BBa_252RIC0N: BD-tau(PHF6 domain)

Name

brain-derived tau (BD-tau)

Origin

BD-Tau originates from neurons within the brain, specifically, it's the tau protein that is released from damaged or dying neurons in the brain. Synthesized for E. coli expression.

Base Pairs

102bp

Properties

BD-Tau is a blood-based, brain-specific tau fragment serving as a biomarker for Alzheimer’s disease (Kyalu etal ;2023)

Usage and Biology

Normally tau protein helps stabilize microtubules, which are essential for neuron structure and transport. However, in Alzheimer's disease, brain-derived tau protein exhibits abnormal aggregation and phosphorylation, forming tangles within neurons. These tau tangles disrupt cellular function, leading to neuronal damage and cognitive decline. Additionally, brain-derived tau’s molecular properties influence the rate of uptake and potential spread of pathology. This new basic part is being investigated as a potential biomarker for Alzheimer’s since it has shown promise in differentiating between Alzheimer's and other neurodegenerative diseases and in correlating with disease progression and cognitive decline. BD-Tau is confirmed to be a biomarker for Alzheimer's Disease(Gonzalez-Ortiz, etal ;2023). BD-Tau protein is only released during neurodegenerative brain cell damage, while P-Tau protein could be activated for reasons nonspecific to AD .

Cultivation, Purification

and SDS-PAGE

We have used enzyme digestion and enzyme linkage with enzymes NheI and HindIII to construct the pET28a-BD-tau. We needed and by using PCR, we have amplified the sequence of BD-tau, with a length of 102 bp. From the figure1 above, it is shown a band consistent with the target size. After gel recovery, the BD-tau fragment was obtained.

Figure 1: PCR amplification

We have also done SDS-PAGE which separates the proteins based on their size (molecular weight). The smaller the proteins are, the faster they move, allowing for their separation and visualization, which in , BD-tau has shown results as 5.1kDa .

Figure 2: SDS-PAGE protein of BD-tau. The size of BD-tau is 5.1kDa.

Characterization/Measurement

To obtain the fusion protein and expression, we used DNA sequencing to determine the full nucleotide sequence of the plasmids we reconstructed.

Figure 3: Gene sequencing of plasmid

Reference

Gonzalez-Ortiz, F., Turton, M., Kac, P. R., Smirnov, D., Premi, E., Ghidoni, R., Benussi, L., Cantoni, V., Saraceno, C., Rivolta, J., Ashton, N. J., Borroni, B., Galasko, D., Harrison, P., Zetterberg, H., Blennow, K., & Karikari, T. K. (2022). Brain-derived tau: a novel blood-based biomarker for Alzheimer’s disease-type neurodegeneration. Brain, 146(3), 1152–1165. https://doi.org/10.1093/brain/awac407

Kyalu Ngoie Zola N, Balty C, Pyr Dit Ruys S, Vanparys AAT, Huyghe NDG, Herinckx G, Johanns M, Boyer E, Kienlen-Campard P, Rider MH, Vertommen D, Hanseeuw BJ. Specific post-translational modifications of soluble tau protein distinguishes Alzheimer's disease and primary tauopathies. Nat Commun. 2023 Jun 22;14(1):3706. doi: 10.1038/s41467-023-39328-1. PMID: 37349319; PMCID: PMC10287718.

BBa_25RK98WF: T-Tau

Name

T-Tau

Origin

Synthetic codon-optimized gene derived from human MAPT gene. Synthesized for E. coli expression.

Base Pairs

105bp

Properties

Encodes the longest human tau isoform, a microtubule-associated protein.

Usage and Biology

Tau is a neuronal phosphoprotein that binds microtubules (MT) via its MT binding repeats, promoting assembly and stability. Its N-terminal domain modifies MT spacing and interacts with plasma membranes(Teng etal, 2018; Guo etal, 2017). Tau serves as a biomarker resource to mimic the brain-derived tau (bd-tau) leaking into blood in early AD stages. As a targeted aptamer, tau would be immobilized during SELEX to select DNA probes binding AD-specific tau epitopes, while additionally also validates CRISPR-Cas12a diagnostic sensitivity(Gonzalez-Ortiz etal, 2014). Its purpose of validating detection’s sensitivity to ensure the system detects tau exclusively, with no amyloid-beta to cross-reactivity is displayed in both methods of ELISA and CRISPR-Cas12a.

Cultivation, Purification and SDS-PAGE

We have used restriction digestion and ligation with NheI and HindIII to construct the tau. Agarose gel electrophoresis was employed to separate and analyze the size of DNA fragments, thereby verifying the accuracy of gene amplification via PCR. This technique utilizes an electric field to facilitate the migration of DNA fragments, with smaller fragments exhibiting faster mobility. The size and purity of these fragments are assessed through staining and ultraviolet (UV) observation. By referencing a molecular weight marker positioned on the left, the approximate base pair (bp) lengths of the bands can be inferred. When compared to established reference values, the correct bands can be identified. In the accompanying gel image, the boxed bands represent the correct fragments. For Tau, the expected band length is 105bp in Figure 4, which corresponds to the observed band .

Figure 4: PCR amplification

We performed a SDS-PAGE on plasmid-transformed E. coli BL21 to assess the initial protein expression levels. As depicted in Figure 5, both the crude protein extracted from the cell lysate and the protein obtained from the centrifuged supernatant revealed the presence of Tau (5.2 kDa).

.

Figure 5: SDS-PAGE protein result

Characterization/

Measurement

We utilized gene sequence of plasmid that we transfected into the E.coli. The figure 6 showned that there’s no mutation.

Figure 6: gene sequencing of plasmid

Reference

Teng IT, Li X, Yadikar HA, Yang Z, Li L, Lyu Y, Pan X, Wang KK, Tan W. Identification and Characterization of DNA Aptamers Specific for Phosphorylation Epitopes of Tau Protein. J Am Chem Soc. 2018 Oct 31;140(43):14314-14323. doi: 10.1021/jacs.8b08645. Epub 2018 Oct 16. PMID: 30277395; PMCID: PMC6442731.

