M e a s u r e m e n t

Measurement

Introduction

Measurement Part 1: Aptamer Selection by SELEX

Measurement Part 2: Monitoring SELEX Progression

Measurement Part 3: Aptamer Affinity Assessment

Measurement Part 4: Aptamer Specificity Validation

Measurement Part 5: Optimization of the Aptasensor

Measurement Part 6: Sensitivity Validation of the Aptasensor

References

Introduction

Our project aims to develop a diagnostic platform for Alzheimer's disease (AD) through the selection of high-affinity and specific nucleic acid aptamers against Brain-Derived tau (BD-Tau) protein, coupled with CRISPR-Cas12a for signal amplification, to achieve rapid and accurate detection.During the engineering phase, we used various approaches to establish proof of concept.

Our methodology is divided into two sequential phases. The first phase involves selecting BD-Tau-specific aptamers through SELEX, while the second phase focuses on developing a biosensor for BD-Tau detection using the identified aptamers.To ensure the reliability and reproducibility of the detection method, we established a standardized experimental protocol with rigorously repeatable procedures. This approach guarantees consistent performance across multiple tests and operational batches.Implementation of this development and validation framework provides assurance of the system's robustness and sensitivity. We conducted a comprehensive assessment of the AD detection system.

Part I: Comprehensive Evaluation of the SELEX System

  1. Aptamer Selection by SELEX
  2. Monitoring SELEX Progression ---Monitoring the binding efficiency between BD-tau and candidate aptamers in each SELEX round using flow cytometry.
  3. Aptamer Affinity Assessment --- Characterizing the binding affinity of selected aptamers towards BD-Tau using Surface Plasmon Resonance (SPR).
  4. Aptamer Specificity Validation --- Validating the binding specificity of the aptamers for BD-tau over non-target proteins using ELISA.

Part 2: Comprehensive Evaluation of the BD-tau Aptamer-Based Biosensor

  1. Optimization of the Aptasensor --- The binding concentration of BD-tau and the incubation time were optimized using a qPCR method.
  2. Sensitivity Validation of the Aptasensor --- The sensitivity of the biosensor was characterized using a fluorescence microplate reader.
Measurement Part 1: Aptamer Selection by SELEX

Background

The SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technology, first co-introduced by Craig Tuerk and Larry Gold in 1990, is an in vitro selection process that identifies nucleic acid aptamers with high affinity for a specific target from a random single-stranded nucleic acid library.Research has shown that aptamers are being utilized in the development of innovative biosensors. However, they can exhibit cross-reactivity, meaning they may bind not only to the intended target molecule but also to other structurally similar molecules, resulting in off-target effects. To reduce potential cross-reactivity, we have optimized the SELEX strategy and screening conditions.Thus enabling their application in innovative biosensors for the early detection of diseases and significantly advancing the field of precision medicine[1].

Principle

His-tagged target and interfering proteins are first immobilized on Ni-NTA magnetic beads. The bead-bound proteins are then incubated with the nucleic acid library, which enables the selection of high-affinity aptamers that specifically bind to the target protein. Finally, these aptamers are eluted and sequenced, facilitating the identification of candidate aptamer sequences.

The SELEX process primarily encompasses three key aspects: library design, selection strategy, and aptamer evaluation methods.

Library design:A single-stranded DNA (ssDNA) library with a 66-nucleotide random region flanked by fixed primer-binding sequences (e.g., 5'-CAGCACCGTCAACTGAAT-(N66)-GTGATGCGATGGAGATGT-3'). The initial library contained a diversity of approximately 1.2×10^16 unique molecular species.

Selection strategy: In the conventional SELEX process, which typically includes positive selection and counter-selection, we have modified the counter-selection step. Our refined approach employs BD-Tau as the target for positive selection, while utilizing T-Tau and empty Ni-NTA magnetic beads for counter-selection. This strategy enhances the specificity of the aptamers for BD-Tau by eliminating sequences that bind non-specifically to the T-Tau isoform or Ni-NTA, thereby mitigating potential cross-reactivity and reducing interference during the detection and screening process. SELEX contains 16 rounds of selection, divided into Positive Selection (Rounds 1-5), Denoising I (Rounds 6-7 ) and Denoising II (Rounds 8-16).

Evaluation Methods: We employed multiple analytical techniques to assess the stability and reproducibility of the SELEX system. These included monitoring the binding efficiency between BD-Tau and aptamers by flow cytometry, characterizing binding affinity using Surface Plasmon Resonance (SPR), and validating target specificity through ELISA.

Protocols

Materials

DsDNA library: 5'-CAGCACCGTCAACTGAAT-(N66)-GTGATGCGATGGAGATGT-3'

Target protein BD-tau:PHF6 domain (PMC4428543, PMC8304967): N-terminal acetylation + VQIVYKPVDLSK + Linker (2 units of 6-aminocaproic acid) + (His)6 (BBa_K4165204)

T-Tau (PMC6442731): N-terminal acetylation + KVAVVRTPPKSPS + Linker (2 units of 6-aminocaproic acid) + (His)6

Primer:

Selex_Fwd: 5'-CAG CAC CGT CAA CTG AAT-3' (FAM-labeled for monitoring).

Selex_Rev: 5'-ACA TCT CCA TCG CAT CAC-3' (biotinylated for strand separation).

Reagents: Ni-NTA magnetic beads, 1XPBS(137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8 mM KH₂PO₄, pH 7.4), 0.1 M NaOH.

Procedure

1. Acquisition of BD-Tau and T-Tau Proteins

  1. Obtain BD-Tau and T-tau protein with a purity >90% and a concentration of 5 mg/mL via Ni-NTA purification.
  2. Perform further purification using a Superdex 200 Increase column by size-exclusion chromatography. This step effectively removes protein aggregates and exchanges the buffer system into 1XPBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8 mM KH₂PO₄, pH 7.4), which is suitable for the SELEX process.

2. Ni-NTA Bead Preparation

  1. Take 20 μL of Ni-NTA magnetic beads (approximately 7×10⁵ beads) and place them in a 1.5 mL centrifuge tube.
  2. Add 500 μL of PBS and briefly mix, then immobilize the beads using a magnet and discard the supernatant.
  3. Repeat the washing step three times to ensure complete removal of the storage buffer.

3. BD-tau and T-tau immobilization

  1. Resuspend the Ni-NTA beads: Resuspend the Ni-NTA beads pellet in 100 μL 1xPBS containing 400μg/mL (for rounds 1-7 screening) or 800 μg/mL BD-tau peptide.
  2. Binding incubation: Place the mixture on a 4°C rotary shaker and incubate with oscillation overnight (16-18 h). Ensure thorough mixing to prevent bead sedimentation.
  3. No washing required: After incubation, directly retain the peptide solution and store at 4°C .
  4. Control bead preparation:

- Negative control: Processed using identical procedures but with pure PBS (without peptides).

- For counter selection: Immobilize T-tau and Ni-NTA beads.

4. DNA Library Preparation

  1. Heat the DNA library to 95˚C for 3 minutes
  2. Snap-cool for 5 minutes to form ssDNA to promote the formation of secondary structures in DNA.

SELEX contains 16 rounds of selection, divided into Positive Selection (Rounds 1-5), Denoising I (Rounds 6-7) and Denoising II (Rounds 8-16). For each section, refer to its corresponding procedure. {n} is used to represent variable values. Refer to the corresponding cell in Table 1 at coordinates (n, round number) for the specific value of a given trial.

