Table 1 LB Culture Medium Formula

Component	Concentration
Trypsin	10 g/L
Sodium chloride	10 g/L
Yeast	5 g/L

Anion Antioxidant Peptide and PelB were cloned separately from plasmids stored in the laboratory. CecB was cloned from the synthesized pET-28a(+)-cecB plasmid.

Table 2 Primers Used in Experiments

Primers	Sequence
CecB-R	CCTTTCGGGCTTTGTTAGCAG
CecB-F	GACCCGAACGGTatgAAGT
Yin-F	GAATTCGAGatgGATGCTCAAGAAAAACTAGAGATAGAAGC
ZT-F	CTGCTAACAAAGCCCGAAAGG
ZT-C-R	ACTTcatACCGTTCGGGTCGAGCTCGAATTCGGATCCG
ZT-Y-R	CTAGTTTTTCTTGAGCATCGAGCTCGAATTCGGATCCG

Table 3 Reaction System

Component	Volume
2 × Phanta SE Buffer	25 µL
Upstream primer (10 μM)	2 µL
Downstream primer (10 μM)	2 µL
Phanta SE Super-Fidelity DNA Polymerase	1 µL
Template DNA	x µL
ddH2O	Up to 50 µL

Table 4 Standard Reaction Procedure

Loop steps	Temperature	Time	Number of loops
Pre-denaturation	98℃	30 sec
Denaturation	98℃	10 sec	28-35 cycles
Annealing	55℃	5 sec
Extend	72℃	5 - 10 sec/kb
Completely extended	72℃	1 min

1. Add appropriate fragments and carriers, add ddH₂O to prepare the system to 5 µL, add 2 × CE Mix 5 µL. The process uses the Novagen ClonExpress Ultra One Step Cloning Kit V2 kit.
2. Heat Shock Transformation:
   • Take competent cells BL21 (DE3) out of the -80℃ freezer and place them on ice.
   • After competent cells thaw (about 5 min), add 10 µL plasmid to each 100 µL competent cells and incubate on ice for 30 min.
   • Heat shock at 42℃ for 90 seconds, then immediately take them out and place back on ice for 2-3 min.
   • In the heat-stimulated competent cells add 1 mL of antibiotic-free LB liquid medium and incubate on a 37℃ shaker for 1 hour.
   • Take 1 mL and mix the remaining 100 µL bacterial solution uniformly and spread it on LB solid medium containing the corresponding antibiotics.
   • Invert the LB solid medium and incubate in a constant temperature incubator at 37℃ overnight.

Mix 10× DNA loading buffer with PCR amplification products at a 1:10 ratio, gently mix and perform 1% agarose gel electrophoresis using 1× TAE buffer. Run at approximately 30 min under 105 V. Observe the bands under a UV lamp to see if they match the size of the target fragment. Recover the target fragment based on gel operation. The DNA purification kit uses FastPureR Gel DNA Extraction Mini Kit (Nanjing Vazyme Enzyme Biotechnology Co., Ltd.), specific experimental steps are detailed in [Protocol]. Store the purified product in a -20℃ refrigerator for later use.

Table 5 Primers Used in the Experiment

Primer	Sequence
CecB-E10K-F	TAAAAAGATAaagAAAATGGGTCGTAATATTCGCAAC
CecB-E10K-R	GACCCATTTTcttTATCTTTTTAAATACTTTCCACTTcatACCG
CecB-N15K-F	ATGGGTCGTAAgATTCGCAACGGCAT
CecB-N15K-R	GTTGCGAATcTTACGACCCATTTTTTCTATCTTT
CecB-P25A-F	GAAGGCGGGTgctGCAATCGCCGTTTT
CecB-P25A-R	GGCGATTGCagcACCCGCCTTCACGATG
CecB-V29W-F	GCAATCGCCtggTTGGGCGAGGCGAAAG
CecB-V29W-R	TCGCCCAAccaGGCGATTGCCGGACC

Table 6 Experimental Reaction System

Component	Volume
2 × Phanta SE Buffer	25 µL
Upstream primer (10 μM)	2 µL
Downstream primer (10 μM)	2 µL
Phanta SE Super-Fidelity DNA Polymerase	1 µL
Template DNA	x µL
ddH2O	Up to 50 µL

Table 7 Specific Reaction Procedures

Loop steps	Temperature	Time	Number of loops
Pre-denaturation	98℃	30 sec
Denaturation	98℃	10 sec	28-35 cycles
Annealing	55℃	5 sec
Extend	72℃	5 - 10 sec/kb
Completely extended	72℃	1 min

PCR reaction is complete, add 1 μL Dpn I and 5 μL 10×EC Buffer for demethylation heat at 37°C for 40 min, then heat at 80°C for 20 min. After digestion, take 5 μL for AGE(agarose gel electrophoresis).

Signal peptide PelB and anionic antioxidant peptide colony PCR verification primers and systems are as follows, T7 and T7t are used to verify the presence of signal peptide part and the target gene of anionic antioxidant peptide on the plasmid.

