to test their binding properties. Additionally, we chose two forms of PCR to produce our aptamer template and our fluorescently tagged ssDNA aptamer sequences. To produce our single-stranded aptamers, we use a combination of Splicing by Overhang Extension (SOE) PCR & Primer Blocked Asymmetric (PBA) PCR.

Aptamer Part Collection

➔ SOE PCR Experiment

To produce our single-stranded aptamers, we use a combination of Splicing by Overhang Extension (SOE) PCR and Primer Blocked Asymmetric (PBA) PCR as described below. SOE PCR is used as an alternative method to produce template DNA for our aptamers, addressing resource challenges. Due to the higher costs of ordering oligonucleotides larger than 65 bp, we purchased our aptamers and anti-aptamers in two fragments, each sharing a reverse complement at the 3′ end. We then used SOE PCR, a two-phase PCR process, to conjoin the two ssDNA fragments on their shared 3′ ends and to extend them into their full sequences.

The first phase of SOE PCR allows fragments to anneal and extend to form a full dsDNA strand as displayed in Fig. 1. The second phase amplifies our aptamers after the addition of primers for 30 cycles. After SOE PCR, the target dsDNA product—including both the aptamer and the anti-aptamer—is used as the template for PBA PCR.

SOE PCR Process with ssDNA fragments: Phase 1 annealing/extension and Phase 2 amplification
Fig. 1. Phase 1 (left panel) displays joining of homologous regions of ssDNA highlighted in green overlap region & subsequent extension of ssDNA fragments by polymerase to give full dsDNA (bottom left). Phase 2 is displayed in the right panel and shows the regular PCR process using the phase 1 product as a template.

SOE PCR Protocol

Step 1: 50 µL Reaction Setup (Fragment Assembly without Primers)

Prepare PCR mix for overlap extension (no primers added initially).

  • 5 µM Forward fragment – 3 µL
  • 5 µM Reverse fragment – 3 µL
  • Nuclease-free water – 15 µL
  • Q5 High Fidelity 2× Master Mix – 25 µL

Run 15 cycles of PCR without primers to allow fragments to anneal via overlap regions. Two-step PCR includes only initial denaturing to prevent concatemer formation & is allowed by initial fragments both being single-stranded.

Step 2: Add Flanking Primers (After Cycle 15)

  • Add 2.0 µL 10 µM Forward primer (Fwd-0, 65 °C Tm)
  • Add 2.0 µL 10 µM Reverse primer (Rev-0, 64 °C Tm)
  • Continue PCR for 30 additional cycles using annealing temperature ~63 °C

Step 3: Thermocycler Program

Phase 1 – Fragment Assembly (without primers)
StepCyclesTempTimeNotes
Denature198 °C30 sInitial denaturing
Touchdown Annealing 1–10 69 °C → 64 °C
(~−0.5 °C per cycle)		 10 s Maximize on-target annealing
Annealing11–1565 °C10 s Temp based on overlap region Tm (NEB tool)
Extension1–1572 °C4 s Fragment extension to make dsDNA
Phase 2 – Amplification (with primers added)
StepCyclesTempTimeNotes
Denature16–3098 °C10 sStandard
Annealing16–3064 °C10 sMatches flanking primers

Two-step PCR due to the speed of Q5 and the short size of the DNA product, allowing for extension during cycle ramping between denaturing and annealing.

Step 4: Oligonucleotide Cleanup Protocol

  1. Add 7× sample volume of membrane binding buffer to the sample in a clean tube. Gently mix by pipetting up and down or inverting tube.
  2. Insert the spin column into the collection tube. Pipette the sample into the center of the spin column. Spin for 1 min at 16,000 rpm. Discard flow-through.
  3. Reinsert the column into the collection tube. Wash by adding 200 µL of wash buffer. Spin for 1 min at 16,000 rpm. Discard flow-through.
  4. Repeat step 3. Spin again, but with no buffer added.
  5. Transfer the spin column into a clean centrifuge tube. Heat deionized water to 50 °C.
  6. Add 10 µL of heated nuclease-free water to the center of the spin column. Wait 1–5 min. Spin for 1 min at 16,000 rpm. Keep the flow-through and discard the spin column.

Reference Tables

Aptamer Constructs & Overlaps

AptamerFull Sequence (5′→3′)Forward Fragment Reverse FragmentOverlap (bp)Tm
GQ5 TAGGGAAGAGAA GGACATATGATGATCA GGGTGGGGGTGGGTC TTGACTAGTAGATGA CCACTTGA TAGGGAAGAGAA G GACATAT GATTGATCAGGGTGGGGGTG TCAAGT GGTCAT GTACTA GTCAAG ACCCAC 18 bp 61.2–64 °C
P5 TAGGGAAGAGAA GGACATATGATGCTCC GAAGTATCACTGCGG AGCATGTCCCCGAATT TCATTGCTTCTCGTG ACTTGACTAGTACAT GACCACTTGA TAGGGAAGAGAA GGACATAT GATACCTCCGAAGTATCATG CGGAGCATGTCCCCGAATTT CCCACC CTGATC AAT 19 bp 61.2 °C
P6 TAGGGAAGAGAA GGACATATGATGTCTGA GGT ACTCACTCTTCTCA CGTACGTTTCCCTCC TGAATTGACTAGTAC ATGACCACTTGA TAGGGAAGAGAA GGACATAT GATGTCTGAGGTACTCACTT CTCACGTTACGTTTCCCTC TCAAGT GGTCAT GTACTA GTC AAT TCAGGA GGGAA ACGTAC GTGAGAG 21 bp 62.0 °C