Guo, T., Noble, W., & Hanger, D. P. (2017). Roles of tau protein in health and disease. Acta Neuropathologica, 133(5), 665–704. https://doi.org/10.1007/s00401-017-1707-9

Gonzalez-Ortiz F, Kirsebom BE, Contador J, Tanley JE, Selnes P, Gísladóttir B, Pålhaugen L, Suhr Hemminghyth M, Jarholm J, Skogseth R, Bråthen G, Grøndtvedt G, Bjørnerud A, Tecelao S, Waterloo K, Aarsland D, Fernández-Lebrero A, García-Escobar G, Navalpotro-Gómez I, Turton M, Hesthamar A, Kac PR, Nilsson J, Luchsinger J, Hayden KM, Harrison P, Puig-Pijoan A, Zetterberg H, Hughes TM, Suárez-Calvet M, Karikari TK, Fladby T, Blennow K. Plasma brain-derived tau is an amyloid-associated neurodegeneration biomarker in Alzheimer's disease. Nat Commun. 2024 Apr 4;15(1):2908. doi: 10.1038/s41467-024-47286-5. PMID: 38575616; PMCID: PMC10995141.

BBa_25R6CI56: Aptamer-1

BBa_25QENYPB: Aptamer-2

Origin

SELEX(Systematic Evolution of Ligands by EXponential)

Base Pairs

60bp

Properties

Nucleic acid aptamers that specifically bind to BD-tau

Usage and Biology

Nucleic acid aptamers specific for identifying blood-based BD-Tau is a novel detection methodology. These DNA aptamers are designed to target specific epitopes of BD-Tau(Teng etal,2018). These DNA aptamers are designed to target specific epitopes of BD-Tau, offering high sensitivity and specificity by avoiding cross-reactivity with peripheral tau isoforms(Gonzalez-Ortiz etal, 2023). With advantages of high specificity, ease of modification, strong stability, and low cost, they are suitable for large-scale application, upholding the potential to enable early screening for Alzheimer's Disease patients.

Design

Aptamer-1 and Aptamer-2 are a nucleic acid aptamer selected via the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) election process from a single-stranded DNA (ssDNA) library for its binding affinity with BD-tau. The initial library consisted of a single-stranded DNA (ssDNA) library with a 66-nucleotide random region flanked by fixed primer-binding sequences (e.g., 5'-CAGCACCGTCAACTGAAT-(N66)-GTGATGCGATGGAGATGT-3'), linked with a commercially synthesized Oligo DNA pool with a complexity of 1.2×10^16 unique sequences under high-temperature denaturation.

The selection protocol involved immobilizing BD-tau on Ni-NTA magnetic beads under a total of 17 rounds of selection. Involving an initial round, incorporated counter-selection steps, as well as the final round, where afterwards the enriched pool is sequenced. From the multitude of resulting sequences provided by the bio company sequencing, molecular docking was used to pinpoint the aptamer with the highest predicted specificity for BD-tau.

Aptamer-1 the sequence: 5’GGAGATAGTAAGTGCAATCTAAGGGCGAATTCCAGCACACTGGCGGCCATTACTAGTGGA-3’

Aptamer-2 the sequence:

5’ CGGGTGAGATAGTAAGTGCAATCTAAGGGCGAATTCTGCAGATATCCATCACACTGGCGG-3’

Characterization/Measurement

We designed a FAM tag after the aptamer, enabling the use of flow cytometry to monitor the specific binding between the enriched aptamer and the peptide. The specific binding was determined by detecting the fluorescence signal intensity when individual aptamers were bound to the peptide and analyzed via flow cytomety(Zuo etal, 2014). After obtaining the aptamer sequence, we used Surface Plasmon Resonance (SPR) to measure response units (RU) and determined the dissociation constant (Kd) by fitting the data, thereby characterizing the binding affinity between the aptamer and BD-tau(Scarano etal, 2015). For this purpose, we immobilized the BD-tau protein onto a CM5 sensor chip and injected the aptamer at gradient concentrations (5, 10, 30, 100, 150 μmol/L). The Langmuir binding (1:1) was fitted to calculate the Kd value.

Figure 7. Flow symmetry concerning the product of various rounds of the SELEX process

This study presents our findings on flow symmetry concerning the product of various rounds of the SELEX process. RFU, or Relative Fluorescence Units, quantifies the intensity of the fluorescent signal emitted by the RAM attached to the F primer during PCR. As illustrated in the figure, RFU values progressively increased from round 1 to round 6, indicating a gradual enrichment of aptamers with binding affinity for BD-tau. Post round 6, we implemented reverse screening to eliminate non-specific binders, which resulted in a noticeable decline in RFU. By round 12, after additional rounds of stringent selection, there was a substantial decrease in RFU, suggesting that only a small pool of aptamers with the highest affinity remained.

The Kd value of Aptamer-1 found through SPR is 152.9 μMol. A larger Kd value indicates a lower binding affinity. As is evident from the table 2, the Kd of Aptamer-1 is considerably higher than that of other aptamers, indicating a considerably weaker affinity. The Kd of Aptamer-2 is considerably lower than that of aptamers1, indicating a considerably srtonger affinity. However, the dissociation constant (Kd) of the nucleic acid aptamer is relatively high, necessitating further optimization.

Table 2. Nucleic acid aptamer sequence and their Kd values

Reference

Gonzalez-Ortiz F, Turton M, Kac PR, Smirnov D, Premi E, Ghidoni R, Benussi L, Cantoni V, Saraceno C, Rivolta J, Ashton NJ, Borroni B, Galasko D, Harrison P, Zetterberg H, Blennow K, Karikari TK. Brain-derived tau: a novel blood-based biomarker for Alzheimer's disease-type neurodegeneration. Brain. 2023 Mar 1;146(3):1152-1165. doi: 10.1093/brain/awac407. Erratum in: Brain. 2023 Oct 3;146(10):e89-e90. doi: 10.1093/brain/awad208. PMID: 36572122; PMCID: PMC9976981.

Teng IT, Li X, Yadikar HA, Yang Z, Li L, Lyu Y, Pan X, Wang KK, Tan W. Identification and Characterization of DNA Aptamers Specific for Phosphorylation Epitopes of Tau Protein. J Am Chem Soc. 2018 Oct 31;140(43):14314-14323. doi: 10.1021/jacs.8b08645. Epub 2018 Oct 16. PMID: 30277395; PMCID: PMC6442731.