图片1

Figure 1. SELEX Selection Process

5. Positive Selection (Rounds 1-5):

  1. Add Table1 column {1} nM of DNA library and Table1 column {3} μL of 400μg/mL BD-tau-Ni NTAbeads to ({1(volume)} - Vlib - {3}) μL of PBS buffer in an EP tube. For round 1, Calculate Vlib with the following equation: , where is the volume of the library needed, c1 is the molar concentration of the library and cd is the desired concentration.
  2. Allow library & BD-tau-Ni NTA beads to incubate for Table1 column {3} min.
  3. Add Table 1 column {6} μL ddH2O to the EP tubes containing the library and BD-tau-Ni NTA beads.
  4. Place the EP tubes into the magnetic separation rack. Carefully discard the supernatant without disturbing the beads.
  5. Repeat steps 3-4 an additional Table1 column {6} times.
  6. Add Table1 column {4} μL Dnase-free ddH2O to the EP tube. Heat the supernatant to 95˚C for 7 minutes.
  7. Place the system in the microcentrifuge for 30sec.
  8. Conduct {7} rounds of PCR on the sample(table 2 and 3).
  9. Wash 20 μL of streptavidin magnetic beads with 200 μL of Dnase-free ddH2O
  10. Wash the bead-bound library twice with 500 μL of DNase-free ddH₂O following a 30-minute incubation.
  11. Add 500 μL of 1M NaOH to the microcentrifuge tubes, incubate for 30 minutes, and then collect the supernatant.
  12. Conduct a nanodrop test for the supernatant to determine its concentration.
  13. Calculate Vlib for the next trial given by the following equation: where Vlib is the volume of the library needed, cm is the concentration measured via nanodrop and cd is the desired concentration.

6. Denoising I (Rounds 6-7)

  1. Add Table1 column {1} nM of DNA library and Table1 column {3} μL of 400μg/mL BD-tau-Ni NTA beads to Table1 column ({1(volume)} - Vlib - {2}) μL of PBS buffer for an EP tube.
  2. Allow the library & BD-tau-Ni NTA beads to incubate for Table1 column {3} min.
  3. Add Table1 column {6} μL ddH2O to the EP tubes containing the library and BD-tau-Ni NTA beads .
  4. Place the EP tubes into the magnetic separation rack. Carefully discard the supernatant without disturbing the beads.
  5. Repeat steps 3-4 an additional Table1 column {6} times.
  6. Add Table1 column {4} μL 1xPBS to the EP tube. Heat the supernatant to 95˚C for 7 minutes.
  7. Place the test tube on the magnetic separation rack.
  8. Transfer all eluted supernatant and Table1 column 400 μL of 400μg/mL T-tau-Ni NTA beads to a new test tube.
  9. Allow the beads and library to incubate for 30min.
  10. Place the test tube on the magnetic separation rack. Extract all supernatant and transfer to a new EP tube.
  11. Heat the supernatant to 95˚C for 7 minutes. Place the system in the microcentrifuge for 30sec.
  12. Conduct Table1 column {7} rounds of PCR on the sample(table 2 and 3).
  1. Wash 20 μL of streptavidin magnetic beads with 200 μL of Dnase-free ddH2O
  2. Wash the bead-bound library twice with 500 μL of DNase-free ddH₂O following a 30-minute incubation.
  3. Add 500 μL of 1M NaOH to the microcentrifuge tubes, incubate for 30 minutes, and then collect the supernatant.
  4. Conduct a nanodrop test for the supernatant to determine its concentration.
  5. Calculate Vlib for the next trial given by the following equation: where Vlib is the volume of the library needed, cm is the concentration measured via nanodrop and cd is the desired concentration.

7. Denoising II (Rounds 8-16)

  1. Add Table1 column {1} nM of DNA library and Table1 column {2} μL of unloaded Ni-NTA beads to Table1 column ({1(volume)} - Vlib - {2}) of PBS buffer to an EP tube.
  2. Allow the library & sunloaded Ni-NTA beads to incubate for Table1 column {2} min.
  3. Extract the supernatant and transfer to a new EP tube.
  4. Add extract the supernatant to Table1 column {3} μL of 800μg/mL BD-tau-Ni NTA beads .
  5. Allow the library & 800μg/mL BD-tau-Ni NTA beads to incubate for Table1 column {3} min.
  6. Add Table1 column {6} μL PBS to the EP tube containing the library and BD-tau-Ni NTA beads.
  7. Place the microtubes into the magnetic separation rack. Carefully discard the supernatant without disturbing the beads.
  8. Repeat steps 4-5 an additional Table1 column {6} times.
  9. Add Table1 column {4} μL PBS to the EP tube. Heat the supernatant to 95˚C for 7 minutes.
  10. Place the test tube on the magnetic separation rack.
  11. Transfer all eluted supernatant and Table1 column {5} μL of 400μg/mL BD-tau-Ni NTA beads to a new test tube.
  12. Allow the beads and library to incubate for 30min.
  13. Place the test tube on the magnetic separation rack. Extract all supernatant and transfer to a new EP tube.
  14. Heat the supernatant to 95˚C for 7 minutes.
  15. Place the system in the microcentrifuge for 30sec.
  16. Conduct {7} rounds of PCR on the sample(table 2 and 3).
  17. Conduct a nanodrop test for the supernatant to determine its concentration.
  18. Calculate Vlib for the next trial given by the following equation: where Vlib is the volume of the library needed, cm is the concentration measured via nanodrop and cd is the desired concentration.

The selection process of SELEX in Table 1:

{1}

{2}

{3}

{4}

{5}

{6}

{7}

Round

DNA Library (Concentration, Volume)

Counter-selection (Bead Volume, Time)

Positive Selection (BD-tau Bead Volume, Time)

Elution Volume

Secondary Counter-selection (T-tau Bead Volume, Time)

Wash (Volume, Repetitions)

PCR Cycles

1

40 µM, 500 µL

–

25 µL × 2, 60 min

100 µL

–

500 µL × 2

20

2

300 nM, 500 µL

–

25 µL × 2, 45 min

300 µL

–

500 µL × 2

14

3

300 nM, 500 µL

–

25 µL × 2, 30 min

300 µL

–

500 µL × 2

14

4

250 nM, 500 µL

–

50 µL × 2, 30 min

300 µL

–

500 µL × 2

14

5

250 nM, 500 µL

–

50 µL × 2, 30 min

300 µL

–

500 µL × 3

12

6

250 nM, 500 µL

–

50 µL × 2, 30 min

500 µL

400 µL, 30 min

500 µL × 3

12

7

250 nM, 500 µL

–

50 µL × 2, 30 min

500 µL

400 µL, 30 min

1000 µL × 3

22

8

250 nM, 300 µL

125–1000 µL, 30 min

50 µL × 2, 30 min

300 µL

400 µL, 30 min

1000 µL × 3

26

9

250 nM, 300 µL

400 µL, 30 min

50 µL × 2, 30 min

300 µL

400 µL, 30 min

1000 µL × 3

24

10

250 nM, 300 µL

1000 µL, 30 min

50 µL × 2, 30 min

300 µL

1000 µL, 30 min

1000 µL × 3

10

11

250 nM, 300 µL

1000 µL, 30 min

50 µL × 2, 30 min

300 µL

1000 µL, 30 min

1000 µL × 3

18

12

250 nM, 300 µL

1000 µL, 30 min

50 µL × 2, 30 min

500 µL

1000 µL, 30 min

1000 µL × 3

16

13

250 nM, 300 µL

1000 µL, 30 min

50 µL × 2, 30 min

500 µL

1000 µL, 30 min

1000 µL × 3

16

14

250 nM, 300 µL

1000 µL, 30 min

50 µL × 2, 30 min

500 µL

1000 µL, 30 min

1000 µL × 5

20

15

250 nM, 300 µL

1000 µL, 30 min

50 µL × 2, 30 min

500 µL

1000 µL, 30 min

1000 µL × 5

14

16

100 nM, 200 µL

200 µL, 30 min

50 µL × 2, 30 min

500 µL

200 µL, 30 min

1000 µL × 5

12

Prepare a 50 μL system for PCR in Table 2:

Componment

Volume(μl)

2XPrime Star

25

Selex_Fwd

1

Selex_Rev

1

Library

23

Prepare a 50 μL system for PCR process in Table 3:

Step

Temp

Time

# of cycles

Initial Denaturation

95°C

90s

Denaturation

95°C

30 sec

Table 1

Primer Annealing

57°C

30 sec

Extension

72°C

60 sec

Final Extension

72°C

3 min

Result

We employed 27 DNA sequences obtained from the SELEX system to predict their interactions with Tau and BD-Tau proteins through molecular docking. For detailed modeling procedures, click here: https://2025.igem.wiki/keystone/model

Based on the molecular docking results of all 27 DNA sequences listed in Table 4, the binding strength between the DNA sequences and the target proteins was evaluated using Z-scores. A lower Z-score indicates a higher binding potential. We specifically prioritized nucleic acid aptamers exhibiting strong binding affinity to BD-Tau while showing weak affinity to Tau protein. This screening process identified three DNA sequences- Aptame-08, Aptame-14 and Aptame-16-with promising docking results.

These results confirm the feasibility of our optimized SELEX system for selecting nucleic acid aptamers that specifically bind to BD-Tau.

Table 4. Nucleic Acid Aptamer Sequences and Z-Scores

Number

Aptamer Sequences

T-tau Z-Score

BD-Tau Z-Score

1

5' -TCACCTGAGACTTGACGATGGCATCACTCCCCCCCACCTATTACATCATCATAAATTGAGTGCTATCGTCTGTCCA - 3'

-1.1

-1.3

2

5' - TCACCTGAGACTTGACGATGGCCTCCCCCTCACGCACTCTTCCGTTTCTTCTTATCTGAGTGCTATCGTCTGTCCA - 3'

-0.9

-1.2

3

5' - TCACCTGAGACTTGACGATGGAACTCCCCCCACCATTATCAGCGCACCACCATTGTAGAGTGCTATCGTCTGTCCA - 3'

-1.2

-1.5

4

5' - TCACCTGAGACTTGACGATGGTTTAACTCCCCCACGCCCCCCGCCAACCCATCTCCAGAGTGCTATCGTCTGTCCA - 3'

-2.5

-1.6

5

5' - TCACCTGAGACTTGACGATGGTACGACGGCCCCCCGATTATGCGACTACTTGATTTGAGTGCTATCGTCTGTCCA - 3'

-1.5

-1.7

6

5' - TCACCTGAGACTTGACGATGGTCAGAACGACGCGCCCCCCACCTCATTCATTATTTTGAGTGCTATCGTCTGTCCA - 3'

-1.7

-2.1

7

5' - TCACCTGAGACTTGACGATGGTGACCACCCCCCACGCACACACACCTCTTCCATCCTGAGTGCTATCGTCTGTCCA - 3'

-1.7

-2.0

8

5' - TCACCTGAGACTTGACGATGGCACTACCCCTCCCTACTAAGCACGGTATCTTGTACTGAGTGCTATCGTCTGTCCA - 3'

-1.2

-1.8

9

5' - TCACCTGAGACTTGACGATGGGAACAAACACCGCGACCACCCCCCCACTTAACTCCTGAGTGCTATCGTCTGTCCA - 3'

-2.1

-1.4

10

5' - TCACCTGAGACTTGACGATGGCAATCCCCCCGACACCGAATCCTAAGCGAACAACGCGAGTGCTATCGTCTGTCCA - 3'

-1.4

-1.2

11

5'- TCACCTGAGACTTGACGATGGACTCACAAACTCGAGCCACCCCCGACCCACACAACAGAGTGCTATCGTCTGTCCA - 3'

-1.7

-1.8

12

5'- TCACCTGAGACTTGACGATGGTACTCCCCCCCAACCTAATAGCTCTTTACCCTCTGAGAGTGCTATCGTCTGTCCA - 3'

-1.5

-1.8

13

5' - TCACCTGAGACTTGACGATGGCCGACTCCCCACCCTACATCGCAACATTGACTATTAGAGTGCTATCGTCTGTCCA - 3'

-1.7

-1.3

14

5' - TCACCTGAGACTTGACGATGGTTCTACACTGCCCCCCCGACCCGCCAGACCAACCCAGAGTGCTATCGTCTGTCCA - 3'

-1.0

-2.1

15

5' - TCACCTGAGACTTGACGATGGCAATCCTCCGAGCTCCACCCACCCTTACTCAACATTGAGTGCTATCGTCTGTCCA - 3'

-2.6

-2.2

16

5' - TCACCTGAGACTTGACGATGGCGCTACCCCCTAACTTCAACCCGCATTATTCTAGCTGAGTGCTATCGTCTGTCCA - 3

-1.8

-2.3

17

5' - TCACCTGAGACTTGACGATGGTTACCGAACCCGACACCCCCGCCGACACCAGCCCCAGAGTGCTATCGTCTGTCCA - 3'

-2.2

-1.5

18

5' - TCACCTGAGACTTGACGATGGCCCCCCCCCGCACCGCCTCATTCAGCATACTAATACGAGTGCTATCGTCTGTCCA - 3'

-1.9

-1.2

19

5' - TCACCTGAGACTTGACGATGGCAACCACCCCCCCTGGCTACATCATATTCTTATCTTGAGTGCTATCGTCTGTCCA - 3'

-2.1

-1.3

20

5' - TCACCTGAGACTTGACGATGGTTTCTTCGCCCCCCCCACACACTACACGTTTCTTCTGAGTGCTATCGTCTGTCCA - 3'

-2.2

-2.1

21

5' - TGACTGATTTACGGAAGCTGAATAAGGACTGCTTAGGATTGCGATGATTCAGCT - 3'

-2.6

-1.5

22

5' - TGACTGATTTACGGAAGTTACGGACGGATGTCAGTGGTATAGTAATCCGTAACT - 3'

-1.7

-1.5

23

5' - TGACTGATTTACGGAAGCTGAATAAGGACTGCTTAGGATTGCGATGATTCAGCT - 3'

-1.4

-1.6

24

5' - CGTAAATCAGTCAGAAGCTGAATAAGGACTGCTTAGGATTGCGATGATTCAGCT - 3'

-1.4

-1.2

25

5' - GCGGAGCGTGGCAGG - 3'

-2.3

-1.4

26

5' - CCTGCCACGCTCCGC - 3'

-2.3

-1.6

27

5' - CTGAATCATCGCAATCCTAAGCAGTCCTTATTCAGAAAAAAAAAAAAAAAA - 3'

-2.1

-2.0

Discussion

The experimental results indicate that Aptamer-08, Aptamer-14, and Aptamer-16 exhibit stronger binding affinity to BD-Tau than to T-Tau.We conducted two rounds of SELEX screening during the project. The initial strategy involved separate selections against BD-Tau and T-Tau, followed by the removal of aptamers common to both. This strategy, however, did not yield satisfactory results.