Flanking Primers

PrimerSequence (5′→3′)Length StrandBinding LocationTm
Fwd-0 TAGGGAAGAGAA GGACATATGAT 23 bp Antisense (anti-aptamer strand) 3′ end 62 °C
Rev-0 TCAAGTGGTCATGTACTAGTCAA 23 bp Sense (aptamer strand) 3′ end 63 °C
Aptamer Part Collection

➔ PBA PCR Design

We selected Primer Blocked Asymmetric (PBA) PCR to separate and amplify our aptamer from its antisense strands, and to prevent the formation of unwanted byproducts. PBA PCR uses the same basic principle of asymmetric PCR (aPCR), which is performed by introducing a primer concentration imbalance between excess forward primer and limiting reverse primer [12]. However, that imbalance is also a major source of unwanted byproducts, called concatemers—large DNA products caused by non-specific annealing of DNA fragments—as shown in Fig. 2. When a primer imbalance exists, the limiting primer leaves one ssDNA unbound throughout PCR cycles, increasing opportunities for off-target binding with other ssDNA fragments, leading to the formation of concatemers.

PBA PCR includes an additional 3′ phosphorylated limiting primer that binds to the template sense strand, blocking the polymerase from extending the antisense strand that would produce concatemers, and allowing for the overproduction of our desired aptamer strand. PBA PCR also offers a higher purity yield of the target DNA and a better conversion ratio of excess forward primer to target aptamer, compared to traditional aPCR, as shown in Fig. 3 [13, 14]. With the blocked primer equimolar to excess primer, the major product of PBA PCR is the ssDNA sense aptamer strand with a phosphorylated reverse primer bound to it. After PBA PCR, we planned to perform gel electrophoresis using Size-Select 2% Agarose E-Gels [15] and formamide, at denaturing agent, to separate the 22 bp phosphorylated primers from ±80 bp aptamers. The difference in sizes between the primer and aptamer would cause them to migrate through the gel at different rates, allowing excision of the target ssDNA at the capture well, foregoing gel extraction.

Concatemer formation process in asymmetric PCR
Fig. 2. Concatemer formation process in asymmetric PCR displaying how excess ssDNA strands promoted off-target binding and concatemer formation. A gold star represents the non-specific binding of DNA at partially complementary sequences.
Primer-Blocked Asymmetric PCR schematic
Fig. 3. PBA PCR schematic displaying how phosphorylated blocking primers lead to a high yield of partially ssDNA. Note that the site occupied by phosphorylated primer reduces concatemer formation.

PBA PCR Protocol

Step 1: Reaction Setup

  1. Keep all reagents on ice.
  2. Label PCR tubes according to sample condition.
  3. For each 50 µL PCR reaction, add the following:
  • 2 µL Template DNA at 4 ng/µL
  • 1.3 µL Limiting primer (1 µM)
  • 2.5 µL Excess primer (10 µM)
  • 2.4 µL Phosphorylated primer (10 µM)
  • 16.8 µL Nuclease-free water
  • 25 µL Q5 Master Mix

Step 2: Thermocycler Program

Phase Temperature Time Cycles Notes
Initial Denature 98 °C 20 s 1 Fully melt template
Denature 98 °C 10 s 1–40 Standard denaturation
Annealing (TD) 69 °C → 64 °C 10 s 1–10 Touchdown: −0.5 °C/cycle
Annealing 64 °C 10 s 11–40 Stable temperature annealing
Hold 4 °C ∞ – Store until removal

Step 3: Post-PCR Processing

  1. Run PCR products on agarose gel (10–50 bp ladder) to confirm product size.
  2. Purify using the Oligonucleotide Cleanup Protocol.
  3. If necessary, perform gel extraction to isolate the correct band.

PCR Conditions Table

Sample ID Primer Ratio (Limiting: Excess) Cycles Limiting Primer Excess Primer Phosphorylated Primer Template DNA
P5-A-151:15151.25 µL @ 1 µM1.875 µL @ 10 µM1.75 µL @ 10 µM2 µL (26 ng/µL)
P5-B-151:20151.25 µL @ 1 µM2.5 µL @ 10 µM—2 µL (26 ng/µL)
P5-C-151:30151.25 µL @ 1 µM3.75 µL @ 10 µM3.625 µL @ 10 µM2 µL (26 ng/µL)
P5-A-201:15201.25 µL @ 1 µM1.875 µL @ 10 µM1.75 µL @ 10 µM2 µL (26 ng/µL)
P5-B-201:20201.25 µL @ 1 µM2.5 µL @ 10 µM—2 µL (26 ng/µL)
P5-C-201:30201.25 µL @ 1 µM3.75 µL @ 10 µM—2 µL (26 ng/µL)
P5-A-301:15301.25 µL @ 1 µM1.875 µL @ 10 µM1.75 µL @ 10 µM2 µL (26 ng/µL)
P5-B-301:20301.25 µL @ 1 µM2.5 µL @ 10 µM—2 µL (26 ng/µL)
P5-C-301:30301.25 µL @ 1 µM3.75 µL @ 10 µM—2 µL (26 ng/µL)
Aptamer Part Collection

➔ Fluorescent Binding Assay Design

Fluorescent Binding Assay for Tagged Aptamer

  1. If using a manually coated streptavidin plate that was previously stored, wash the plate three times with a wash buffer. If using a pre-coated streptavidin plate, skip this step.
  2. Add the 100 µL of prepared ssDNA and biotinylated progesterone solution to each well of the 96-well plate.
  3. Incubate at room temperature while shaking at 120 RPM for 1 hour to allow binding to occur.
  4. Pipette out all the liquid.
  5. Wash twice with 200 µL wash buffer — discard liquid.
  6. Immediately read fluorescence with a plate reader. For 6-FAM tagged DNA, read at excitation: 490, emission: 520. An additional measurement can be taken before or during the wash step to give a better indication of the change in fluorescence prior to & following washing.

