Plant epidermal wax is a layer of hydrophobic lipid compounds covering the surface of all aerial organs of plants (such as leaves, fruits, stems), primarily composed of ultra-long chain fatty acids and their derivatives (such as aldehydes, alkanes, ketones, primary and secondary alcohols, esters, etc.) [1].It is akin to a "smart coat" for plants. This "coat" is a crucial substance formed by plants during their long-term evolution to cope with terrestrial environments. It plays a significant role in preventing non-stomatal water loss (anti-transpiration), resisting pathogen invasion, and preventing mechanical damage. Nowadays, it is commonly used in the agricultural sector. By selecting waxy-layered crop varieties, the resistance of crops to stress can be enhanced, and the freshness of plants can be prolonged through artificial waxing [2].In the industrial field, epidermal wax can also serve as a raw material for the production of paints, polishing machines, cosmetics, and other products [3].In addition to its widespread application in agriculture and industry, epidermal wax has shown potential research prospects in the medical and pharmaceutical fields. This is a highly cutting-edge and actively researched area with immense potential. For instance, plant waxes, such as carnauba wax and beeswax, are excellent hydrophobic pharmaceutical excipients that can be used for drug coating and slow/controlled release formulations. Furthermore, the hydrophobic and film-forming properties of waxes make them suitable for developing novel wound dressings [4].

The ultimate goal of this project is to explore the most effective method for maximizing wax synthesis by modifying the wax synthesis pathway in Nicotiana benthamiana plants. It aims to provide insights for enhancing plant stress resistance and create low-cost, short-cycle, high-wax plant materials, offering abundant raw materials for agricultural and industrial production. Initially, we constructed the pKSE402-CER1 recombinant plasmid vector and utilized CRISPR-Cas9 technology to verify that the key regulatory gene for wax synthesis in plants is CER1. Subsequently, by constructing the pGreenII 62-SK-HY5 and pGreenII 0800-LUC-CER1 recombinant plasmid vectors, we discovered that the wax synthesis regulatory network in plants is mediated by HY5-CER1, providing a breakthrough point for our modification. Afterwards, we modified the HY-CER1-wax synthesis pathway by altering light intensity to promote wax synthesis, and further investigated the optimal light intensity for maximizing wax synthesis.

Based on the powerful function of tobacco genome and the mature genetic transformation technology, we chose the model plant Nicotiana benthamiana for research in order to identify the key regulatory genes involved in wax synthesis in plants. Through extensive reading and consulting of literature, we first identified the CER1 gene as our candidate gene. However, to verify its function, we needed to utilize some molecular biology experimental methods. We edited the CER1 gene using the gene knockout vector pKSE402, confirming that CER1 can control the synthesis of waxy substances and plays a positive regulatory role in this process.After clarifying the function of CER1, we need to identify suitable sites for modification. We further verified through interaction experiments that HY5 can bind to the promoter region of CER1, affecting the expression of CER1 and subsequently influencing the synthesis of waxy substances.

Schematic diagram of the HY5-CER1-mediated wax synthesis pathway regulated by light in plants

Most studies have shown that HY5 is directly linked to light exposure, and the intensity of light directly affects the expression of HY5, which in turn influences plant traits. As illustrated in the figure, we have designed a wax high-yield production system driven by light intensity. By increasing light intensity, we promote the expression of HY5, enhance the binding ability of HY5 and downstream target gene CER1, and artificially modify the HY5-CER1 module through physical means to increase the wax content in tobacco plants. To evaluate the effectiveness of our project, we also used gas chromatography-mass spectrometry (GC-MS) to detect the specific wax content in tobacco plants under different light treatment conditions, finding the optimal light intensity of 40×104 Lx/m2, with wax production reaching 400 ug/dm2, and the synthesis amount increased by more than three times compared to natural conditions.