Zuo Mingyan. Selection of Nucleic Acid Aptamers for Prealbumin Based on SELEX Technology and Application of an Aptamer-Based Magnetic Beads Sensor for Detection of Bacterial Endotoxins [D]. University of Science and Technology of China, 2014.

Scarano S , Mariani S , Minunni M .SPR-Based Affinity Biosensors as Innovative Analytical Devices[J].Journal of Lightwave Technology, 2015, 33(16):3374-3384.DOI:10.1109/JLT.2015.2442997.

BBa_25XMPAOH: Aptamer-3

Name

Aptamer-3

Origin

SELEX(Systematic Evolution of Ligands by EXponential)

Base Pairs

60bp

Properties

Nucleic acid aptamers that specifically bind to BD-tau

Usage and Biology

Nucleic acid aptamers specific for identifying blood-based BD-Tau is a novel detection methodology. These DNA aptamers are designed to target specific epitopes of BD-Tau(Teng etal,2018). These DNA aptamers are designed to target specific epitopes of BD-Tau, offering high sensitivity and specificity by avoiding cross-reactivity with peripheral tau isoforms(Gonzalez-Ortiz etal, 2023). With advantages of high specificity, ease of modification, strong stability, and low cost, they are suitable for large-scale application, upholding the potential to enable early screening for Alzheimer's Disease patients.

Design

Aptamer-3 is Aptamer-1 and Aptamer-2 are a nucleic acid aptamer selected via the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) election process from a single-stranded DNA (ssDNA) library for its binding affinity with BD-tau. The initial library consisted of a single-stranded DNA (ssDNA) library with a 66-nucleotide random region flanked by fixed primer-binding sequences (e.g., 5'-CAGCACCGTCAACTGAAT-(N66)-GTGATGCGATGGAGATGT-3'), linked with a commercially synthesized Oligo DNA pool with a complexity of 1.2×10^16 unique sequences under high-temperature denaturation.

The selection protocol involved immobilizing BD-tau on Ni-NTA magnetic beads under a total of 17 rounds of selection. Involving an initial round, incorporated counter-selection steps, as well as the final round, where afterwards the enriched pool is sequenced. From the multitude of resulting sequences provided by the bio company sequencing, molecular docking was used to pinpoint the aptamer with the highest predicted specificity for BD-tau, yielding the sequence:

5’ CCCGCAGATAGTAAGTGCAATCTAAGGGCGAATTCCAGCACACTGGCGGCAGTTACTAGT-3’

Characterization/Measurement

We designed a FAM tag after the aptamer, enabling the use of flow cytometry to monitor the specific binding between the enriched aptamer and the peptide. The specific binding was determined by detecting the fluorescence signal intensity when individual aptamers were bound to the peptide and analyzed via flow cytomety(Zuo etal, 2014).

Figure 8. Flow symmetry concerning the product of various rounds of the SELEX process

This study presents our findings on flow symmetry concerning the product of various rounds of the SELEX process. RFU, or Relative Fluorescence Units, quantifies the intensity of the fluorescent signal emitted by the RAM attached to the F primer during PCR. As illustrated in the figure 8, RFU values progressively increased from round 1 to round 6, indicating a gradual enrichment of aptamers with binding affinity for BD-tau. Post round 6, we implemented reverse screening to eliminate non-specific binders, which resulted in a noticeable decline in RFU. By round 12, after additional rounds of stringent selection, there was a substantial decrease in RFU, suggesting that only a small pool of aptamers with the highest affinity remained.

Table 3. The sequence of nucleic acid aptamers and their Kd value

Figure 9. Affinity assessed by using surface plasmon resonance

After synthesizing our aptamer, we assessed its affinity using surface plasmon resonance (SPR). The figure 9 A illustrates the relationship between aptamer concentration and the energy required to dissociate the aptamer from its target protein. Subsequently, the The figure 9 B re-plotted the data from the first graph, with the x-axis representing aptamer concentration, and a logistic best-fit line was derived. The midpoint of this graph was identified as the dissociation constant (Kd) value. In our analysis of various aptamers using SPR, we observed that a lower Kd value corresponds to a higher energy requirement for dissociation, indicating greater affinity. Notably, the aptamer-3 exhibited a Kd value of approximately 56.66, signifying a high affinity for the target protein. The Kd value of aptamer-3 is significantly lower compared to the values given for aptamers 1 and 2, indicating a stronger binding affinity with BD-tau, therefore we coated Aptamer-3 onto a microplate and used an ELISA to validate its specificity.

Figure 10. Quantitative binding analysis of BD-Tau aptamer-3 in simulated plasma environments

In the figure10 A presented above, the initial graph illustrates a positive correlation between the increased concentration of our aptamer and the bound BD-tau levels. The figure10 B demonstrates the results of an ELISA assay conducted to detect Alzheimer's Disease (AD) within a simulated blood plasma environment. The data indicate that the ELISA assay consistently identified elevated BD-tau levels in the plasma of the AD group, whereas the control group exhibited significantly lower BD-tau levels. These findings suggest that the aptamer is capable of accurately detecting AD within a plasma environment.

Reference

Brain. 2023 Mar 1;146(3):1152-1165. doi: 10.1093/brain/awac407. Erratum in: Brain. 2023 Oct 3;146(10):e89-e90. doi: 10.1093/brain/awad208. PMID: 36572122; PMCID: PMC9976981.

Teng IT, Li X, Yadikar HA, Yang Z, Li L, Lyu Y, Pan X, Wang KK, Tan W. Identification and Characterization of DNA Aptamers Specific for Phosphorylation Epitopes of Tau Protein. J Am Chem Soc. 2018 Oct 31;140(43):14314-14323. doi: 10.1021/jacs.8b08645. Epub 2018 Oct 16. PMID: 30277395; PMCID: PMC6442731.

Zuo Mingyan. Selection of Nucleic Acid Aptamers for Prealbumin Based on SELEX Technology and Application of an Aptamer-Based Magnetic Beads Sensor for Detection of Bacterial Endotoxins [D]. University of Science and Technology of China, 2014.

Scarano S , Mariani S , Minunni M .SPR-Based Affinity Biosensors as Innovative Analytical Devices[J].Journal of Lightwave Technology, 2015, 33(16):3374-3384.DOI:10.1109/JLT.2015.2442997.

