Flavin mononucleotide (FMN)-dependent fluorescent protein Bs2

Bs2 is one of the fluorescent proteins based on flavin mononucleotide (FMN). To learn more about this flavin mononucleotide (FMN)-based fluorescent protein for more information, please view doi: 10.1016 / / j.j biotec. 2019.08.019

In this project, the bs2 gene is a fluorescent protein based on flavin mononucleotide (FMN).

We designed the pET29a-bs2 plasmid (containing J23100 promoter) to enhance the expression of fluorescent protein Bs2 by replacing the T7 promoter with J23100 . By detecting the fluorescence expression intensity of fluorescent protein Bs2, we determined whether promoter J23100 could increase the Bs2 fluorescence .

The recombinant plasmid pET29a-bs2 (including T7 promoter) was used as template, and primers j23100-For-20240719 and j23100-Rev-20240719 were used to linearize vector (5721bp) followed by one-step cloning, Colony PCR (734bp) was performed on the transformed colonies using primers yanzheng23100-For and yanzheng23100-Rev. Positive colonies were cultured and plasmid was extracted. After sequencing verification, the recombinant plasmid pET29a-j23100-bs2 (containing J23100 promoter) was obtained.

Fig.1 pET-29a-bs2(J23100) Plasmid Map

Table 1 Primer sequences

Primers	Sequences
j23100-For-20240719	AGCTCAGTCCTAGGTAcagTGCTAGCGGAATTGTGAGCGGATAACAATTC
j23110-Rev-20240719	GCTAGCActgTACCTAGGACTGAGCTAGCcGTCAAATTTCGCGGGATCGAGATC
yanzheng23100-For	ATCTTCCCCATCGGTGATGT
yanzheng23100-Rev	CAGCCAACTCAGCTTCCTTT

The recombinant plasmid pET29a-j23100-bs2 was transformed into E.coli BL21 (notated as J23100). The cells were cultured in LB medium till OD₆₀₀ reached 0.8,1.0 and 1.2, respectively, and the fluorescence intensity was detected. E.coli BL21 harboring the empty vector pET29a as a negative control .(notated as BL21)

Fig.2 RFU of E.coli BL21 transformed with recombinant plasmid pET29-bs2 compared with E.coli BL21 carrying the empty vector pET29a (RFU: Relative fluorescence unit)

These results showed that with the blank control (261.97,287.54,304.34),J23100 achieved efficient expression of protein Bs2 with high RFU of 332.53,596.60 and 669.68 under OD₆₀₀=0.8 OD₆₀₀=1 and OD₆₀₀=1.2, respectively.

Data on Bs2 in current part libraries are limited.. In order to apply this reporter to practical use, we made contributions to supplement its characteristics, including excitation and emission wavelengths, unit fluorescence intensity in facultative anaerobes.

In this study, we used the pET29a plasmid (containing the J23100 promoter)(Fig.3) to express the Bs2 protein. In order to expand its application in facultative anaerobic bacteria, we used facultative anaerobic E.coli strain BL21 as expression vector to express Bs2 protein.(Fig.4) After 48 hours of cultivation, the excitation wavelength was about 400 nm and the emission wavelength was about 525 nm (Fig.5).

Fig.3 Construction maps of plasmids of pET29a-bs2 (containing the J23100 promoter)

Fig.4 Picture of solid medium UV

E.coli BL21/pET29a-bs2 (containing the J23100 promoter) on LB solid medium with Kanamycin (50 μg/mL) and IPTG (0.2 mM), incubated at 37℃ for 24h. Image was acquired under UV and by fluorescence microscopy during the exponential growth phase when OD₆₀₀≈0.8.

Fig.5 Excitation maximum and emission peak (RFU: Relative fluorescence unit). The Ex Wavelength in nm (Em: 520) indicates that there is one peak values of excite wavelength and it is 400 nm. The Em Wavelength in nm (Ex: 400 nm) shows excluding the impact of three peaks value of excite wavelength, the emission wavelength is around 525 nm.

According to the measured excitation/emission wavelength, we measured the change of unit fluorescence intensity of E.coli BL21 harboring pET29a-bs2 plasmid (containing J23100 promoter) by controlling the culture temperature and time. After entering the logarithmic growth phase (OD₆₀₀≈0.5), IPTG was added to E.coli harboring pET29a-bs2 plasmid (including J23100 promoter) to induce Bs2 gene expression. OD₆₀₀ and fluorescence intensity were measured every 1h, and OD₆₀₀ and fluorescence intensity were measured every 2h after entering the stationary phase.The unit fluorescence intensity of Bs2 in E.coli BL21 was determined (Fig 4).

(Fig.6). RFU and RFU/OD₆₀₀ under the growth curve of E.coli harboring pET29a-bs2 plasmid (including J23100 promoter) at different temperatures. (A) 20℃; (B) 30℃. (C) 37℃. (A)-(B) indicates that OD₆₀₀ has the minimal fluctuation at 37℃, however at 30℃ MFI maintained the highest than the other two.