Based on these findings, we implemented several key optimizations in the design and conditions of the second selection round, as detailed below:

1.Our optimized SELEX protocol incorporated sequential counter-selections against empty Ni-NTA beads and T-Tau at eighth round , thereby effectively removing non-specific and cross-binding aptamers to ultimately isolate highly specific aptamers.

2. Moreover, we employed multiple rounds of selection under increasingly stringent conditions, a strategy designed to efficiently isolate high-affinity aptamers.

We have provided a detailed experimental protocol to ensure the reproducibility of the experiments. To further rigorously monitor the SELEX screening process, we employed flow cytometry to conduct real-time monitoring of each selection round.

Measurement Part 2: Monitoring SELEX Progression

Background

Flow cytometry is a powerful technology capable of performing rapid, multi-parametric quantitative analysis and sorting of individual cells or other microscopic particles in suspension[1]. However, flow cytometry cannot directly detect DNA or proteins. Since the nucleic acid aptamers in our project cannot be monitored by flow cytometry, but there was a need to track the binding efficiency of each SELEX round, we turned to an alternative approach. Studies have shown that flow cytometry can be used to analyze and sort magnetic beads, which provided the basis for our indirect monitoring strategy.We incorporated a FAM label into the primers used for PCR amplification during the SELEX screening. FAM (Carboxyfluorescein) is a commonly used fluorescent dye for labeling peptides, proteins, and nucleotides. By measuring the fluorescence intensity of FAM associated with the magnetic beads, we were able to characterize the binding efficiency.

Principle

Flow cytometry is a biological technique used for counting and sorting microscopic particles suspended in a fluid(Zuo etal, 2014). In our experiments, we first incubate Ni-NTA magnetic beads with His-tagged BD-tau protein to allow complex formation. Subsequently, nucleic acid aptamers with high affinity can specifically bind to the BD-tau Ni-NTA magnetic beads. The test sample contains four distinct components: Ni-NTA magnetic beads, BD-tau-conjugated Ni-NTA magnetic beads, aptamer-bound BD-tau-Ni-NTA magnetic bead complexes, and free nucleic acid aptamers.

We employed flow cytometry to separate the four components in the experimental sample.The BD-tau-conjugated Ni-NTA magnetic beads and unconjugated Ni-NTA beads can be distinguished and sorted based on their physical properties, but they yield no RFU signal due to the absence of fluorescent labeling. Furthermore, free nucleic acid aptamers, being DNA molecules below the detection threshold of conventional flow cytometry, cannot be directly detected by this method. RFU signals are generated only when nucleic acid aptamers are complexed with BD-tau-Ni-NTA magnetic beads. The RFU value thereby serves as a qualitative indicator of the relative extent of aptamer-bead binding.

Protocols

Materials:

Ni-NTA Magnetic Beads, 1xPBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4,pH 7.4), Binding Buffer(20 mM Tris-HCl (pH 7.4-7.6); 120 mM NaCl; 5 mM KCl; 1-5 mM MgCl; 0.01-0.1% (v/v) Tween-20; 0.1-1 mg/mL BSA or 0.1-0.5% (w/v) Yeast tRNA), 1xPBS/MgCl, Sheath Fluid

Procedure:

1. Sample Preparation

Beads Pretreatment:

  1. Pipette 20 μL of 400 μg/mL BD-Tau and Ni-NTA magnetic beads (approximately 1.4×10⁵ beads) into a 1.5 mL microcentrifuge tube.
  2. Add 500 μL of PBS buffer, vortex for 10 seconds.
  3. Centrifuge at 10,000 rpm for 10 seconds in a microcentrifuge and discard the supernatant.
  4. Repeat the wash step three times.

Aptamer Binding:

  1. Resuspend the washed beads in 80 μL of binding buffer.
  2. Add FAM-labeled aptamer to a final concentration of 100 nM
  3. Incubate at 4°C for 30 minutes in the dark.

Washing Steps:

  1. After incubation, add 500 μL of 1xPBS/MgCl₂ buffer.
  2. Vortex, then centrifuge for 10 seconds and discard the supernatant.
  3. Repeat the wash twice.
  4. Finally, resuspend in 80 μL of binding buffer for subsequent analysis.

Flow Cytometric Detection and Analysis

  1. Repeat for all cycles and for 2 control samples containing unbound Ni-NTA beads and unbound aptamers respectively.
  2. Pass all solutions through separate 35μm-pore-size sieves to prevent the sample from jamming the flow cytometry machine.
  3. Add a control/blank solution of unbound streptavidin magnetic beads to the cytometry machine to test it.
  4. Adjust the parameters of the flow cytometry machine:
  1. Set a range of detection. This will appear as a polygon on Graph 1 whose vertices may be determined by clicking on their desired locations. All datapoints within this polygon are registered.
  2. Adjust the voltage until a clustered, elliptical distribution starts showing on Graph 1. The voltage used was ~0.62 V.

Results Before SELEX Method Optimization

图片18

Figure 2. Flow symmetry concerning the product of various rounds of the SELEX process

This figure 2 presents our findings on flow symmetry concerning the product of various rounds of the SELEX process. RFU, or Relative Fluorescence Units, quantifies the intensity of the fluorescent signal emitted by the FAM attached to the F primer during PCR. As illustrated in the figure 2, RFU values progressively increased from round 1 to round 6, indicating a gradual enrichment of aptamers with binding affinity for BD-tau. Post round 6, we implemented reverse screening to eliminate non-specific binders, which resulted in a noticeable decline in RFU. By round 12, after additional rounds of stringent selection, there was a substantial decrease in RFU, suggesting that only a small pool of aptamers with the highest affinity remained.Finally, the selected nucleic acid aptamers were sequenced to determine their precise nucleotide sequences, thereby providing the essential molecular information for subsequent development steps.

Results After SELEX Method Optimization

As depicted in the Figure 3, the RFU increased progressively from round 1 to round 6, reflecting a gradual enrichment of aptamers with binding affinity for BD-tau. After round 6, we initiated reverse screening to eliminate non-specific binders, resulting in a noticeable decline in RFU. By round 12, following additional rounds of stringent selection, the RFU decreased substantially, indicating that only a small pool of aptamers with the highest affinity remained.

2-流式

Figure 3. Flow symmetry concerning the product of various rounds of the SELEX process

Discussion

According to Measurement Part 1, both before and after optimization of SELEX, we monitored the selection process using flow cytometry. The results indicate that the SELEX process remained stable. As the stringency of the selection conditions increased, the RFU significantly decreased starting from round 12, suggesting that only a small number of aptamers with the highest affinity were retained. These results demonstrate that our SELEX screening method is reproducible.

Measurement Part 3: Aptamer Affinity Assessment

Background

The core of SPR is to monitor changes in refractive index caused by molecular binding events on the chip surface. This change is converted into a signal response value (Response Units, RU). It is used to assess the binding strength and dissociation rate between antibodies and target proteins, thereby screening candidate molecules with the highest affinity and longest-lasting effect [2-4]. We applied this method to validate the affinity between BD-tau and the nucleic acid aptamer screened by the SELEX system, thereby verifying the SELEX system.

Principle

The biotinylated target protein BD-tau was immobilized onto the gold film surface of an SPR chip (CM5 chip) pre-coated with streptavidin (SA). The nucleic acid aptamer was then flowed over the chip surface at a certain flow rate. The binding between the two molecules led to an increase in the mass on the chip surface, resulting in a rise in the Response Units (RU) value, from which the dissociation constant (Kd) was calculated.