BBa_25WL4D7V, Aptamer-08

Name

Aptamer-08

Origin

SELEX(Systematic Evolution of Ligands by EXponential)

Base Pairs

76bp

Properties

Nucleic acid aptamers that specifically bind to BD-tau

Usage and Biology

Nucleic acid aptamers specific for identifying blood-based BD-Tau is a novel detection methodology. These DNA aptamers are designed to target specific epitopes of BD-Tau(Teng etal,2018). These DNA aptamers are designed to target specific epitopes of BD-Tau, offering high sensitivity and specificity by avoiding cross-reactivity with peripheral tau isoforms(Gonzalez-Ortiz etal, 2023). With advantages of high specificity, ease of modification, strong stability, and low cost, they are suitable for large-scale application, upholding the potential to enable early screening for Alzheimer's Disease patients.

Design

Aptamer-08 is a nucleic acid aptamer selected via the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) election process from a single-stranded DNA (ssDNA) library for its binding affinity with BD-tau. The initial library consisted of a single-stranded DNA (ssDNA) library with a 66-nucleotide random region flanked by fixed primer-binding sequences (e.g., 5'-CAGCACCGTCAACTGAAT-(N66)-GTGATGCGATGGAGATGT-3'), linked with a commercially synthesized Oligo DNA pool with a complexity of 1.2×10^16 unique sequences under high-temperature denaturation.

The selection protocol involved immobilizing BD-tau on Ni-NTA magnetic beads under a total of 17 rounds of selection. Involving an initial round, incorporated counter-selection steps, as well as the final round, where afterwards the enriched pool is sequenced. From the multitude of resulting sequences provided by the bio company sequencing, molecular docking was used to pinpoint the aptamer with the highest predicted specificity for BD-tau, yielding the sequence:

5’-TCACCTGAGACTTGACGATGGCACTACCCCTCCCTACTAAGCACGGTATCTTGTACTGAGTGCTATCGTCTGTCCA-3’

Characterization/Measurement

Due to the low affinity of the nucleic acid ligands from the initial selection round for BD-tau, we optimized the experimental conditions and performed a second round of systematic SELEX selection. The process of flow cytometric analysis and Surface Plasmon Resonance(SPR) were described in Aptamer-08.

Figure 11. Flow symmetry concerning the product of various rounds of the SELEX process

This study presents our findings on flow symmetry concerning the product of various rounds of the SELEX process. RFU, or Relative Fluorescence Units, quantifies the intensity of the fluorescent signal emitted by the RAM attached to the F primer during PCR. As illustrated in the figure, RFU values progressively increased from round 1 to round 6, indicating a gradual enrichment of aptamers with binding affinity for BD-tau. Post round 6, we implemented reverse screening to eliminate non-specific binders, which resulted in a noticeable decline in RFU. By round 12, after additional rounds of stringent selection, there was a substantial decrease in RFU, suggesting that only a small pool of aptamers with the highest affinity remained.

Figure 12. Affinity assessed by using surface plasmon resonance

After synthesizing our aptamer, we assessed its affinity using surface plasmon resonance (SPR). The figure 12 illustrates the relationship between aptamer concentration and the energy required to dissociate the aptamer from its target protein.Notably, the aptamer-08 exhibited a Kd value of approximately 11.32±1,1μmol, signifying a high affinity for the BD-tau protein.

Reference

Gonzalez-Ortiz F, Turton M, Kac PR, Smirnov D, Premi E, Ghidoni R, Benussi L, Cantoni V, Saraceno C, Rivolta J, Ashton NJ, Borroni B, Galasko D, Harrison P, Zetterberg H, Blennow K, Karikari TK. Brain-derived tau: a novel blood-based biomarker for Alzheimer's disease-type neurodegeneration. Brain. 2023 Mar 1;146(3):1152-1165. doi: 10.1093/brain/awac407. Erratum in: Brain. 2023 Oct 3;146(10):e89-e90. doi: 10.1093/brain/awad208. PMID: 36572122; PMCID: PMC9976981.

Teng IT, Li X, Yadikar HA, Yang Z, Li L, Lyu Y, Pan X, Wang KK, Tan W. Identification and Characterization of DNA Aptamers Specific for Phosphorylation Epitopes of Tau Protein. J Am Chem Soc. 2018 Oct 31;140(43):14314-14323. doi: 10.1021/jacs.8b08645. Epub 2018 Oct 16. PMID: 30277395; PMCID: PMC6442731.

BBa_25ZYR9NO: Aptamer-14

Name

Aptamer-14

Origin

SELEX(Systematic Evolution of Ligands by EXponential)

Base Pairs

76bp

Properties

Nucleic acid aptamers that specifically bind to BD-tau

Usage and Biology

Nucleic acid aptamers specific for identifying blood-based BD-Tau is a novel detection methodology. These DNA aptamers are designed to target specific epitopes of BD-Tau(Teng etal,2018). These DNA aptamers are designed to target specific epitopes of BD-Tau, offering high sensitivity and specificity by avoiding cross-reactivity with peripheral tau isoforms(Gonzalez-Ortiz etal, 2023). With advantages of high specificity, ease of modification, strong stability, and low cost, they are suitable for large-scale application, upholding the potential to enable early screening for Alzheimer's Disease patients.

Design

Aptamer-14 is a nucleic acid aptamer selected via the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) election process from a single-stranded DNA (ssDNA) library for its binding affinity with BD-tau. The initial library consisted of a single-stranded DNA (ssDNA) library with a 66-nucleotide random region flanked by fixed primer-binding sequences (e.g., 5'-CAGCACCGTCAACTGAAT-(N66)-GTGATGCGATGGAGATGT-3'), linked with a commercially synthesized Oligo DNA pool with a complexity of 1.2×10^16 unique sequences under high-temperature denaturation.

The selection protocol involved immobilizing BD-tau on Ni-NTA magnetic beads under a total of 17 rounds of selection. Involving an initial round, incorporated counter-selection steps, as well as the final round, where afterwards the enriched pool is sequenced. From the multitude of resulting sequences provided by the bio company sequencing, molecular docking was used to pinpoint the aptamer with the highest predicted specificity for BD-tau, yielding the sequence:

TCACCTGAGACTTGACGATGGTTCTACACTGCCCCCCCGACCCGCCAGACCAACCCAGAGTGCTATCGTCTGTCCA

Characterization/Measurement

Due to the low affinity of the nucleic acid ligands from the initial selection round for BD-tau, we optimized the experimental conditions and performed a second round of systematic SELEX selection. The process of flow cytometric analysis and Surface Plasmon Resonance(SPR) were described in Aptamer-14.