Fluorescent Binding Assay using SYBR Gold

NOTE: SYBR Gold dilutions rapidly degrade when exposed to light. Store dilutions in darkness and complete pipetting in low light conditions. The incubation step with SYBR Gold must be done in the dark.
  1. If using a manually coated streptavidin plate that was previously stored, wash the plate three times with a wash buffer. If using a pre-coated streptavidin plate, skip this step.
  2. Add the 100 µL of prepared ssDNA and biotinylated progesterone solution to each well of the 96-well plate.
  3. Incubate at room temperature while shaking at 120 RPM for 1 hour to allow binding to occur.
  4. Pipette out all the liquid.
  5. Wash twice with 200 µL wash buffer — discard liquid.
  6. Add 120 µL of SYBR Gold diluted 10,000× in PBS & incubate in darkness for 15 minutes.
  7. Pipette out all the liquid.
  8. Wash once with 200 µL of wash buffer & discard liquid via pipetting, taking care to remove all liquid.
  9. Immediately read fluorescence with a plate reader. Read at excitation: 485, emission: 537. An additional measurement can be taken before or during the wash step to give a better indication of the change in fluorescence prior to & following washing.
Aptamer Part Collection

➔ Troubleshooting SOE PCR Discussion

Our initial SOE PCR produced concatemers that required us to adjust our PCR program and protocol. This was likely due to the high processivity of the Q5 polymerase and the small size of our aptamer sequences. When designing our SOE PCR protocol, we adapted long extension and annealing times found commonly in other PCR programs, which most likely allowed the Q5 polymerase to overextend the sequences, creating concatemers during the 30 cycles in phase 2.

Additionally, having multiple denaturing steps in phase 1 may have caused the extended template to reanneal to unextended fragments, providing undesirable sequences the opportunity to bind randomly and form concatemers. To combat this, we implemented 2-step PCR and touchdown PCR techniques in the thermocycler programs to reduce concatemer formation. We established one initial denaturing step in phase 1, then alternated between short annealing and extension steps, and touched down from 69–94 °C. Phase 2 consisted of short denaturing and annealing steps, also touching down at 69–94 °C. After running gel electrophoresis on our new product, we did not see concatemer formation, validating the effectiveness of our adjustments.

Proof of Concept Part Collection

➔ Seagull Ultramer Duplex Composite Part

Part Number: BBa_255J2T2O    Part Type: Oligo [SO:0000696]

Contributers: Ally Hoogs, Aleek Tekehyan, Srishta Hazra, Christine Lau, Amanda Ferguson, Nishad Chavan

“Seagull” is an ultramer duplex designed with two single-stranded aptamer overhangs, P6 [1] and P4G03 [2], which bind to progesterone. The central 25 bp region provides structural rigidity. An additional preliminary test of the mechanism of our aptamer–plasmid system was developed using a prototype ultramer duplex with single-stranded overhangs carrying two different aptamer arms in a “seagull” formation. With these arms, we aim to quantitatively test whether our aptamers are successfully binding progesterone, but in a more similar format to how they would be formed in our cut plasmid.

The two aptamer arms are P6 and P4G03, due to their distinct flanking sequences which prevent undesired hybridization during duplex formation. Seagull was formed using two ultramers with matching complementary sequences in the body of the duplex, each attached to its respective aptamer arm. The ultramers were replicated using PBA PCR and annealed together to form the full seagull (Fig. 4) for our binding assay.

Seagull ultramer duplex formation showing complementary sequence and aptamer arms P6 and P4G03
Fig. 4. “Seagull” formation with P6 (blue) and P4G03 (red) single-stranded aptamer arms attached. In the body of the seagull is the complementary sequence of 25 bp to limit the flexibility of the aptamers. Limiting flexibility reduces the chance of either aptamer from impeding the other’s hairpin formation.
Proof of Concept Part Collection

➔ pUC19 Blue White Screening Design and Findings

When transforming our native pUC19 plasmid into the DH5 alpha strain of E. coli, we had questions on whether the pUC19 plasmid had successfully transformed our cells, so we used a procedure known as “blue white screening” for determining this success. This screening relies on a few conditions. The first of which is that DH5 alpha has a lacZΔM15 deletion mutation, which results in the cell being incapable of generating the β-galactosidase enzyme, cleaves lactose upon the presence of the lactose compound [16].

This mutation causes the cell to have only the omega fragment of the β-galactosidase enzyme, which on its own, is incapable of producing the enzyme. However, the pUC19 plasmid contains the remaining sequence for the production of the β-galactosidase that was removed from DH5 alpha via the lacZΔM15 mutation. This is known as the alpha fragment.

When DH5 alpha is successfully transformed with a pUC19 plasmid containing the alpha fragment of β-galactosidase, the transformant is capable of physically associating the alpha component produced by the plasmid and the omega component produced by the plasmid, creating functional β-galactosidase — This is known as alpha-complementation.

When these transformants capable of producing β-galactosidase through alpha-complementation are in the presence of a substrate known as X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside), the β-galactosidase hydrolyzes the substrate, ultimately producing a colony with a stark blue color [17].

Therefore, plating DH5 alpha that has been transformed with pUC19 plasmid on these X-Gal substrate plates allows for screening of whether this transformation has been successful, as only colonies that appear blue are verified to be complete transformants capable of alpha-complementation. Upon performing this screening, we found that growing up cells that were expected pUC19 transformed DH5 alpha on plates made with both the selective antibiotic ampicillin as well as the required reagents for blue white screening, both individual white and blue colonies grew. These colonies remained white, even after prolonged incubation.