Table 8 Primers Used in the Experiment

Primers	Sequence
T7	TAATACGACTCACTATAGGG
T7t	GCTAGTTATTGCTCAGCGG

Table 9 Colony PCR Reaction System

Composition	Volume
2×Rapid Taq Master Mix	5 µL
Upstream Primer (10 µM)	0.4 µL
Downstream Primer (10 µM)	0.4 µL
Colony	Not counted
ddH2O	Up to 10 µL

1. Prepare the PCR reaction mixture according to the above system.
2. From multiple single colonies selected from the culture dishes after transformation, immerse them separately into the reaction systems of sterile eight-tube racks.
3. After the reaction is complete and verified through AGE(agarose gel electrophoresis). If fragments of the corresponding size are present, picking the single colony for culturing, then transfer it to liquid medium. Store the strains in a 1:1 glycerol and bacterial solution, and the rest can be sent for sequencing.

1. After successful sequencing, place the reserved strains in a liquid culture medium containing 5 mL LB (50 µg/mL Kan) in a shaking tube, and incubate for about 5 hours.
2. Take 1-2 mL of bacterial liquid from the shaking tube, and transfer it to a flask containing 50 mL LB (50 µg/mL Kan).
3. Shake at 37℃, 200 rpm until OD₆₀₀=0.6
4. Add IPTG with a final concentration of 0.5 mM to the flask on a clean bench.
5. 18℃, Incubate at 200 rpm for 20 h.

1. Cell collection: After induction, centrifuging the culture at 8000 rpm for 5 min, discard the supernatant. Add 10 mL of PBS with pH 7.0 to the centrifuge tube, suspend the cells to wash away the medium, and centrifuge again at 8000 rpm for 5 min, discard the supernatant. Repeat this step 3 times, then add 10 mL of PBS with pH 7.0 to resuspend the cells.
2. Place the centrifuge tube in an ultrasonicator with a power of approximately 250 W, ultrasonicate for 3 s followed by a 5 s interval, for a total of 10 min. Utilize the high-frequency vibration of the ultrasound to break down the cell walls until the bacterial liquid becomes clear.
3. After ultrasonication, centrifuge at 4°C, 12000 rpm for 30 min to separate the supernatant and precipitate.

1. Prepare the nickel column (stored in 20% alcohol), wait for the alcohol to evaporate, and sequentially add 5 mL Buffer A (20 mM imidazole), 3 mL Buffer B (250 mM imidazole), 5 mL Buffer A to wash the column.
2. Add the crude enzyme solution and repeat the adsorption 3 times, wash with 5 mL Buffer A to remove impurity proteins. Then add 5 mL Buffer B and pour into the pre-marked beaker to obtain the target protein.
3. Separately add 5 mL Buffer B, 5 mL Buffer A, 5 mL H₂O clean the nickel column, and seal the column with 20% alcohol.
4. Pour the crude enzyme solution from the beaker into the ultrafiltration tube (sealed with 20% alcohol), and centrifuge at 4℃, 6500 rpm for 30 min. If the final concentrated volume of the pure enzyme solution exceeds 500~700 µL, centrifuge for an additional 5~15 min to increase protein concentration.
5. After completion, aspirate the upper layer and rinse the ultrafiltration tube with up water.
6. Fill the ultrafiltration tube with 0.1 mM NaOH, and soak at 4℃ for 1 h. Then centrifuge at 6500 rpm for 15 min.
7. The pure enzyme solution after concentration is stored in a -20℃ freezer, and the ultrafiltration tubes are preserved with 20% alcohol.

According to the SDS-PAGE electrophoresis method in the [protocol], samples are prepared based on protein concentration, and SDS-PAGE electrophoresis is performed on the supernatant, precipitate, and purified enzyme solution to observe whether bands corresponding to the target protein are present.

Under the condition of a volume ratio of 2:1, the lysis solution was added to all purified liquids. The lysis solution included: 1.86 M hydroxylamine hydrochloride solution and 100 mM Tris-HCl, pH=9.0. After the reaction system was prepared, it was placed at 45℃ for 4 hours of reaction. After the reaction was completed, 1 M HCl solution was added to adjust the pH to 7.0 to terminate the reaction. After the reaction was terminated for a period of time, all reaction solutions were added to the ultrafiltration tube to obtain the upper liquid for subsequent experiments.

Signal Peptide Section

Signal peptide PelB comes from pET-28a(+)-pelB-yin-cecB. LYY-7, LYY-4, LYY-2 come from plasmids synthesized by the company (General Biol).