Figure 13. Flow symmetry concerning the product of various rounds of the SELEX process

This study presents our findings on flow symmetry concerning the product of various rounds of the SELEX process. RFU, or Relative Fluorescence Units, quantifies the intensity of the fluorescent signal emitted by the RAM attached to the F primer during PCR. As illustrated in the figure 14, RFU values progressively increased from round 1 to round 6, indicating a gradual enrichment of aptamers with binding affinity for BD-tau. Post round 6, we implemented reverse screening to eliminate non-specific binders, which resulted in a noticeable decline in RFU. By round 12, after additional rounds of stringent selection, there was a substantial decrease in RFU, suggesting that only a small pool of aptamers with the highest affinity remained.

Figure 14. Affinity assessed by using surface plasmon resonance

Table 4. The Kd value of nucleic acid aptamers

In our analysis of various aptamers using SPR, we observed that a lower Kd value corresponds to a higher energy requirement for dissociation, indicating greater affinity. Notably, the aptamer-14 exhibited a Kd value of approximately 6.38±0.78μmoll, lower than the binding affinity of aptamer-08 and aptamer-16. The results indicated that Aptamer-14 likely exhibited the highest binding affinity for BD-tau. Consequently, we immobilized Aptamer-14 onto the microplate to further validate its binding efficacy with BD-tau. A series of BD-tau protein concentrations(0,2pg/ml; 25ng/ml; 50ng/m;100ng/m;200ng/m;500ng/m;) were designed to interact with Aptamer-14, and the binding interactions were assessed by measuring the absorbance.

Figure 15. Quantitative binding analysis of BD-Tau aptamer-14 in simulated plasma environments

The figure15 demonstrates the results of an ELISA assay conducted to detect Alzheimer's Disease (AD) within a simulated blood plasma environment. The data indicate that the ELISA assay consistently identified elevated BD-tau levels in the plasma of the AD group, whereas the control group exhibited significantly lower BD-tau levels. These findings suggest that the aptamer is capable of accurately detecting AD within a plasma environment.

Reference

Gonzalez-Ortiz F, Turton M, Kac PR, Smirnov D, Premi E, Ghidoni R, Benussi L, Cantoni V, Saraceno C, Rivolta J, Ashton NJ, Borroni B, Galasko D, Harrison P, Zetterberg H, Blennow K, Karikari TK. Brain-derived tau: a novel blood-based biomarker for Alzheimer's disease-type neurodegeneration. Brain. 2023 Mar 1;146(3):1152-1165. doi: 10.1093/brain/awac407. Erratum in: Brain. 2023 Oct 3;146(10):e89-e90. doi: 10.1093/brain/awad208. PMID: 36572122; PMCID: PMC9976981.

Teng IT, Li X, Yadikar HA, Yang Z, Li L, Lyu Y, Pan X, Wang KK, Tan W. Identification and Characterization of DNA Aptamers Specific for Phosphorylation Epitopes of Tau Protein. J Am Chem Soc. 2018 Oct 31;140(43):14314-14323. doi: 10.1021/jacs.8b08645. Epub 2018 Oct 16. PMID: 30277395; PMCID: PMC6442731.

BBa_259EP3O5:Aptamer-16

Name

Aptamer-16

Origin

SELEX(Systematic Evolution of Ligands by EXponential)

Base Pairs

76bp

Properties

Nucleic acid aptamers that specifically bind to BD-tau

Usage and Biology

Nucleic acid aptamers specific for identifying blood-based BD-Tau is a novel detection methodology. These DNA aptamers are designed to target specific epitopes of BD-Tau(Teng etal,2018). These DNA aptamers are designed to target specific epitopes of BD-Tau, offering high sensitivity and specificity by avoiding cross-reactivity with peripheral tau isoforms(Gonzalez-Ortiz etal, 2023). With advantages of high specificity, ease of modification, strong stability, and low cost, they are suitable for large-scale application, upholding the potential to enable early screening for Alzheimer's Disease patients.

Design

Aptamer-16 is a nucleic acid aptamer selected via the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) election process from a single-stranded DNA (ssDNA) library for its binding affinity with BD-tau. The initial library consisted of a single-stranded DNA (ssDNA) library with a 66-nucleotide random region flanked by fixed primer-binding sequences (e.g., 5'-CAGCACCGTCAACTGAAT-(N66)-GTGATGCGATGGAGATGT-3'), linked with a commercially synthesized Oligo DNA pool with a complexity of 1.2×10^16 unique sequences under high-temperature denaturation.From the multitude of resulting sequences provided by the bio company sequencing, molecular docking was used to pinpoint the aptamer with the highest predicted specificity for BD-tau, yielding the sequence:5’-TCACCTGAGACTTGACGATGGCGCTACCCCCTAACTTCAACCCGCATTATTCTAGCTGAGTGCTATCGTCTGTCCA-3’

Characterization/Measurement

Due to the low affinity of the nucleic acid ligands from the initial selection round for BD-tau, we optimized the experimental conditions and performed a second round of systematic SELEX selection. The process of flow cytometric analysis and Surface Plasmon Resonance(SPR) were described in Aptamer-16.

Figure 16. Flow symmetry concerning the product of various rounds of the SELEX process

As illustrated in the figure, RFU values progressively increased from round 1 to round 6, indicating a gradual enrichment of aptamers with binding affinity for BD-tau. Post round 6, we implemented reverse screening to eliminate non-specific binders, which resulted in a noticeable decline in RFU. By round 12, after additional rounds of stringent selection, there was a substantial decrease in RFU, suggesting that only a small pool of aptamers with the highest affinity remained.

Figure 17. Affinity assessed by using surface plasmon resonance

The figure 17 illustrates the relationship between aptamer concentration and the energy required to dissociate the aptamer from its target protein. Five different concentrations of the aptamer were utilized for the SPR analysis. In our analysis of various aptamers using SPR, we observed that a lower Kd value corresponds to a higher energy requirement for dissociation, indicating greater affinity.Aptamer-16 exhibited a Kd value of approximately 21.83 μmol, indicating its binding capability to BD-tau.