This suggests that pUC19 plasmid from some vendors may not be entirely pure pUC19 plasmid. The ability for colonies to grow on these ampicillin plates without turning blue demonstrates that the cells had taken up some component that has ampicillin resistance, but did not contain the functional alpha fragment required for alpha-complementation. Therefore, while vendor-sourced pUC19 did include functional and complete plasmids, this is not true for the entirety of the product.

This was further proven by the selection of these blue colonies to be grown up on additional blue white screening plates. When these individual blue colonies were re-plated, they grew only blue colonies, demonstrating that the white colonies from the initial plating were not due to ineffective plate media, but rather ampicillin-resistant DH5 alpha without complete alpha-complementation.

For colonies that were blue, this demonstrates that alpha-complementation was successful, and the LacZ alpha, lac promoter, terminator, and ribosome binding site components are all active and usable in these transformed cells.

Additionally, we had questions regarding whether or not the LacI regulatory gene was present in DH5 alpha cells. LacI is typically present in many E. coli strains, encoding for a lac repressor protein. When the cell is not in the presence of lactose, this repressor binds to the operator site of the lac operon [18]. This prevents the transcription of downstream needs that are required to metabolize lactose [19]. However, if lactose is present, the lactose molecules bind to the repressor, forcing it to unbind from the operator, which allows for the necessary transcription of genes critical for lactose metabolization.

In order to confirm if the LacI gene was present in our cells, we had to determine whether or not the presence of lactose was required in order for the lac operon to be derepressed. One method of doing so is to use a lactose mimic, such as Isopropyl-β-D-thiogalactopyranoside (IPTG), in conjunction with the X-Gal substrate when plating pUC19 DH5 alpha transformants. If colonies on the X-Gal only plate are white, but blue colonies are present on the plate containing IPTG as well as X-Gal, then LacI is present, effectively repressing the operator site of the lac operon. If blue colonies are present, then LacI is not present in the system, and lactose (or a lactose mimic) is not required to derepress the lac operon and allow for transcription of downstream genes.

We tested this by taking samples of the same selected blue colony, and growing them on two different plate media. The first plate media contained LB + ampicillin + X-Gal. The second plate media was prepared the same, except for the addition of IPTG. The appearance of solely blue colony growth on both plate media types indicates that LacI is not present in the pUC19 DH5 alpha transformants.

Additionally, the functionality of glucose repression for blue colony selected pUC19 transformants was examined, and was found to be supported. When glucose levels are high cyclic AMP (cAMP) is not made. When cAMP is not present, the catabolite activator protein (CAP) loses its DNA binding functionality. This is critical because when able, CAP will bind to a DNA region upstream of the lac operon promoter. Its presence here assists the binding of RNA polymerase to the lac operon promoter, allowing for transcription to occur [20].

Therefore, high concentrations of glucose prevents the expression of the lac operon in cells. This concept was proven to be true, as blue colonies selected pUC19 transformants, when plated on LB + ampicillin + X-Gal plates at 0% and 1% glucose concentrations presented blue colonies at extremely different rates. While the 0% glucose plates grew colonies that were visibly becoming blue within 8 hours of incubation, the 1% glucose plates did not begin to display this blue coloring until after 36 hours of incubation, indicating a 28 hour repression period of the lac operon in these pUC19 transformed cells.

Proof of Concept Part Collection

➔ pUC19 Discussion

Through the utilization of the pUC19 plasmid, we aimed to design our safeTEA plasmid that, when in the presence of lactose, is derepressed to become a pUC19 backbone, the interior double-stranded segment between two aptamer arms that is able to bind to target molecules in an aqueous solution. Our insert was modeled to be under the control of the LacZ promoter so that lactose regulation may occur. Due to native pUC19 not having LacI, it must be added for binding. Once added, lactose can bind to LacI, splitting it and inhibiting binding to lacO, allowing for transcription. This then allows for the restriction enzyme to cleave the double strand in between the two aptamers and lambda exonuclease to cut away the anti-aptamer strands, slowing down at rumble zones, ultimately linearizing the plasmid and freeing the aptamers from its anti-aptamers. The key component of our system is its strong transcriptional repression in the presence of glucose, mediated by the glucose-sensitive regulators cyclic AMP (cAMP) and catabolite activator protein (CAP) upstream of the Lac operon [21]. Given the lac operon is known to be leaky, we aim to exploit this transcriptional suppression by storing and transporting our system in a high-concentration glucose solution.

Design

We created an aptamer–anti-aptamer structure: the vector insert contains the aptamer sequences on the sense strand and a complementary sequence being the anti-aptamer on the anti-sense strand on one end of the restriction site while the other end contains an anti-aptamer on the sense strand and an aptamer on the anti-sense strand. Therefore, once the plasmid is cut, the exposed 5′ end would be that of the anti-aptamer rather than the aptamer, which gets digested by the lambda exonuclease.

The following are the key components that we used to build our insert:

  • Spacer sequences: With our program NOODL, we are able to identify spacer sequences that can go in between our aptamers without interfering with hairpin formation. These spacers are spread out across our vector to minimize aptamers from entangling with each other.
  • Restriction Endonuclease cut site: For pUC19, we use the KpnI restriction enzyme, which creates a double-stranded cut at the recognition sequence (5′-GGTACC-3′) [22]. This recognition site is placed in the middle of our vector insert to, once cut, create the aptamer arms.
  • Restriction Endonuclease Coding Sequence: The coding sequence is under the LacZ promoter of pUC19 to create the restriction endonuclease that cleaves at our middle restriction site.
  • Lambda Exonuclease Coding Sequence: Once we have the linearized DNA carrying our aptamers with the restriction endonuclease, we need a way to cut the anti-aptamer away from the backbone, as its presence would impede on the efficacy of the aptamer. We chose Lambda exonuclease to digest at any exposed 5′-phosphorylated end of dsDNA, which was designed to be our anti-aptamer. The Lambda exonuclease coding sequence is under the control of the LacZ promoter, and we have attached a HisTag for production quantification. We include start and stop codons for transcription regulation, also as part of our lactose-activated promoter system.
  • Rumble Zone: These are four consecutive pause sites intended to slow Lambda exonuclease. These are placed on each side of the insert to protect the backbone from exonuclease digestion.