The dissociation constant (Kd) reflects the rate at which a complex dissociates into free molecules. Its core calculation is based on the ratio of the kinetic parameters kon (association rate constant) and koff (dissociation rate constant):

kon: the rate at which molecules bind to form a complex per unit time, measured in M⁻¹s⁻¹. koff: the rate at which a complex dissociates per unit time, measured in s⁻¹.

Protocols

Control Channel: A channel immobilized with an unrelated protein was used simultaneously for measurement. The signal obtained represents the background signal generated by refractive index changes, non-specific binding, etc. During final data analysis, this background signal must be subtracted from the signal of the experimental channel.

Blank Injection Control: The running buffer (without analyte) was injected as a "zero-concentration" point to assess baseline stability and buffer effects.

1. Chip Surface Preparation and Immobilization

  1. The target protein, 5 mg/ml BD-tau, was biotinylated.
  2. An SPR chip (CM5) pre-coated with Streptavidin (SA) was used.
  3. The biotinylated target BD-tau protein was injected over a designated flow cell on the SA chip, allowing it to be specifically and securely captured.

2. Binding and Dissociation Assay

  1. The nucleic acid aptamer was serially diluted with running buffer to concentrations of 0 μM, 5 μM, 10 μM, 30 μM, 100 μM, and 150 μM.
  2. The series of diluted aptamer solutions were sequentially injected over the chip surface immobilized with the target protein in order of increasing concentration, at a constant flow rate of 50 µL/min, to monitor the association phase.
  3. After each concentration was injected for a period of time (typically3 minutes), the flow was switched to running buffer to monitor the dissociation phase (typically 10 minutes).
  4. Between each cycle, a regeneration solution (2 M NaCl for protein-nucleic acid interactions) was briefly injected (30-60 seconds) to completely remove any bound aptamer and regenerate the chip surface.

Results Before SELEX Method Optimization

The initial graph illustrates the relationship between aptamer concentration and the energy required to dissociate the aptamer from its target protein. Five different concentrations of the aptamer were utilized for the SPR analysis. Subsequently, the second graph re-plotted the data from the Figure 4 with the x-axis representing aptamer concentration, and was derived.

Figure 4. Affinity assessed by using surface plasmon resonance

Table 5. Aptamer Sequences and Dissociation Constants

图片10

The Table 5 above illustrates the three optimal aptamers. The dissociation constant (Kd) represents the affinity for the target protein, with this value being determined through the Surface Plasmon Resonance (SPR) method.Notably, the Aptamer-3 exhibited a Kd value of approximately 56.66, signifying maybe affinity for the BD-tau protein.Based on the Kd values, we selected Aptamer-3 from the three nucleic acid aptamers as having the affinity for BD-tau.

Results After SELEX Method Optimization

图片31

Figure 5. Aptamer-08 affinity assessed by using surface plasmon resonance

图片32

Figure 6 . Aptamer-14 affinity assessed by using surface plasmon resonance

图片33

Figure 7. Aptamer-16 affinity assessed by using surface plasmon resonance

As shown in the figure 5,6and 7, the Kd values for Aptamer-08, Aptamer-14, and Aptamer-16 are 11.32, 6.38, and 21.38, respectively. Among them, Aptamer-14 demonstrates the lowest Kd value compared to Aptamer-08 and Aptamer-16, indicating it possesses the highest binding affinity for BD-tau. Based on the Kd values, we selected Aptamer-14 as the nucleic acid aptamer with the strongest affinity for BD-tau from the three candidates. A nd Aptamer-14 was utilized for the development of a nucleic acid aptamer-based sensor for detecting BD-tau.

Discussion

Comparison of the Kd values before and after optimization shows that the Kd values of the optimized Aptamer-08, Aptamer-14, and Aptamer-16 were significantly higher than those of the pre-optimization Aptamer-1, Aptamer-2, and Aptamer-3. This indicates an improvement in the affinity of the selected nucleic acid aptamers. Furthermore, these results demonstrate that our SELEX optimization strategy was successful and reproducible. Furthermore, Aptamer-14, which exhibits high affinity and specificity, can be utilized for developing sensors to detect BD-tau.

Measurement Part 4: Aptamer Specificity Validation

Background:

The sandwich ELISA technique utilizes two specific antibodies (a capture antibody and a detection antibody) to "sandwich" the antigen. The process involves first coating the plate with the capture antibody, then adding the sample containing the antigen, followed by the addition of an enzyme-labeled detection antibody[5-8].

Principle:

We immobilized the biotinylated nucleic acid aptamer onto the wells of a 96-well ELISA plate. The BD-tau protein in the sample binds to the aptamer. Subsequently, after incubation with Streptavidin-polyHRP and the addition of a chromogenic substrate, the binding efficiency between BD-tau and the nucleic acid aptamer can be validated by measuring the absorbance.

Protocols

Materials

1x TBST, simulated plasma, 5mg/ml BD-tau, 5mg/ml Tau, 20 mg/mL biotin in PVP, biotin, Streptavidin Poly-HRP

Procedure:

Binding Aptamers to Plate:

  1. Dilute the aptamer-3 solution with the coating solution (pH9.6) to 1μg/mL.
  2. Add 100μL of the diluted aptamer solution to each well of the 96-well plate. Incubate overnight at 4°C.

Blocking & Washing:

  1. Wash the plate 3 times by adding 200 μL 1X TBST to each well.
  2. Add 200μL of sealing buffer to each well; Incubate at room temperature for 1 hour or at 37 ° C for 30 minutes.
  3. Wash the plate 3 times by adding 200 μL 1X TBST to each well.

Sample Preparation & Addition:

  1. Prepare standard curve samples with concentrations 1pg/ml, 2pg/ml, 10pg/mL, 20,ng/mL 50ng/mL, 100ng/mL, 200ng/mL, 500ng/mL,1000ng/mL, 2000ng/mL, 5000ng/mL and 10,000 ng/mL BD-tau.
  2. Prepare samples with concentrations 0ng/mL, 2pg/ml, 25ng/mL, 50ng/mL, 100ng/mL, 200ng/mL, 500ng/mL BD-tau.
  3. Randomly generate 2 equal-sized sets of sample concentrations, one below 100 pg/mL and the other above 100 pg/mL and below 10 ng/mL. (See Attachment 1 for c++ code for generating random concentrations).
  4. Prepare H2O-based and artificial blood-based storage solutions containing.
  5. Prepare solutions of all randomly-generated concentrations. Use the H2O storage solution to prepare 25% of randomized sample concentrations and artificial blood for the remaining 75%.
  6. Add the remaining randomized samples prepared in step 4 to the subsequent wells.

Incubation:

  1. 1.Incubate at room temperature for 2 hours (or overnight at 4 ° C).
  2. 2.Wash the plate three times with 1xTBST.

Fittest incubation:

  1. 1.Add 100μL of biotin solution (500nM TBST+20 mg/mL biotin in PVP buffer+100 μg/mL salmine DNA) to each well.
  2. 2.Incubate the plate at room temperature for 1 hour.
  3. 3.Wash the plate three times with TBST.
  4. Incubation of enzyme-labeled secondary antibodies
  5. 1.Add 100 μL of Streptavidin Poly HRP to each well diluted at a ratio of 1:10,000 to TBST.
  6. 2.Incubate at room temperature for 1 hour. Wrap the sample in aluminium foil.
  7. 3.Wash the board 5 times with TBST.

Color Development & Measurement:

  1. 1.Add 100μl of TMB chromogenic substrate to each well and react in the dark for 10-15 minutes.
  2. 2.Add 50μL/well of termination solution with concentration 2M.
  3. 3.Measure the absorbance at 450nm using an microplate reader (reference wavelength: 450-620nm).