To explore the function of CER1, we designed target sites on the website (http://crispr.hzau.edu.cn/CRISPR2/). To enhance editing efficiency, we selected two target site, we select the two terminal sequences serve as targeting sites the GTAGCAGCATTGCTGCACGC and the TTGTTGGTGACAGTGCTAAC, amplify the target sequence through the method of four-primer amplification（Picture 1A）. Establishing an enzyme digestion and ligation system, perform double enzyme digestion using BsaI endonuclease, remove the SpR structure from the pKSE402 vector, and insert the target sequence we cloned, Construct the recombinant plasmid vector pKSE402-CER1（Picture 1B），transforming into Escherichia coli DH5α, and after a single colony grows, identify the positive clone through colony PCR（Picture 1C）. The striped sample was sent to QinKe Biotechnology Co., Ltd. for sequencing. The sequencing results aligned correctly with our target sequence, indicating that we successfully constructed the pKSE402-CER1 recombinant plasmid vector.

To further explore the regulatory network of wax synthesis in plants, we have artificially applied external control measures to identify suitable entry points. We will utilize interaction experimental methods to verify the potential HY5-CER1 regulatory pathway within plants. Firstly, we cloned the coding sequence of HY5 and the promoter sequence of CER1. Specific primers for cloning the HY5 coding region were designed at both ends, and PstI and HindIII restriction enzyme sites were added. HindIII and PstI restriction enzyme sites were added at both ends of the primers for cloning the CER1 promoter sequence. The PCR product was obtained through amplification (Picture 2A),pGreenII 62-SK and pGreenII 0800-LUC were digested with HindIII and PstI endonucleases, respectively, and then ligated using T4 DNA ligase for recombination. Afterwards, they were transformed into E. coli DH5α（Picture 2B），after PCR, the bacterial colonies were sent for sequencing, and the sequencing results were aligned and analyzed. It indicates that we have successfully constructed pGreenII 62-SK-HY5 and pGreenII 0800-LUC-CER1 recombinant plasmid vector（Picture 2C and Picture 2D）.

After confirming the presence of the HY5-CER1-mediated wax synthesis pathway in plants, we decided to approach from the perspective of light exposure, given that HY5 is a well-known star gene responsive to light. By controlling the light intensity, we aimed to alter the binding of HY5 and CER1 in plants, thereby regulating wax synthesis.After transplanting the Nicotiana benthamiana, we primarily utilize a plant light-controlled incubator to treat the tobacco plants with varying light intensities, exploring their impact on wax synthesis and seeking the optimal light intensity for maximum wax production.

We transformed the constructed pKSE402-CER1 recombinant plasmid vector into agrobacterium cells, prepared an agrobacterium suspension, and after planting the tobacco for two weeks, took tobacco leaves as explants for genetic transformation on a clean bench. Using the agrobacterium suspension of pKSE402-CER1 that we have prepared for infection and vacuumize. Subsequently, the infected explants were placed in a co-culture medium, after reacting with agrobacterium and tobacco leaf explants for three days, the explants were transferred to a differentiation medium, and after one month, they were transferred to a rooting medium. Positive plants were identified through fluorescence observation（ Picture 4A），Taking tobacco plant leaves and taking them into the company for sequencing. Analyzing the sequencing results to determine whether the CER1 gene has been edited. The results show that there is a 4-base pair (bp) deletion at the first target site, there is a 2bp base deletion at the second target site（Picture 4B）, it causes the premature termination of the transcription process，it indicates the loss of CER1 function. Furthermore, we utilized gas chromatography-mass spectrometry (GC-MS) for analysis. The wax content of wild-type and CER1 functionally deficient mutants was detected. It was found that the wax content significantly decreased after the loss of CER1 function compared to the wild-type（Picture 4C）. It indicates that CER1 can control the synthesis of waxy substances.