To create our plasmid, we utilize Golden Gate Assembly for multi-fragment insertion and construct assembly models through Geneious Software [23]. Golden Gate Assembly uses a restriction enzyme to create overlapping “sticky ends” between each fragment and the associated backbone. We chose the BsaI restriction enzyme due to the recognition site (5′-GGTCTC-3′) not being present anywhere else on the plasmid, which ensures no off-target digestion. Our fragments consisted of our vector, in the form of a gBlock and Ultramer duplex, and our pUC19 plasmid backbone. The gBlock was designed to already include the BsaI restriction sites flanking both ends.

Proof of Concept Part Collection

➔ Blue White Colony Screening Protocol

Materials

  • 3 × 500 mL LB + Agar medium
    1500 mL total; 3 individual flasks of 500 mL each; autoclaved for sterility
  • Ampicillin liquid stock solution
    1000× (100 mg ampicillin / 1 mL DI water)
  • X-Gal liquid stock solution
    400× (20 mg X-Gal / 10 mL DMSO)
  • IPTG liquid stock solution
    1000× (1 g IPTG / 8.392 mL DI water)
  • DH5α cells transformed with native pUC19 plasmid

Procedure

Preparation of X-Gal Liquid Stock

  1. Measure out 200 mg of solid X-Gal.
  2. Add this measured X-Gal to 10 mL of DMSO in a conical tube.
  3. Vortex until completely dissolved into solution.
  4. Aliquot the solution out into 1 mL aliquots to be stored away from light at −20 °C until use.
  5. Once thawed for use, the stock solution may not be refrozen and rethawed. This will significantly reduce functionality.
  6. Ensure that the aliquots are stored in dark tubes and kept out of light. Failure to do so will significantly reduce functionality.
  7. X-Gal, in both its solid and liquid forms, reduces in functionality significantly over time. Do not use past one year from purchase.

Preparation of IPTG Liquid Stock

  1. Measure out 1 g of solid IPTG.
  2. Add this measured IPTG to 8.392 mL of DI water in a conical tube.
  3. Vortex until completely dissolved into solution.
  4. Aliquot the solution out into 100 µL aliquots, to be stored away from light at −20 °C until use.
  5. Once thawed for use, the stock solution may not be refrozen and rethawed. This will significantly reduce functionality.

Preparation of 3 Different Plate Media

  1. Prepare LB + agar + ampicillin plate media.
  2. To 500 mL autoclaved LB + agar (cooled to 55 °C), add:
    • 500 µL of 1000× ampicillin stock (1× per 1 mL media)
  3. Pour media into plates and allow to set.
  4. Prepare LB + agar + ampicillin + X-Gal plate media.
  5. To 500 mL autoclaved LB + agar (cooled to 55 °C), add:
    • 500 µL of 1000× ampicillin stock
    • 1.25 mL of 400× X-Gal stock (2.5 µL per 1 mL media)
  6. Pour media into plates and allow to set.
  7. Prepare LB + agar + ampicillin + X-Gal + IPTG plate media.
  8. To 500 mL autoclaved LB + agar (cooled to 55 °C), add:
    • 500 µL of 1000× ampicillin stock
    • 1.25 mL of 400× X-Gal stock
    • 500 µL of 1000× IPTG stock (1× per 1 mL media)
  9. Pour media into plates and allow to set.

Plate Transformed Cells

  1. After the media has all set, plate pre-grown colonies (on ampicillin plates) consisting of anticipated DH5α cells that have been transformed with pUC19 plasmid.
  2. Ensure that for each set of three plates, the same colony sample is being used so that direct comparisons can be made between the three different media conditions.
  3. Incubate plated cells at 37 °C for at least 24 hours.
  4. Check back periodically for colony growth and blue pigment appearance.
  5. Blue colonies can appear in as little as 8 hours, to as many as 48 hours.

Interpreting Results

  1. The ampicillin-only plate serves as a control. Ensure that colonies are present here — they will be white. Their presence indicates DH5α has been transformed with some component that has ampicillin resistance. Lack of colonies indicates the transformation was not successful, as ampicillin resistance provided by the plasmid is not present in the DH5α cells.
  2. The ampicillin + X-Gal + IPTG plate serves as the test for whether the DH5α cells have been successfully transformed with pUC19 in a manner that allows for the required alpha-complementation to generate the β-galactosidase enzyme responsible for the blue pigment. Blue colonies indicate successful alpha-complementation between the transformed DH5α and native pUC19 plasmid. White colonies indicate a lack of this complementation and suggest that the components required are not present in the transformant.
  3. The ampicillin + X-Gal plate serves as the test for whether the system contains the LacI gene. If colonies on this plate are white but blue colonies are present on the plate containing IPTG, then LacI is present and effectively repressing the operator site of the lac operon. If blue colonies are present, then LacI is not present in the system, and lactose (or a lactose mimic) is not required to derepress the lac operon and allow for transcription of downstream genes.
  4. Take the blue colonies and create index plates with them for future use of known, successful transformants.
Proof of Concept Part Collection

