We come from all over the country and come together to form the Rains-ECO team. Due to our dispersed locations, online meetings at least once a week are our daily routine, and we hold weekly meetings. Everyone counts their time and brainstorm and discuss projects online together. During this process, all of our team members worked together to advance the tasks of the dry and wet teams. Despite facing various challenges during the experiment, with everyone's concerted efforts and love for scientific research, we ultimately achieved a successful conclusion.

Topic: Familiarize yourself with the laboratory environment, prepare reagents and consumables in advance before the experiment, and learn how to configure LB culture medium.

Recorder：DING YUNQING/LIU LUJIA

Process：Accurately weigh pancreatic peptone, yeast extract, and sodium chloride in proportion and place them in a conical flask with distilled water. For the preparation of solid LB medium, agar needs to be added to the liquid base, while liquid medium does not. Dissolve the ingredients, seal, sterilize with high-pressure steam (121 ℃, 103kPa (1atm) for 20 minutes), remove after sterilization, and store for later use after cooling.

In the ultra clean workbench, add antibiotics such as ampicillin, pour the culture medium into a sterile culture dish, cover the dish lid, and avoid the formation of bubbles. Let it stand for 30 minutes, wait for the agar to completely solidify, seal and invert the plate to prevent condensation from contaminating the colony. Store in a refrigerator at 4 ℃.

Laboratory Safety Guidelines

Topic：Sequence acquisition and structural analysis of NbCER1 and NbHY5 genes

Recorder：DING YUNQING

Process：Login to Arabidopsis official website address（ https://www.arabidopsis.org/ ）When selecting the gene option, search for CER1, click on the annotation of the gene ID corresponding to CER1, AT1G02205 (CER1), select Protein from the Sequence, and copy the protein sequence. Log in to the tobacco database（ https://solgenomics.net/organism/Nicotiana_benthamiana/genome ）Click on the Blast option, select blastp (protein to protein), and choose N. benthamiana Genome V1.0.1 predicted proteins for Database. Enter the protein sequence of Arabidopsis CER1 for alignment.

Result: Based on the comparison results, select the gene with the highest Score value, an evaluation value of 0, and features of the Wax2 domain. The gene ID is Niben101Scf17024g00002.1. Click on the ID, select View in genome context, right-click and select View details to obtain the gene DNA sequence and CDS sequence. The same method is used to obtain the HY5 gene. The Arabidopsis HY5 gene ID is AT5G11260 (HY5). After Blast alignment, the gene ID for HY5 in Nicotiana benthamiana is Niben101Scf15744g00003.1.

Topic：Extraction of DNA from Nicotiana benthamiana

Recorder：SONG YIMING

Process：

Carefully transfer the upper aqueous phase into a new centrifuge tube (provided), add 700 μ l of solution B, and mix thoroughly.

Topic：Experimental cultivation of Nicotiana benthamiana and extraction and quality testing of tobacco leaf RNA

Recorder：HU RUOYU

Process：Experimental plant cultivation of Nicotiana benthamiana. As a commonly used model organism in botanical research, Nicotiana benthamiana has the characteristics of short growth cycle, high genetic transformation efficiency, and easy cultivation, providing material basis for gene function verification, protein expression, etc.

Extraction of RNA

Determination of RNA concentration

Take 2 μ l of the extracted solution with a pipette, open the Nanodrop software, use the elution buffer as a blank control, and measure the RNA concentration and relative absorbance of A260/A280 on RNA Nanodrop 2000 Spectropppmeter. The pure RNA A260/A280 should be between 1.8-2.2.

Topic: Detection of RNA integrity by agarose gel electrophoresis

Recorder：HU RUOYU

Process：

Result：The main components in the total RNA sample are 28s rRNA, 18s rRNA, and 5s rRNA. After electrophoresis, there were three distinct bands on the gel. And the brightness of the 28srRNA band is twice that of the 18srRNA band, indicating that the results are relatively complete.

Topic：Synthesis of cDNA

Recorder：WANG CHUNQI

Process：

Reagent kit used: In this experiment, the AMV first strand cDNA synthesis kit [Biotech (Shanghai) Co., Ltd.], product number B532445, was used. Add 2 μ g of total RNA, 1 μ l of Oligo dT, and RNase free ddH2O to the RNase free PCR tube in an ice bath to a volume of 12 μ l. Gently mix and centrifuge for 3-5 seconds. The reaction mixture is then immersed in a 65 ℃ water bath for 5 minutes, followed by an ice bath for 30 seconds, and then centrifuged for 3-5 seconds. Add the components to a clean RNase free PCR tube and perform reverse transcription reaction on a PCR instrument under the following conditions: 42 ℃, 30-60 minutes; Terminate the reaction at 85 ℃ for 5 minutes (enzyme inactivation). After treatment, cDNA is obtained and stored in a refrigerator at 4 ℃ for future use.