Reference

Gonzalez-Ortiz F, Turton M, Kac PR, Smirnov D, Premi E, Ghidoni R, Benussi L, Cantoni V, Saraceno C, Rivolta J, Ashton NJ, Borroni B, Galasko D, Harrison P, Zetterberg H, Blennow K, Karikari TK. Brain-derived tau: a novel blood-based biomarker for Alzheimer's disease-type neurodegeneration. Brain. 2023 Mar 1;146(3):1152-1165. doi: 10.1093/brain/awac407. Erratum in: Brain. 2023 Oct 3;146(10):e89-e90. doi: 10.1093/brain/awad208. PMID: 36572122; PMCID: PMC9976981.

Teng IT, Li X, Yadikar HA, Yang Z, Li L, Lyu Y, Pan X, Wang KK, Tan W. Identification and Characterization of DNA Aptamers Specific for Phosphorylation Epitopes of Tau Protein. J Am Chem Soc. 2018 Oct 31;140(43):14314-14323. doi: 10.1021/jacs.8b08645. Epub 2018 Oct 16. PMID: 30277395; PMCID: PMC6442731.

BBa_25AJAYBU: Cas12a

Name

Cas12a

Origin

Cas12a originates from a type of prokaryotic immune system (CRISPR) found in Lachnospiraceae bacterium.

Base Pairs

3753 bp

Properties

Cas12a is a type of CRISPR-associated protein that acts as a DNA-cutting enzyme guided by RNA to locate and cleavage selected DNA sequences.

Usage and Biology

Compared to Cas9, Cas12a has a unique feature of containing an RNase domain that can excise its crRNA from a larger CRISPR array, simplifying editing or gene regulation with multiple crRNAs. Therefore, after extracting the DNA, it is used to connect with the crRNA that is developed. Beyond genetic manipulation applications, some Cas proteins with trans-cleavage activity have been developed by researchers such as Feng Zhang and Jennifer Doudna into cost-effective, portable nucleic acid diagnostic tools, including SHERLOCK and DETECTR. These CRISPR-Cas biosensing systems are being applied in pathogen detection, virus detection, genotyping, cancer mutation detection, and single nucleotide polymorphism (SNP) identification(Tran etal, 2021).

Cultivation

Purification

We plan to clone the target gene fragment Cas12a into the pET28a vector via enzymatic ligation for protein expression. We have performed PCR amplification of the Cas12a sequence, yielding a product of 3753 bp(Figure 18).

Figure 18: Target gene PCR amplification

Characterization/Measurement

In the figure 19, the target sequence can be clearly detected in its entirety. Within the high-confidence regions (noting that Sanger sequencing may show lower confidence at the ends, and a single reaction can only cover approximately 1000 bp, which is why multiple sequences are joined end-to-end in the figure), the sequencing quality is good, with well-resolved peaks. No mutations are observed in the target fragment, indicating that the fragment has been successfully integrated into the plasmid backbone and that the recombinant plasmid has been successfully constructed.

Figure 19. Sequencing validation.

Reference

Tran, M. H., Park, H., Nobles, C. L., Pabalu Karunadharma, Pan, L., Zhong, G., Wang, H., He, W., Ou, T., Gogce Crynen, Sheptack, K., Stiskin, I., Mou, H., & Farzan, M. (2021). A more efficient CRISPR-Cas12a variant derived from Lachnospiraceae bacterium MA2020. Molecular Therapy Nucleic Acids, 24, 40–53. https://doi.org/10.1016/j.omtn.2021.02.012

BBa_2540VQLQ: ComDNA 1

BBa_25FNMXM6: ComDNA 2

BBa_25R1UJJB: ComDNA 3

BBa_254DI5CV: ComDNA 4

BBa_25AG7QMC: ComDNA 5

Origin

Artificially designed

Base Pairs

25bp

Properties

The ComDNA, which is complementary to the bases of the aptamer, can be used to immobilize the aptamer onto streptavidin-coated magnetic beads.

Usage and Biology

The biotin-modified single-stranded ComDNA sequence, which is complementary to part of the BD-tau-aptamer-F sequence, together with the modified aptamer, constitutes an aptamer switch. "Biotin" is biotin, which is incorporated during the synthesis of the single-stranded nucleotide ComDNA sequence and can bind to streptavidin on the magnetic beads, serving to anchor the ComDNA to the beads. The polyT acts as a linker DNA, providing a certain distance between the complementary sequence region on the ComDNA and the magnetic beads, which is beneficial for the functional performance of the complementary sequence-aptamer switch(Han etal, 2023). The basic design principles for ComDNA include a GC content of approximately 55%, an annealing temperature of ~40°C, and a complementary site length of 11 bp to 13 bp.

Figure 20.Magnetic bead sensor

Characterization/Measurement

To optimize the dissociation of ComDNA upon target binding, five distinct ComDNA sequences (Com1-Com5) were designed and tested. Specifically, the Com1-Tau aptamer-dsDNA complex was assembled and incubated with an excess of Tau protein. The relase of the tau aptamer-dsDNA complex was quantified via qPCR, with a control sample using an equivalent volume of water. The signal-to-noise ratio was calculated for each ComDNA. The sequence yielding the highest ratio was selected for further use. To ensure data reliablility, all qPCR results were normalized to the expression level of the actin gene used as an internal reference.

Figure 21. Signal-to-noise ratio of ComDNA verified with BD-Tau

Among the different complementary DNA (ComDNA) sequences tested, the fluorescence intensity ComDNA1 and Com DNA 5 demonstrated a significantly lower than that of the ComDNA 2, ComDNA3 and ComDNA4 in the figure 21. ComDNA3 exhibited a higher relative fluorescence intensity compared to the other groups, demonstrating that ComDNA provides the superior signal-to-noise ratio.

ComDNA3 was identified as the optimal applicant based on its highest relative fluorescence value and superior signal-to-noise ratio and performance in comparative assays, making it the most suitable linker between the aptamer and the magnetic beads.