➔ Glucose Repression of Lac Operon Testing Protocol

Materials

  • 20% glucose solution
    4 g D-Glucose in 20 mL DI water
    Filter sterilized
  • 3 × 125 mL LB + Agar medium
    Autoclaved for sterility
  • Ampicillin liquid stock solution
    1000× (100 mg ampicillin / 1 mL DI water)
  • X-Gal liquid stock solution
    400× (20 mg X-Gal / 10 mL DMSO)
  • IPTG liquid stock solution
    1000× (1 g IPTG / 8.392 mL DI water)
  • DH5α cells transformed with native pUC19 plasmid

Procedure

Prepare 20% Glucose Solution

  1. Measure out 4 g of glucose into a heat-safe container.
  2. To the glucose, add 20 mL of DI water.
  3. Using a heated stir plate, stir and heat the glucose and water until it is dissolved into solution.
  4. Allow this solution to cool until safe to handle.
  5. Using a 0.2 µm filtration tip on a 25 mL luer-lock syringe, filter sterilize the 20% glucose solution into a sterile conical tube.

Prepare 3 Different Concentrations of Glucose Plate Media

  1. Prepare LB + agar + ampicillin + X-Gal plate media (0% Glucose).
  2. To 125 mL of autoclaved LB + agar media (cooled to 55 °C), add:
      – 125 µL of 1000× ampicillin stock (1× stock per 1 mL media),
      – 312.5 µL of 400× X-Gal stock (2.5 µL stock per 1 mL media)
  3. Pour media into plates and allow to set.
  4. Prepare LB + agar + ampicillin + X-Gal + glucose plate media (1% Glucose).
  5. To 125 mL of autoclaved LB + agar media (cooled to 55 °C), add:
      – 131.6 µL of 1000× ampicillin stock (1× stock per 1 mL final media volume)
      – 329 µL of 400× X-Gal stock (2.5 µL stock per 1 mL final media volume)
      – 6.6 mL of 20% Glucose
  6. Pour media into plates and allow to set.
  7. Prepare LB + agar + ampicillin + X-Gal + glucose plate media (1.5% Glucose).
  8. To 125 mL of autoclaved LB + agar media (cooled to 55 °C), add:
      – 135.14 µL of 1000× ampicillin stock (1× stock per 1 mL final media volume)
      – 337.85 µL of 400× X-Gal stock (2.5 µL stock per 1 mL final media volume)
      – 10.14 mL of 20% Glucose
  9. Pour media into plates and allow to set.

Plate Transformed Cells

  1. After the media has all set, plate pre-grown colonies known to be successful native pUC19 transformants of DH5α (see “Blue White Colony Screening” protocol).
  2. Ensure that for each set of three plates, the same colony sample is being used, so that direct comparisons can be made between the three different media conditions.
  3. Incubate plated cells at 37 °C for at least 24 hours.
  4. Check back periodically for colony growth and blue pigment appearance.

Interpreting Results

  1. The gradient-based appearance of blue colonies among the three plates should suggest the functionality of glucose as a repressor for the lac operon.
  2. Blue colonies are anticipated on the 0% glucose plates in as soon as 8 hours of incubation time (see “Blue White Colony Screening” protocol).
  3. The presence of blue colonies on the 0% plate, but not on the 1% or 1.5% plates, suggests that glucose presence acts as a strong repressor of the lac operon.
  4. These findings are further confirmed by the presence of blue colonies appearing over time on the 1% glucose plates, while still not present on the 1.5% plates, suggesting that higher levels of glucose prolong repression of the lac operon.
Proof of Concept Part Collection

➔ Lambda Exonuclease Rumble Sequence Basic Part

Part Number: BBa_25SURMFG
Part Type: Oligo [SO:0000696]

Sequence:
5’-GGCGGATTCTGACAGCATCGGCGGATTCTGATATCAACGGCGGATTCTACGCGTGACGGCGATTCT-3’

Description:
The “rumble sequence” contains four putative pause sequences, found in literature, that are intended to pause Lambda exonuclease for a more targeted digestion. In our research, we employ the use of Lambda Exonuclease to digest the 5′ phosphorylated unwanted complementary strands to produce single-stranded aptamers from a double-stranded plasmid. The rumble zones flank a portion of the double-stranded sequence that remains undigested to provide structure and hold our aptamer arms. The pause sequence itself, 5′-GGCGGATTCT-3′, was found in scientific literature from Perkins et al [26]. We proposed that four pause sites put together into a “rumble sequence” would be an effective mechanism for Lambda exonuclease inhibition.

Proof of Concept Part Collection

➔ Lambda Exonuclease Rumble Sequence Efficacy

To test the efficacy of the “rumble zone”, we inserted it into a gene block, TriCycle. This “rumble zone” flanks a 210 bp region intended to remain undigested to “hold” the undigested aptamer arms (Fig. 5). We also designed a control sequence with no pause sequences, NonStop (N), to better characterize the influence of the pause sequences within the context of digestion.

TriCycle gene block showing rumble zones flanking a backbone region
Fig. 5. TriCycleV1 Gene Block.

Lambda Digestion Protocol [27]

Reagents

  • Amplified template DNA
    • gBlocks: (TriCycleV1, NonstopV1, TriCycleV2, NonstopV2)
  • Lambda Exonuclease Reaction Buffer (10×)
  • Lambda Exonuclease
  • Nuclease-free water

Procedure

  1. To a thin-walled PCR tube add the following:
    1. 5 µL of 10× Lambda Exonuclease Reaction Buffer
    2. 1 µL of Lambda Exonuclease
    3. Approximately 2000 ng of template DNA
    4. Nuclease-free water to reach 50 µL
  2. Incubate at 37 °C for X (variable) time(s) in a thermocycler.
  3. Heat at 80 °C for 10 minutes.
  4. Follow with DNA Cleanup (see below).