Results Before SELEX Method Optimization

In the first SELEX, we validated the binding affinity of aptamer Aptamer-3 using ELISA. To simulate conditions in AD and non-AD patients, artificial blood was spiked with varying concentrations of BD-tau and peripheral tau, thereby minimizing potential interference from other factors. In the figure 8A, the initial graph illustrates a positive correlation between the increased concentration of our Aptamer-3 and the bound BD-tau levels. The figure 8B demonstrates the results of an ELISA assay conducted to detect Alzheimer's Disease (AD) within a simulated blood plasma environment. The data indicate that the ELISA assay consistently identified elevated BD-tau levels in the plasma of the AD group, whereas the control group exhibited significantly lower BD-tau levels. These findings suggest that the aptamer is capable of accurately detecting AD within a plasma environment.

图片121

Figure 8. Quantitative binding analysis of BD-Tau Aptamer-3 in simulated plasma environments

Results After SELEX Method Optimization

In the second SELEX, We validated the binding affinity of Aptamer-14 using ELISA. In the figure 9 shows that the increase concentration of our aptamer has a positive correlation with the binded BD-tau level. Furthermore, the figure 9 demonstrates that BD-tau can be detected even at concentrations ranging from 2 pg/mL to 25 ng/mL, confirming the high affinity of our Aptamer-14 for BD-tau.

Aptamer-14-Elisa

Figure 9. Quantitative binding analysis of BD-tau Aptamer-14 in simulated plasma environments

Discussion

During real-world detection, nucleic acid aptamers may be affected by various substances in human blood. To verify the specificity of the aptamers, we added different concentrations of BD-tau and Tau protein into an artificial simulated blood environment, mimicking biological samples from Alzheimer's disease (AD) patients and non-AD patients, thereby excluding potential interference from other factors on the experimental data. The results demonstrate that the nucleic acid aptamers screened by the SELEX system can specifically recognize the target under various experimental conditions, indicating that the obtained aptamers possess high sensitivity and specificity.

Compared to the results before and after the SELEX system optimization, the optimized Aptamer-14 exhibits a lower detection range for BD-tau than Aptamer-3, thereby demonstrating the significant effectiveness of our optimization.

Measurement Part 5: Optimization of the Aptasensor

Background

qPCR is a powerful molecular biology technique that not only enables highly specific amplification of DNA/RNA but also allows real-time monitoring of the amplification process through fluorescent signals, thereby achieving precise quantification [8-10]. The optimization of aptamer-based biosensors is a critical aspect of the detection system, involving factors such as detection time, detection efficiency, and concentration. We utilize this technology to optimize various aspects of the biosensor for detecting BD-tau in our research project.

Principle

The “magnetic beads-ComDNA/aptamer-dsDNA” biosensor consists of three components: streptavidin-coated magnetic beads, a biotin-modified single stranded DNA (ssDNA) partially complementary to the aptamer sequence, and a hybrid strand formed by the engineered aptamer linked to a Cas12a-activating double stranded DNA (dsDNA) sequence. The streptavidin-coated magnetic beads have a diameter of 1 μm, with a theoretical loading capacity of 500 pmol of biotinylated single stranded oligonucleotide (24 nt in length) per mg. The ComDNA is synthesized commercially and shares a complementary sequence of 10-15 bases in length with the engineered aptamer. The complex formed by the complementary pairing of ComDNA and the aptamer is a commonly used method for constructing an aptamer switch.

In the absence of the analyte, the ComDNA binds to the aptamer, preventing the formation of the aptamer’s secondary structure. When the analyte is present, the binding affinity between the analyte and the aptamer is stronder than the force of complementarity between the ComDNA and the aptamer. This displaces the ComDNA, allowing the aptamer to form its secondary structure. In the constructed magnetic bead-ConDNA/aptamer-dsDNA complex, this is manifested as the analyte binding to the aptamer, causing the separation of the aptamer from the ComDNA anchored on the magnetic bead(figure 10). qPCR can be used to quantify dsDNA, thereby further characterizing the interaction between BD-tau and the nucleic acid aptamer, and optimizing the concentration and incubation time for the aptamer-based bead sensor.

图片13

Figure 10. The Operating Principle of the Magnetic Bead Biosensor

Protocols

Materials: 

Name

Sequence

Streptavidin Magnetic Beads

/

Reference genes actin

/

qPCR-F:

TGAGC CATGT ATCCA

qPCR-R:

TGGAA CTGTC AGAGC

BD-Tau aptamer-F:

TACTCTCACCTGAGACTTGACGATGGTTCTACACTGCCCCCCCGACCCGCCAGACCAACCCAGAGTGCTATCGTCTGTCCATATTTTTTATTCCGACCTCATTAAGCAGC

ds-DNA-F

TGAGCCATGTATCCAGGTCATTTGTCCCTATCAGTGATAGAGAAGCTCTGACAGTTCCA

ds-DNA-R

TGGAACTGTCAGAGCTTCTCTATCACTGATAGGGACAAATGACCTGGATACATGGCTCAGCTGCTTAATGAGGTCGGAAT

ComDNA1

cccaaaggGAGTAtttttttttttt-biotin

ComDNA2

accccaaaggGTtttttttttttt-biotin

ComDNA3

tcgtcaagccatttttttttttt-biotin

ComDNA4

Tcttcgtcaagctttttttttttt-biotin

ComDNA4

Actttcttcgtcatttttttttttt-biotin

Procedure:

1. Preparation of Aptamer-dsDNA Conjugate

  1. Corresponding modified oligonucleotides—10 μM BD-tau aptamer-F, dsDNA-F, and dsDNA-R—were synthesized by a commercial supplier.
  2. The three components were mixed at a 1:1:1 molar ratio in a final 1× Taq buffer and thoroughly combined.
  3. The mixture was incubated at 95°C for 5 minutes, then gradually cooled to room temperature at a rate of 2°C per minute.
  4. The resulting aptamer-dsDNA conjugate was quantified using a NanoDrop spectrophotometer, diluted to a final concentration of 5 μM, and stored at -20°C for future use.

2. Preparation of the Aptamer Sensor:

  1. The streptavidin magnetic beads stored at 4°C were taken out and thoroughly vortexed to ensure a homogeneous suspension.
  2. A 20 μL aliquot of streptavidin magnetic beads was transferred into a nuclease-free 1.5 mL centrifuge tube. The tube was placed on a magnetic rack for 1 minute to separate the beads from the storage solution, after which the supernatant was carefully aspirated and discarded.
  3. The beads were washed with 200 μL of 1× PBST buffer, vortexed to resuspend, and then magnetically separated for 1 minute. The supernatant was removed. This washing procedure was repeated three times to thoroughly remove the NaN₃ preservative present in the streptavidin magnetic bead storage solution.
  4. After washing, 20 μL aliquots of pre-quantified 0μM, 1 μM, 2 μM, 5 μM, and 10 μM biotin-modified Com DNA1, Com DNA2, Com DNA3, Com DNA4, and Com DNA5 were added to separate centrifuge tubes. Each was then brought to a total volume of 200 μL by adding 1× PBST buffer.
  5. The mixtures were vortexed thoroughly and then incubated on a rotator for 30 minutes to allow full binding between the Com DNA and the streptavidin on the magnetic beads.
  6. After incubation, the tubes were placed on the magnetic rack for separation. The supernatant was aspirated and discarded to remove any excess Com DNA that did not bind to the beads.
  7. The beads were washed with 200 μL of 1× PBST buffer, vortexed, magnetically separated for 1 minute, and the supernatant was discarded. This washing step was repeated twice.
  8. After washing, 20 μL of the pre-prepared 5 μM aptamer-dsDNA conjugate was added to each centrifuge tube. The volume in each tube was then adjusted to 200 μL using 1× PBST buffer.
  9. The mixtures were vortexed thoroughly and incubated on a rotator for 30 minutes to allow complete hybridization between the aptamer-dsDNA and the Com DNA.
  10. After incubation, the tubes were placed on the magnetic rack for separation. The supernatant was aspirated and discarded to remove any excess unbound aptamer-dsDNA.
  11. The beads were washed with 200 μL of 1× PBST buffer, vortexed, magnetically separated for 1 minute, and the supernatant was discarded. This washing step was repeated three times.
  12. After the final wash, 900 μL of 1× PBST buffer was added to each tube to resuspend the "magnetic bead-Com DNA/aptamer-dsDNA" complexes in the buffer.