Reference

Han Y, Li F, Yang L, Guo X, Dong X, Niu M, Jiang Y, Li L, Li H, Sun Y. Imunocapture Magnetic Beads Enhanced and Ultrasensitive CRISPR-Cas13a-Assisted Electrochemical Biosensor for Rapid Detection of SARS-CoV-2. Biosensors (Basel). 2023 May 31;13(6):597. doi: 10.3390/bios13060597. PMID: 37366962; PMCID: PMC10296353.

Xu H, Peng L, Wu J, Khan A, Sun Y, Shen H, Li Z. Clustered Regularly Interspaced Short Palindromic Repeats-Associated Proteins13a combined with magnetic beads, chemiluminescence and reverse transcription-recombinase aided amplification for detection of avian influenza a (H7N9) virus. Front Bioeng Biotechnol. 2023 Jan 5;10:1094028. doi: 10.3389/fbioe.2022.1094028. PMID: 36686235; PMCID: PMC9849363.‌

BBa_253RQU0P: BD-tau aptamer 14-F

Name

BD-tau aptamer 14-F

Origin

Artificially designed

Base Pairs

110bp

Properties

The modified alpha-fetoprotein (AFP) aptamer sequence, when used in the construction of a biosensor, forms an aptamer switch with a biotin-modified complementary ssDNA sequence (ComDNA). Together with the cleavage-mimicking dsDNA strand of Cas12a, they constitute a hybrid chain. (Xu et al., 2023)

Usage and Biology

The “magnetic beads-ComDNA/aptamer-dsDNA” biosensor consists of three components: streptavidin-coated magnetic beads, a biotin-modified single stranded DNA (ssDNA) partially complementary to the aptamer sequence, and a hybrid strand formed by the engineered aptamer linked to a Cas12a-activating double stranded DNA (dsDNA) sequence. The streptavidin-coated magnetic beads have a diameter of 1 μm, with a theoretical loading capacity of 500 pmol of biotinylated single stranded oligonucleotide (24 nt in length) per mg. The ComDNA is synthesized commercially and shares a complementary sequence of 10-15 bases in length with the engineered aptamer. The complex formed by the complementary pairing of ComDNA and the aptamer is a commonly used method for constructing an aptamer switch.

In the absence of the analyte, the ComDNA binds to the aptamer, preventing the formation of the aptamer’s secondary structure. When the analyte is present, the binding affinity between the analyte and the aptamer is stronder than the force of complementarity between the ComDNA and the aptamer. This displaces the ComDNA, allowing the aptamer to form its secondary structure. In the constructed magnetic bead-ConDNA/aptamer-dsDNA complex, this is manifested as the analyte binding to the aptamer, causing the separation of the aptamer from the ComDNA anchored on the magnetic bead(figure 22).

In this biosensor complex, the performance in responding to the analyte depends on the quality of the aptamer switch, which is determined by its signal-to-noise ratio (SNR). This ration is defined as the signal intensity (amount of released aptamer-dsDNA) in the presence of a high concentration of analyte divided by the background signal intensity (amount of released aptamer-dsDNA) in the absence of the analyte. The SNR of the aptamer switch is influenced by two factors: first the affinity of the aptamer, which is determined during the selection process and does not require further optimization; furthermore, second the suitability of the complementary sequence between the ComDNA and the aptamer. In principle, the ComDNA should bind to the aptamer as tightly as possible in the absence of the analyte.

Figure 22. The Operating Principle of the Magnetic Bead Biosensor

Characterization/Measurement

Subsequent optimization focused on determining the ideal concentration of the BD-tau aptamer-dsDNA complex. The "magnetic bead-biotinylated ComDNA-Tau aptamer-dsDNA" complex was assembled with varying concentrations of BD-tau aptamer-dsDNA. Evaluation of the signal-to-noise ratio following standard incubation protocols revealed that it plateaued beyond a specific concentration.

The figure 23 indicate that the signal-to-noise ratio of comDNA3 increases with rising concentration, reaching its maximum at 10 μmol. This suggests that 10 μmol provides the optimal effect.

Figure 23. Determination of the concentration of the BD-tau aptamer–dsDNA complex

To determine the optimal incubation time for ComDNA3 and BD-tau aptamer-dsDNA complex at the fixed concentration of 10μmo, we monitored the release kinetics of the BD-tau aptamer-dsDNA over a time course (10,20, 30, 40, 50, 60 min) using qPCR.

As shown in the figure 24, the relative fluorescence value increased with time at 10, 20 and 30 minutes. No significant difference was observed at 40, 50 and 60 minutes, indicating that COmDNA3 and BD-Tau aptamer-dsDNA complex likely reaches a stable state after 40 minutes of incubation.

Figure 24. Determination of the incubation time between BD-Tau and the aptamer–dsDNA complex

Following the establishment of the optimized parameters (ComDNA3, 10 μmol BD-Tau aptamer-dsDNA, 40 min incubation), the full biosensor protocol was implemented to detect BD-Tau protein. Specifically, the sensor was incubated with serially diluted BD-Tau protein standard solutions. After incubation, the supernatant was isolated and introduced into the Cas12a reporter system for fluorescence measurement. It is anticipated that the fluorescence intensity will increase progressively over time. Furthermore, the rate of this increase (represented by the curve slope or the probe cleavage rate) is expected to be dependent on and accelerate with increasing Tau protein concentration. This dose-response relationship will be used to determine the assay's linear range and limit of detection (LOD).

Based on the designed sensor structure, sensor units were constructed using BD--Tau and its corresponding aptamer. Gradient concentrations of BD-Tau were added to generate a standard curve. The results are shown in the figure 25.

Figure 25. Standard curve of BD-Tau

As shown in the figure 25, the fluorescence intensity exhibited a clear linear relationship with the target protein concentration. This result indicates that the release of the aptamer–dsDNA and the subsequent activation of Cas12a trans-cleavage are quantitatively dependent on the amount of protein present in the system. The observed linearity not only demonstrates the sensitivity of the sensing module but also validates its reliability for quantitative detection. Such linear correlation strongly supports that the system can be calibrated using a standard curve, thereby enabling accurate concentration measurements in practical applications. These findings not only confirm the applicability of the sensor but also highlight its potential for further optimization in real biological samples.

Next, we evaluated the recognition specificity of this module, including BD-Tau, bovine serum albumin (BSA), human serum albumin (HSA), IgE, and IgG. The results are shown in figure 26.