Buffer Preparation for DNA Clean Up

  • Membrane Wash Buffer
    • 5 mL snap-cap tubes
    • 10 mM Potassium Acetate (KOAc) (pH 5.0)
    • 80% EtOH (Ethanol)
    • 16.7 µM EDTA (pH 8.0)
  • Membrane Binding Solution
    • Screw-cap bottle for storage
    • 4.5 M Guanidine isothiocyanate (GITC)
    • 0.5 M KOAc (pH 5.0)
  • 5 M Potassium Acetate (pH 5.0)
    • Screw-cap bottle for storage
    • Glacial Acetic Acid
    • DI H2O
    • KOH (Potassium hydroxide) Pellets
  • 0.5 M EDTA
    • Screw-cap bottle for storage
  • General Reagents
    • 95% EtOH

Membrane Binding buffer (10 mL Working Solution)

  1. Add 5.3 g of GITC
  2. Add 1 mL of 5 M Potassium Acetate (pH 5.0)
  3. Finally add DI H2O until the final volume reaches 10 mL

Membrane Wash Buffer (10× Stock)

  1. Add 2 mL of 5 M Potassium Acetate (pH 5.0)
  2. Then add 33.4 µL of 0.5 M EDTA (pH 8.0)
  3. Finally add DI H2O to get a final volume of 100 mL
  4. Aliquot 0.5 mL into 5 mL snap-cap tubes and freeze at −20 °C
  5. To make working solution (5 mL) from stock:
    1. add 4.2 mL of 95% Ethanol
    2. add 0.3 mL of DI H2O

Stock 5 M Potassium Acetate (pH 5.0)

  1. Add 29.5 mL of glacial acetic acid
  2. Then add approximately 28 g of KOH pellets or until the pH reaches 5.0
  3. Finally, add DI H2O to reach a final volume of 100 mL

Stock 0.5 M EDTA

  1. Add 400 mL of DI H2O
  2. To the solution, add 93.05 g disodium-EDTA-2H2O
  3. Add 9 g of NaOH pellets or until the pH is adjusted to 8.0
  4. Finally add DI H2O until a final volume of 500 mL is reached

DNA Cleanup [28]

Reagents:
Binding Buffer · Wash Buffer · DI H2O (60 °C) · DI H2O

Procedure:

  1. Add 7× volumes of Binding Buffer to 1× volume of sample to a 1.5 mL microfuge tube. Mix well by pipetting up and down.
  2. Transfer to a spin column over a collection tube.
  3. Spin for 1 minute at 16,000 g — discard flow-through.
  4. Add 500 µL wash buffer and spin for 1 minute at 16,000 g — discard flow-through.
  5. Repeat wash (step 4).
  6. Spin column again for 1 minute at 16,000 g — discard collection tube.
  7. Move column to a 1.5 mL microfuge tube.
  8. Add 21 µL of DI H2O (60 °C) to the center of matrix of the column.
  9. Wait for 2 minutes and spin for 1 minute at 16,000 g.
  10. Repeat steps 7–9.

E-Gel Protocol

Reagents: Lambda digestion products (X variable times for each sample)

Consumables: E-Gel Precast Agarose Gel · E-Gel Electrophoresis Chamber

Running E-Gel Electrophoresis

  1. Take 20–100 ng of sample DNA digestion and dilute with nuclease-free water to reach a volume of 22.5 µL, plus 2.5 µL of loading dye (red).
  2. First load 50 µL of nuclease-free water into all wells.
  3. Load each sample into the wells on the Invitrogen E-Gel Size Select II, 2% agarose gel.
  4. Run for twelve minutes.
  5. Turn on backlight and visualize.

Results

Non-denaturing and denaturing E-Gel results for TriCycle and NonStop digests
Fig. 6. E-Gel Size Select II, 2% agarose gel ran using 10× ThermoFisher E-Gel loading dye (left). From left to right (1 to 7) the lanes are: template TriCycleV2, 4 hour N, 4 hour T, 2 hour N, 2 hour T, 1 hour T, and 1 hour N. E-Gel ran using 2× RNA Gel Loading dye (right). From left to right the lanes are: Template TriCycleV2, 4 hour N, 4 hour T, 2 hour N, 2 hour T, 1 hour N, 1 hour T.

Interpreting results:

  • On the non-denaturing E-gel, 4 hour digested NonStop sample displayed the faintest band, supporting the conclusion that longer digestion times result in greater digestion and therefore Lambda is functional (Fig. 6).
  • NonStop lanes consistently showed fainter bands compared to their counterpart TriCycle digestions at each digestion time.
  • E-Gel showed all of the digested bands migrated farther down the gel when compared to the undigested template.
  • Denaturing E-Gel exhibited decent resolution with individual bands distinguishable from the general lane smear (Fig. 6).

The four-hour digestions run on the E-gels produced fewer and fainter bands, suggesting that there was more complete digestion of the DNA when compared to the shorter digestion times. Bands seen for the shorter digestions seemed to migrate less far down the gel as well.

TROUBLESHOOTING:

The RNA loading dye did not fluoresce on the denaturing E-Gel. In future experiments, we would like to test the addition of formamide to a higher-percentage agarose gel to improve band resolution and intensity. We would also like to design smaller testing sequences to run on such a gel to more accurately analyze subtle differences in digestion.