To identify entry points for regulating wax synthesis, we utilized the constructed recombinant plasmid vectors pGreenII 62-SK-HY5 and pGreenII 0800-LUC-CER1, employing a dual-luciferase reporter gene system to verify the relationship between the light-responsive factors HY5 and CER1 (Picture 5A). Preparing agrobacterium GV3101 carrying pGreenII 62sk-HY5 and pGreenII 0800-luc-CER1 plasmids into suspensions, respectively, for infecting tobacco leaves. The experiment set up two treatment groups: one group received a mixed bacterial solution of pGreenII 62sk-HY5 and pGreenII 0800-luc-CER1, while the other group received a mixed bacterial solution of pGreenII 62sk-HY5 and an empty vector pGreenII 0800-luc as a control. Inject two sets of bacterial solutions onto the two sides of the same tobacco leaf, and after dark cultivation, observe and detect the luciferase activity（Picture 5B and 5C）. The luciferase complementation imaging results showed that the treatment group combining pGreenII 62sk-HY5 and pGreenII 0800-luc-CER1 exhibited a strong fluorescence signal; further quantitative analysis using a microplate reader indicated that the luciferase activity in this group was significantly higher than that in the control group. The above results indicate that the light-responsive factor HY5 can bind to the CER1 promoter region and promote the expression of CER1, suggesting the existence of a wax synthesis pathway mediated by HY5-CER1 in plants.

We took light intensity as the starting point. Since light has a positive regulatory effect on the HY5-CER1-mediated wax synthesis pathway, we continuously increased the light intensity and detected changes in wax content. By controlling the light intensity, we achieved high-yield wax synthesis. We set up different light intensity gradients and used GC-MS to detect the wax content and the content of each component in tobacco leaves. The results showed (Picture 6). As the light intensity increases, the total wax content and the total content of each component in plants continue to rise, gradually leveling off, with C29 paraffins being the most abundant.Further analysis also revealed that when the light intensity reached 40×104 Lx/m2 and was further increased, the wax content in plants no longer increased, indicating that the wax synthesis in plants had reached a certain threshold. However, excessive light may also have adverse effects on plant growth. Therefore, if only increasing the light intensity to increase the wax content in plants, a light intensity of 40×104 Lx/m2 is the most appropriate.

It is not difficult to observe from our results that when we increase the light intensity to 40×104 Lx/m2, the wax content in the plant no longer increases with the increase in light intensity, indicating that wax synthesis reaches a certain threshold. However, in our production applications, the wax content increased through this method is far from meeting our needs. For some crops that are highly susceptible to adverse environments and pathogens, the improvement in stress resistance is still not significant. As raw materials for industrial production, the wax content remains insufficient. Therefore, we plan to further modify and optimize the HY5-CER1-mediated wax synthesis pathway in the future.

We plan to start with the HY5 protein and modify its protein structure, allowing it to partially or completely escape the constraints of upstream signals and obtain stronger transcriptional activation ability. Therefore, in the future, by point mutation or domain fusion, we aim to modify the HY5 protein to make it more sensitive to light or have stronger binding ability with the CER1 promoter, which is expected to further increase the content of wax synthesis in plants.

Of course, we can also utilize strong promoters (such as 35S or plant epidermal-specific promoters) to simultaneously overexpress HY5 and CER1, providing both ample "activation signals" (HY5) and sufficient "factories" (CER1), allowing the two to synergize at high levels and potentially produce a synergistic effect.

[1] Zhu, L., Guo, J., Zhu, J., & Zhou, C. (2014). Enhanced expression of EsWAX1 improves drought tolerance with increased accumulation of cuticular wax and ascorbic acid in transgenic Arabidopsis. Plant physiology and biochemistry : PPB, 75, 24–35.

[2] Zhu, J., Huang, K., Cheng, D., Zhang, C., Li, R., Liu, F., Wen, H., Tao, L., Zhang, Y., Li, C., Liu, S., & Wei, C. (2022). Characterization of Cuticular Wax in Tea Plant and Its Modification in Response to Low Temperature. Journal of agricultural and food chemistry, 70(43), 13849–13861.

[3] Zhang, Z., Ye, J., Fei, T., Ma, X., Xie, X., Huang, H., & Wang, Y. (2019). Interesterification of rice bran wax and palm olein catalyzed by lipase: Crystallization behaviours and characterization. Food chemistry, 286, 29–37.

[4] Zou, M., Wang, Y., Xu, C., Cheng, G., Ren, J., & Wu, G. (2009). Wax-matrix tablet for time-dependent colon-specific delivery system of sophora flavescens Aiton: preparation and in vivo evaluation. Drug development and industrial pharmacy, 35(2), 224–233.