3. qPCR Detection

  1. Add a 10 μM BD-tau and incubate at 4 °C for 10, 20, 30, 40, 50, and 60 minutes.
  2. Searate the supernatant using a magnetic rack .
  3. Quantify the amount of released BD-tau/Tau aptamer-dsDNA complex using quantitative real-time PCR (qPCR). Use a control sample where an equivalent volume of water is added instead of BD-Tau protein.

Result

  1. Screening for ComDNA with Optimal Signal-to-Noise Ratio

To further evaluate the binding efficacy of ComDNA to the BD-tau aptamer-dsDNA complex and ensure efficient dissociation of ComDNA upon BD-tau protein. We designed five ComDNA variants (ComDNA1–ComDNA5) for systematic testing. Following incubation with an excess of BD-tau protein, the released BD-tau aptamer-dsDNA complex was quantified using quantitative PCR (qPCR). A control group, in which the Tau protein was replaced with an equivalent volume of water, was included to calculate the signal-to-noise ratio. This allowed for the screening of the ComDNA sequence with the highest signal-to-noise ratio.

Com1-5

Figure 11. Signal-to-noise ratio of ComDNA verified with BD-Tau

The figure 11 clearly indicate that under the positive control condition with BD-Tau, the sensor generated a significant fluorescent response, confirming the overall feasibility of the system.The relative fluorescence value of ComDNA3 was significantly higher than that of other groups, indicating that ComDNA3 achieves the highest signal-to-noise ratio. These experimental results are confirned the selection of ComDNA3 for biosensor fabrication.

  1. Determination of ComDNA and Aptamer 14-dsDNA Complex Concentration

Following the screening of the aptamer switch ComDNA3, it is necessary to determine the optimal concentration of the aptamer-dsDNA complex. Different concentrations of the aptamer-dsDNA complex were used to construct the "magnetic bead-biotinylated ComDNA-aptamer-dsDNA" complex. The signal-to-noise ratios at different Com DNA-aptamer-dsDNA concentrations were evaluated to identify the optimal concentration.

浓度

Figure 12. Signal-to-noise ratio of ComDNA verified with BD-Tau.

Figure 12 shows that the signal intensity increases with rising nucleic acid aptamer concentration. The system demonstrated maximum response at 10 μM .

2.3 Determination of Incubation Time for BD-tau with the Biosensor

To determine the optimal incubation time between the target protein and the sensor for practical applications, we designed and conducted a corresponding experiment. Under the same protein concentration, samples were incubated for different durations, and the fluorescence signals at each time point were collected and measured to compare the trend of signal intensity over time.

时间

Figure 13. Signal-to-noise ratio of ComDNA verified with BD-Tau (Normalization Gene:actin )

The figure 13 showed that the fluorescence intensity reached its maximum after 40 minutes of incubation, and further extension of the reaction time did not result in any significant increase in signal. This indicates that at 40 minutes, the binding between the target protein and the sensor had essentially reached saturation, and the system had completed effective signal transduction. Therefore, 40 minutes was determined to be the optimal incubation time for this sensor in practical applications.

Discussion

We utilized qPCR to optimize the selection of ComDNA for preparing nucleic acid aptamers, the concentration of ComDNA, and the detection time of the aptamer sensor for BD-tau. The results showed that a concentration of 10 μM ComDNA3 achieved the highest signal-to-noise ratio and reached a stable level. Additionally, incubating BD-tau with the aptamer sensor for 40 minutes allowed the detection results to stabilize. These data are crucial for our AD-detecting sensor and can improve the accuracy of the detection results.

Measurement Part 6: Sensitivity Validation of the Aptasensor

Background

The combination of a fluorescence microplate reader and Cas12a represents the integration of a detection system (Detector) with a signal amplification system (Amplifier). Cas12a is responsible for the precise molecular-level recognition of the target and "generates" a readable signal, while the fluorescence microplate reader stably, reliably, and efficiently captures and quantifies these signals at a macroscopic level [10-13]. In the field of Alzheimer's disease (AD) detection, there is currently a lack of efficient, convenient, and widely applicable early diagnostic methods. Existing diagnostics primarily rely on multidisciplinary comprehensive assessments and auxiliary examinations[14-15]. We aim to utilize the combination of Cas12a for the rapid and sensitive detection of the AD biomarker BD-tau, and we have also validated the nucleic acid aptamer-based sensor.

Principle

In this biosensor complex, the performance in responding to the analyte depends on the quality of the aptamer switch, which is determined by its signal-to-noise ratio (SNR). This ration is defined as the signal intensity (amount of released aptamer-dsDNA) in the presence of a high concentration of analyte divided by the background signal intensity (amount of released aptamer-dsDNA) in the absence of the analyte. The SNR of the aptamer switch is influenced by two factors: first the affinity of the aptamer, which is determined during the selection process and does not require further optimization; furthermore, second the suitability of the complementary sequence between the ComDNA and the aptamer. In principle, the ComDNA should bind to the aptamer as tightly as possible in the absence of the analyte.

The Cas12a reporter system consists of four key components: the Cas12a protein, a crRNA molecule, a single-stranded DNA (ssDNA) reporter probe labeled with a fluorophore and a quencher at opposite ends, and a double-stranded DNA (dsDNA)(Gonzalez-Ortiz etal, 2014).In this system, the crRNA forms a complex with the Cas12a protein, guiding it to specifically recognize and cleave the target dsDNA (cis-cleavage). Upon completion of the targeted dsDNA cleavage, the Cas12a protein undergoes a conformational change, activating its trans-cleavage activity, which enables non-specific degradation of any surrounding ssDNA molecules. The nucleotide chain reporter probe, labeled with a fluorophore and a quencher, is cleaved by activated Cas12a, resulting in the separation of the quencher from the fluorophore(figure 14). Upon excitation light irradiation, fluorescence is emitted. The fluorescence intensity can be used to quantify the concentration of BD-tau.

Next, we evaluated the recognition specificity of this module, including T-Tau, bovine serum albumin (BSA), human serum albumin (HSA), IgE, and IgG. The results are shown figure 29.

图片14

Figure 14. Schematic Diagram of the Sensor

Protocols

Materials:

CutSmart Buffer, RNase Inhibitor, 10 µM crRNA, 10 µM Cas12a Protein, 10 µM T-Tau, 10 µM Bovine Serum Albumin (BSA), 10 µM Human Serum Albumin (HSA), 10 µM IgE, 10 µM IgG

Procedure:

1) Prepare the magnetic bead-Com DNA3/aptamer-dsDNA sensor according to the optimized conditions described in the relevant section.