Citations
  1. M. Jauset-Rubio et al., “One-Pot SELEX: Identification of Specific Aptamers against Diverse Steroid Targets in One Selection,” ACS Omega, vol. 4, no. 23, pp. 20188–20196, Dec. 2019, doi: 10.1021/acsomega.9b02412.
  2. P. Kumar, K. Birader, and P. Suman, “Development of an Impedimetric Aptasensor for Detection of Progesterone in Undiluted Biological Fluids,” ACS Pharmacol. Transl. Sci., vol. 6, no. 1, pp. 92–99, Jan. 2023, doi: 10.1021/acsptsci.2c00185.
  3. G. Contreras Jiménez, S. Eissa, A. Ng, H. Alhadrami, M. Zourob, and M. Siaj, “Aptamer-Based Label-Free Impedimetric Biosensor for Detection of Progesterone,” Anal. Chem., vol. 87, no. 2, pp. 1075–1082, Jan. 2015, doi: 10.1021/ac503639s.
  4. Thermo Fisher Scientific, “Streptavidin-HRP Conjugate,” Thermo Fisher Scientific, Waltham, MA, USA, Mar. 2010. [PDF]. Available: link.
  5. Thermo Fisher Scientific, “Pierce Streptavidin Coated 96-Well Plates, User Guide, MAN0011250,” Thermo Fisher Scientific Inc., Rockford, IL, USA, circa 2011. [PDF]. Available: link. [Accessed: Jul. 24, 2025].
  6. Thermo Fisher Scientific Inc., “Nunc Immobilizer Streptavidin Plates/Strips Application Note (D20693),” Roskilde, Denmark, 2012. [PDF]. Available: link. [Accessed: Jul. 24, 2025].
  7. Bio-Rad Antibodies, “Direct ELISA protocol with streptavidin–biotin detection,” Bio-Rad Laboratories, [Online]. Available: link. [Accessed: Jul. 24, 2025].
  8. A. Wochner and J. Glökler, “Nonradioactive fluorescence microtiter plate assay monitoring aptamer selections,” BioTechniques, vol. 42, no. 5, pp. 578–582, May 2007. doi: 10.2144/000112472.
  9. “5′ 6-FAM (Fluorescein) modification | IDT.” Accessed: Jul. 25, 2025. [Online]. Available: link.
  10. “3′ Cy5™ modification | IDT.” Accessed: Jul. 25, 2025. [Online]. Available: link.
  11. A. Behle, “Overlap extension PCR,” Aug. 2019, Accessed: Jul. 25, 2025. [Online]. Available: link.
  12. Z. Tolnai et al., “A simple modification increases specificity and efficiency of asymmetric PCR,” Analytica Chimica Acta, vol. 1047, pp. 225–230, Jan. 2019, doi: 10.1016/j.aca.2018.10.017.
  13. M. Jauset-Rubio et al., “One-Pot SELEX: Identification of Specific Aptamers against Diverse Steroid Targets in One Selection,” ACS Omega, vol. 4, no. 23, pp. 20188–20196, Dec. 2019, doi: 10.1021/acsomega.9b02412.
  14. P. Kumar, K. Birader, and P. Suman, “Development of an Impedimetric Aptasensor for Detection of Progesterone in Undiluted Biological Fluids,” ACS Pharmacol. Transl. Sci., vol. 6, no. 1, pp. 92–99, Jan. 2023, doi: 10.1021/acsptsci.2c00185.
  15. G. Contreras Jiménez et al., “Aptamer-Based Label-Free Impedimetric Biosensor for Detection of Progesterone,” Anal. Chem., vol. 87, no. 2, pp. 1075–1082, Jan. 2015, doi: 10.1021/ac503639s.
  16. A. A. Hamed, M. Khedr, and M. Abdelraof, “Activation of LacZ gene in Escherichia coli DH5α via α-complementation mechanism for β-galactosidase production and its biochemical characterizations,” Journal of Genetic Engineering and Biotechnology, vol. 18, no. 1, Dec. 2020, doi: 10.1186/s43141-020-00096-w.
  17. M. R. Green and J. Sambrook, “Screening Bacterial Colonies Using X-Gal and IPTG: α-Complementation,” Cold Spring Harbor Protocols, vol. 2019, no. 12, p. pdb.prot101329, Dec. 2019, doi: 10.1101/pdb.prot101329.
  18. B. Gorke, “Activity of Lac repressor anchored to the Escherichia coli inner membrane,” Nucleic Acids Research, vol. 33, no. 8, pp. 2504–2511, Apr. 2005, doi: 10.1093/nar/gki549.
  19. Khan Academy, “The Lac Operon,” Khan Academy, 2021. Available: link.
  20. A. Tankeshwar, “Lac Operon: Mechanism and Regulation,” Learn Microbiology Online, Nov. 27, 2019. Available: link.
  21. Brown, W., Ralston, A. & Shaw, K. (2008) Positive transcription control: The glucose effect. Nature Education 1(1):202 Available: link.
  22. New England Biolabs, “KpnI-HF.” Accessed: Jul. 24, 2025. link.
  23. Geneious Prime 2025.0. (https://www.geneious.com).
  24. A. Wochner and J. Glökler, “Nonradioactive fluorescence microtiter plate assay monitoring aptamer selections,” BioTechniques, vol. 42, no. 5, pp. 578–582, May 2007. doi: 10.2144/000112472.
  25. N. R. Markham, L. S. Zuker, and M. Zuker, “UNAFold.” Accessed: Jul. 21, 2025. Available: link.
  26. T. T. Perkins, R. V. Dalal, P. G. Mitsis, and S. M. Block, “Sequence-Dependent Pausing of Single Lambda Exonuclease Molecules,” Science, vol. 301, no. 5641, pp. 1914–1918, Sep. 2003, doi: 10.1126/science.1088047.
  27. New England Biolabs, “NEB #M0262.” Available: link.
  28. New England Biolabs, “Monarch® Spin PCR & DNA Cleanup Kit (5 µg) | NEB.” Available: link.