Table 10 Primers Used in the Experiment

Primers	Sequence
ZT-R	CGCCATTGCCGGCT
NJT-LYY-7-F	CTGCGCAGCCGGCAATGGCGTGGACACCCGCTCTATC
NJT-LYY-7-R	GCTTCTTTCGCAGCTGCCTCGCACGCACGGGTG
ZT-F	GAGGCAGCTGCGAAAG
NJT-LYY-4-F	CTGCGCAGCCGGCAATGGCGAACGATGTAAATCCAGAAACTACAC
NJT-LYY-4-R	GCTTCTTTCGCAGCTGCCTCACAACGAGAGGTGCACTTG
NJT-LYY-2-F	CTGCGCAGCCGGCAATGGCGTGTACTACAAATACGTTTAGTCTATCAGATTACTG
NJT-LYY-2-R	GCTTCTTTCGCAGCTGCCTCGCACCACGCCATGCAC

Table 11 Experimental Reaction System

Component	Volume
2 × Phanta SE Buffer	25 µL
Upstream primer (10 μM)	2 µL
Downstream primer (10 μM)	2 µL
Phanta SE Super-Fidelity DNA Polymerase	1 µL
Template DNA	x µL
ddH2O	Up to 50 µL

Table 12 Specific Reaction Procedures

Loop steps	Temperature	Time	Number of loops
Pre-denaturation	98℃	30 sec
Denaturation	98℃	10 sec	28-35 cycles
Annealing	55℃	5 sec
Extend	72℃	5 - 10 sec/kb
Completely extended	72℃	1 min

PCR reaction is complete, add appropriate fragments and vector, add ddH₂O to prepare the system to 5 µL, add 2 × CE Mix 5 µL. The process uses the Novozyme ClonExpress Ultra One Step Cloning Kit V2 kit for recombination transformation.

Colony PCR and Sequencing

PelB-NJT-LYY primers and systems for verification are as follows, T7 and T7t are used to verify the presence of signal peptide part and the target gene of anionic antioxidant peptide on the plasmid.

Table 13 Primer Used in the Experiment

Primers	Sequence
T7	TAATACGACTCACTATAGGG
T7t	GCTAGTTATTGCTCAGCGG

Table 14 Culture PCR Reaction System

Composition	Volume
2×Rapid Taq Master Mix	5 µL
Upstream Primer (10 µM)	0.4 µL
Downstream Primer (10 µM)	0.4 µL
Colony	Not counted
ddH2O	Up to 10 µL

1. Prepare the PCR reaction mixture according to the above system.
2. From the culture plates incubated overnight after transformation, select multiple single colonies and immerse them separately in reaction systems with sterile tips.
3. After the reaction is complete and verified via AGE(agarose gel electrophoresis), if fragments of the corresponding size are observed, streak the colony plates for further culturing, then transfer them to liquid medium. Preserve the strains with 50% glycerol at a 1:1 ratio, and the remaining ones can be sent for sequencing.

The predicted combinations were constructed to obtain PelB-NJT-LYY-742.

Table 15 Primers Used in the Experiment

Primer	Sequence
NJT-LYY-7-R	GCTTCTTTCGCAGCTGCCTCGCACGCACGGGTG
ZT-F	GAGGCAGCTGCGAAAG
7&4-F	GCACCCGTGCGTGCGAGCTCAACGATGTAAATCCAGAAACTACAC
NJT-LYY-4-R	GCTTCTTTCGCAGCTGCCTCACAACGAGAGGTGCACTTG
4&2-F	GCACCTCTCGTTGTGTCGACTGTACTACAAATACGTTTAGTCTATCAGATTACTG
NJT-LYY-2-R	GCTTCTTTCGCAGCTGCCTCGCACCACGCCATGCAC

Table 16 Experimental Reaction System

Component	Volume
2 × Phanta SE Buffer	25 µL
Upstream primer (10 μM)	2 µL
Downstream primer (10 μM)	2 µL
Phanta SE Super-Fidelity DNA Polymerase	1 µL
Template DNA	x µL
ddH2O	Up to 50 µL

Table 17 Specific Reaction Procedure

Loop steps	Temperature	Time	Number of loops
Pre-denaturation	98℃	30 sec
Denaturation	98℃	10 sec	28-35 cycles
Annealing	55℃	5 sec
Extend	72℃	15 sec/kb
Completely extended	72℃	1 min

PCR reaction is complete after, add appropriate fragments and vectors, add ddH₂O to prepare the system to 5 µL, add 2 × CE Mix 5 µL. Process uses Novagen ClonExpress Ultra One Step Cloning Kit V2 kit for recombination heat shock transformation and sends to the company for sequencing.

1. Mix the molecular chaperone plasmid with pET-28a(+)-cecB plasmid in equal amounts.
2. Heat shock transformation:
   • Take the competent cells BL21 (DE3) out of the -80℃ freezer and place them on ice.
   • Competent cells after thawing (about 10 min), add 10 µL of the mixed plasmid to each 100 µL of competent cells and chill on ice for 30 min.
   • Heat shock at 42℃ for 90 seconds, immediately transfer back to ice and incubate for 2-3 min.
   • Add 700 µL of antibiotic-free LB liquid medium to the heat-shocked competent cells and incubate on a shaker at 37℃ for 1 hour.
   • Take 100 µL of the bacterial solution and spread it on LB solid medium containing the corresponding antibiotic.
   • Invert the solid medium and incubate overnight at 37℃ in a constant temperature incubator.
3. After heat shock transformation, use LB plates containing dual resistance (Cm, Kan) for initial screening. Invert the plates and incubate at 37℃ for 12 h to verify colony selection.