Figure 26. Protein specificity detection of BD-Tau

The results showed that this module exhibited a significant response to BD-Tau, while no detectable response was observed for common interfering proteins in blood(Figure 26). This finding highlights the excellent specificity of the system, indicating that the sensor can effectively distinguish the target protein from background proteins.

Reference

Han Y, Li F, Yang L, Guo X, Dong X, Niu M, Jiang Y, Li L, Li H, Sun Y. Imunocapture Magnetic Beads Enhanced and Ultrasensitive CRISPR-Cas13a-Assisted Electrochemical Biosensor for Rapid Detection of SARS-CoV-2. Biosensors (Basel). 2023 May 31;13(6):597. doi: 10.3390/bios13060597. PMID: 37366962; PMCID: PMC10296353.

Xu H, Peng L, Wu J, Khan A, Sun Y, Shen H, Li Z. Clustered Regularly Interspaced Short Palindromic Repeats-Associated Proteins13a combined with magnetic beads, chemiluminescence and reverse transcription-recombinase aided amplification for detection of avian influenza a (H7N9) virus. Front Bioeng Biotechnol. 2023 Jan 5;10:1094028. doi: 10.3389/fbioe.2022.1094028. PMID: 36686235; PMCID: PMC9849363.

BBa_259FM6T9:PET28a-BD-tau

Name

pET28a-BD-tau

Origin

Built within our team

Properties

Expressing large amounts of BD-tau protein

Usage and Biology

pET-28a plasmid is an E. coli expression vector for expression of N-terminally 6xHis-tagged proteins with a thrombin site. It was engineered from the pET vector system, to facilitate high-level expression of recombinant proteins under the control of the T7 promoter. After plasmid extraction and connected with BD-tau, it becomes pET28a-BD-tau

Cultivation, Purification and SDS-PAGE

The pET-28a (+) vector was systematically engineered to integrate the BD-tau coding sequence, flanked by NheI and HindIII restriction sites, to ensure an in-frame fusion with a 6×His tag at the N-terminus, facilitating nickel-affinity purification. Competent E. coli DH5 cells were subjected to heat-shock transformation with the recombinant plasmid(Figure 27).

Figure 27. The map of pET28a-BD-tau

In the stage of expression, we cloned BD-tau into pET-28a with N-terminal His-tag, resulting it to transform into E. coli BL21. The E. coli is additionally cultured, induced with 0.5 mM IPTG at the condition of 16°C for 18 hours.

Figure 28: Monoclonal colony plate verification

Characterization/Measurement

We get the gene sequence of plasmid that we transfected into the bacteria. Tested that there’s no mutation.

Figure 29: gene sequencing of plasmid.

Reference

BBa_256M1I7W:pET28a-tau

Name

pET28a-tau

Origin

Built within our team

Properties

Expressing large amounts of Tau protein.

Usage and Biology

PET-28a plasmid is an E. coli expression vector for expression of N-terminally 6xHis-tagged proteins with a thrombin site. It was engineered from the pET vector system, to facilitate high-level expression of recombinant proteins under the control of the T7 promoter. After plasmid extraction and connected with Tau, it becomes pET28a-tau

Cultivation, Purification

The pET-28a (+) vector was systematically engineered to integrate the Tau coding sequence, flanked by NheI and HindIII restriction sites, to ensure an in-frame fusion with a 6×His tag at the N-terminus, facilitating nickel-affinity purification. Competent E. coli DH5 cells were subjected to heat-shock transformation with the recombinant plasmid.

Figure 30. The map of pET28a-tau

In the stage of expression, we cloned tau into pET-28a-tau with N-terminal His-tag, resulting it to transform into E. coli BL21. The E. coli is additionally cultured, induced with 0.5 mM IPTG at the condition of 16°C for 18 hours.

Figure 31: Monoclonal colony plate verification

Characterization/Measurement

We get the gene sequence of plasmid that we transfected into the bacteria. Tested that there’s no mutation.

Figure 32: gene sequencing of plasmid.

Reference

BBa_25OZUK7L:pET28a-Cas12a

Name

pET28a-Cas12a

Origin

Built within out team

Properties

Expressing large amounts of Cas 12a protein

Usage and Biology

PET-28a plasmid is an E. coli expression vector for expression of N-terminally 6xHis-tagged proteins with a thrombin site. It was engineered from the pET vector system, to facilitate high-level expression of recombinant proteins under the control of the T7 promoter. After plasmid extraction and connected with Cas12a, it becomes pET28a-Cas12a

Cultivation, Purification and SDS-PAGE

The pET-28a (+) vector was systematically engineered to integrate the Cas12a coding sequence, flanked by NheI and HindIII restriction sites, to ensure an in-frame fusion with a 6×His tag at the N-terminus, facilitating nickel-affinity purification. Competent E. coli DH5 cells were subjected to heat-shock transformation with the recombinant plasmid.

Figure 33. The map of pET28a-cas12a

Once the plasmid DNA (pET-28a-Cas12a) is converted into E. coli under transformation, it would then be cultured and amplified from nanograms to milligrams, Figure 34 providing enough for Cas12a concentration inside the plasmid for further use of the final sensor. Figure 34 showcases the result of Cas12a amplification results after converting into E.coli and cultured in the petri dish.

Figure 34: Cultured E-coli

Subsequently, we selected eight monoclonal colonies for validation. As shown in the figure, the target bands in lanes 1-8 exhibited the expected sizes, demonstrating successful PCR amplification. The plasmids were subsequently extracted and submitted for commercial sequencing.

Figure 35. Monoclonal Colony verification Gel

The protein was purified, and the purified fractions were analyzed by SDS-PAGE. The results are shown in the figure 35. The figure 35 clearly displays the bands corresponding to the crude protein, wash fractions, and purified protein. Lanes E1–E5 represent the purified protein, showing a strong band at the target position (approximately 120 kDa) with very high concentration and minimal contaminating proteins, indicating high efficiency of protein expression and purification. This observation is further supported by the bands in the crude protein sample. In contrast, the wash fractions contain mostly contaminating proteins and only trace amounts of the target protein.

Figure 36. SDS-PAGE of Cas12a

Characterization/Measurement

After the selected protein is cultured, we used DNA sequencing to the determine the full nucleotide sequence of protein containing pET28a-Cas12a.

Figure 37: gene sequencing of protein.