2) Add 10 µM solutions of BD-tau, T-Tau, Bovine Serum Albumin (BSA), Human Serum Albumin (HSA), IgE, and IgG to the prepared sensors. Incubate the mixtures at 4 °C for 10 minutes and 40 minutes.

3) To establish a standard curve, add BD-tau at concentrations of 0 µM, 20 µM, 40 µM, 80 µM, 120 µM, 160 µM, and 200 µM to separate sensor preparations. Incubate at 4 °C for 10 minutes and 40 minutes.

4) Separate the supernatant using a magnetic rack.

5) Aliquot 10 µL of the post-reaction supernatant from the "magnetic bead-Com DNA/aptamer-dsDNA" complex solution.

6) Add 2 µL of each aliquot to the bottom of individual microplate wells.

7) Prepare a master mix in a 200 µL PCR tube containing the following components:10 µL of 10x CutSmart Buffer;1 µL of RNase Inhibitor; 0.5 µL of 10 µM crRNA; 0.5 µL of 10 µM Cas12a Protein; 5 µL of 10 µM ss-DNA Reporter Probe; 73 µL of Nuclease-Free Water

8) Vortex the mixture thoroughly and briefly centrifuge in a microcentrifuge to collect all liquid at the bottom of the tube.

9) Dispense 9 µL of the detection reaction mixture into each prepared microplate well, delivering it along the left and right sidewalls.

10) Centrifuge the microplate using a plate centrifuge to ensure all liquid is collected at the bottom of the wells.

11) Initiate detection using a multifunctional microplate reader with the excitation wavelength set to 520 nm and the emission detection wavelength set to 480 nm.

Result:

Following the optimization of the above conditions—with ComDNA3 selected as the linker, the comDNA complex concentration set at 10 μM, and the incubation time determined as 40 minutes—we proceeded with the detection of BD-tau protein. Based on the designed sensor structure, sensor units were constructed using BD-tau. Gradient concentrations of BD-tau were added to generate a standard curve. The results are shown in the figure 15.As shown in the figure 15, the fluorescence intensity exhibited a clear linear relationship with the target protein concentration.

标准曲线

Figue 15.The Standard Curve of BD-tau

Next, we evaluated the recognition specificity of this module, including BD-tau, bovine serum albumin (BSA), human serum albumin (HSA), IgE, and IgG. The results are shown figure 16.The results showed that this module exhibited a significant response to BD-tau, while no detectable response was observed for common interfering proteins in blood. This finding highlights the excellent specificity of the system, indicating that the sensor can effectively distinguish the target protein from background proteins

特异性

Figure 16. Specificity Testing of BD-tau Protein

Discussion

This result indicates that the release of the aptamer–dsDNA and the subsequent activation of Cas12a trans-cleavage are quantitatively dependent on the amount of protein present in the system. The observed linearity not only demonstrates the sensitivity of the sensing module but also validates its reliability for quantitative detection. Such linear correlation strongly supports that the system can be calibrated using a standard curve, thereby enabling accurate concentration measurements in practical applications. These findings not only confirm the applicability of the sensor but also highlight its potential for further optimization in real biological samples.

This figure 16 compares relative fluorescence signals generated by the system when exposed to BD-Tau and several unrelated proteins (bovine serum albumin, human serum albumin, immunoglobulin E, immunoglobulin G). Only the bar corresponding to BD-Tau shows a strong signal; all other proteins produce minimal responses near baseline. This demonstrates that the aptamer–dsDNA complex specifically recognizes BD-Tau and does not significantly bind or activate Cas12a in the presence of abundant off-target proteins. The low background from serum albumins and immunoglobulins indicates the assay is likely to remain specific even in complex biological samples such as blood or cerebrospinal fluid. The error bars are small, indicating good reproducibility of these specificity measurements. These results validate the selectivity of the BD-Tau detection system and support its potential application as a reliable biomarker assay.

References

[1] Zuo, M. Y. (2014). Selection of nucleic acid aptamers for prealbumin based on SELEX technology and application of magnetic bead aptamer sensors for the detection of bacterial endotoxins [Master’s thesis, University of Science and Technology of China].

[2] Journal of Molecular Recognition. (1999). Surface plasmon resonance sensors for detection of biomolecular interactions. Journal of Molecular Recognition.

[3] Nature Protocols. (2018). SPR-based antibody screening methods. Nature Protocols.

[4] Analytical Biochemistry. (2005). Quantitative analysis of protein-ligand interactions by SPR. Analytical Biochemistry.

[5] [Author(s)]. (2024). Facile construction of sandwich ELISA based on double-nanobody. Talanta.

[6] Sohu. (2023, [Month Day]). ELISA [A review of ELISA technology (Part 3)].

[7] Thermo Fisher Scientific. (n.d.). ELISA and Western Blot: When to use which immunoassay technology.

[8] Heid, C. A., Stevens, J., Livak, K. J., & Williams, P. M. (1996). Real time quantitative PCR. Genome Research, 6(10), 986–994.

[9] Bustin, S. A. (2000). Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. Journal of Molecular Endocrinology, 25(2), 169–193.

[10] Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M., ... Wittwer, C. T. (2009). The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry, 55(4), 611–622.

[11] Zetsche, B., Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., ... Zhang, F. (2015). Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell, 163(3), 759–771.

[12] Chen, J. S., Ma, E., Harrington, L. B., Da Costa, M., Tian, X., Palefsky, J. M., & Doudna, J. A. (2018). CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science, 360(6387), 436–439.

[13] Wang, T., Liu, Y., Sun, H. H., et al. (2021, August). HOLMES: A DNAzyme- and CRISPR-Cas12a-empowered hydrogel biosensor for point-of-care detection of biomolecules. Nature Protocols, 16(8), 4124–4156.

[14] Mistur, R., Mosconi, L., Santi, S. D., Guzman, M., Li, Y., Tsui, W., & de Leon, M. J. (2009). Current challenges for the early detection of Alzheimer’s disease: Brain imaging and CSF studies. Journal of Clinical Neurology, 5(4), 153–166. https://doi.org/10.3988/jcn.2009.5.4.153

[15] Mahavar, A., Patel, A., & Patel, A. (2025). A comprehensive review on deep learning techniques in Alzheimer’s disease diagnosis. Current Topics in Medicinal Chemistry, 25(4), 335–349. https://doi.org/10.2174/0115680266310776240524061252

Attachments 1:
(1) ELISA Random Clinical Trial Generator
#include
#include
#include
#include
#include
#include
int main(strongint argc, const char * argv[]) {
int varimax, varimin, solutionvol=200;
int trialnum;
std::cout << "Insert the number of trials needed:" << std::endl;
std::cin >> trialnum;
std::cout << "Insert the maximum and minimum concentrations for any given trial starting with the smaller parameter:" << std::endl;
std::cin >> varimin >> varimax;
double trials [trialnum+1];
srand(time(0));
for (int i=1;i<=trialnum;++i){
double random = varimin + rand()%(varimax-varimin);
trials [i] = random;
int conplace=0;
int concentrations [trialnum+1];
for (int constor = trials [i]/5;constor>0;constor/=10){
++conplace;
}
concentrations[i] = pow(10,conplace);
double substrate = (trials[i]/5)*2*pow(10,2-conplace);
std::cout << trials [i] << " " << 5 * concentrations [i] << " " << substrate << " "<< solutionvol-substrate << std::endl;
//std::cout << conplace << std::endl;
//std::cout << 5*concentrations [i] << std::endl;
}
return 0;
}

UP