Topic：Cloning Primer Design

Recorder：WANG CHUNQI

Process：Open Snapgene software, select the file, enter the new DNA or RNA software, and enter the CDS sequences of NbCER1 and NbHY5 respectively. According to the principle of primer design, the primer length is 15-35 bp. It is advisable to avoid a string arrangement of more than 5 purine or pyrimidine nucleotide sequences with a G+C content of 40% -60% to avoid complementarity between primers and prevent the formation of primer dimers. Select a sequence from ATG, click on 'Add Primer', choose the top or bottom chain, and you will see the values of annealing temperature, binding sites, and GC content. Ensure that the Tm value difference between upstream and downstream primers is less than 5 ℃. Send the primer name and the sequence from the 5 'end to the 3' end of the primer to the biotech company for primer synthesis.

Topic：PCR amplification of CDS sequences of NbCER1 and NbHY5 genes

Recorder：WANG CHUNQI

Process：

Firstly, prepare the cDNA template, primers ddH2O、 And M5 Taq enzyme. Establish a reaction system in a sterile and clean PCR tube as required. The annealing time can be adjusted by the transcription rate of the enzyme used and the maximum length of the fragment to be replicated.

Topic：Agarose gel electrophoresis

Recorder：TONG YANBO

Process：

TAE buffer preparation: Dilute 50 x TAE solution to 1 x TAE solution according to the ratio. Prepare agarose gel mixture: according to the size of DNA/RNA fragments to be separated, prepare agarose solution of appropriate concentration with electrophoresis buffer. The concentration of agarose gel prepared in this experiment is 1.5% (suitable for separating 0.2-3Kb linear DNA fragments). Weigh 0.9 g of agarose and mix it with 60 ml of 1 × TAE solution in a triangular flask. Dissolve agarose: Gently cover the neck of the triangular flask with KimWipes wiping paper and heat it in the microwave to melt. If not completely dissolved, it is necessary to wear insulated gloves and carefully rotate the triangular flask to ensure that the unmelted agarose particles stuck to the wall enter the solution, and repeat heating until completely melted. Transfer the triangular flask to a 55 ℃ water bath using insulated gloves. Add 6 μ l GelRed nucleic acid dye after the melted gel cools slightly. Gently rotate to fully mix the gel solution. Pour into the gel mold: pour the warm liquid gel into the gel mold, drive away the bubbles, insert the comb, wait for about 20 minutes until the gel is completely dry, gently pull out the comb, and then take out the gel from the mold (glue making plate, select large or small hole comb as required). Prepare electrophoresis tank: pour TAE solution into electrophoresis tank and put it into gel. Continue to add electrophoretic buffer, which is about 1mm above the gel. Sample loading: add PCR product and Marker into the hole of gel. The amount added can be determined according to the size of gel.(The extracted RNA needs to be added to a 6 × loading buffer with a volume of 0.2 times.) Glue running: Close the electrophoresis tank cover and connect the electrode plug. DNA swims sideways towards the sun level (red plug). The sample well should be located at the negative electrode. When the power is turned on, dense small bubbles can be seen emerging from the electrophoresis tank, indicating that the program is in progress. Electrophoresis should be carried out at a constant voltage of 150V for 15 minutes. If necessary, increase the running time until the product reaches at least the middle of the gel. To obtain clearer results, the voltage can be reduced and the operating time can be extended. Observation results: The band position was observed by gel imager.

Topic: Purification and recovery of PCR products

Recorder：TONG YANBO

Process：

Column balancing steps: Add 500 μ l of balancing solution BL to adsorption column CA2 (place the adsorption column into the collection tube), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the recovery collection tube. (Please use the column that has been processed on the same day). Cut a single target DNA strip from the agarose gel (try to remove the excess) and put it into a clean centrifuge tube, and weigh it. Add 3 times the volume of sol solution PN to the gel block; when the recovered target fragment is<150 bp or the concentration of agarose gel is>2%, 6 times the volume of sol solution PN is required (for example, if the weight of gel is 0.1 g, its volume can be regarded as 100 μ l, and so on). Place in a 50 ℃ water bath for 10 minutes, during which gently flip the centrifuge tube up and down to ensure that the rubber block is fully dissolved. If there are still undissolved glue blocks, you can add some sol solution or continue to let it sit for a few minutes until the glue blocks are completely dissolved (if the volume of the glue blocks is too large, you can cut them into pieces in advance).(Note: After the gel block is completely dissolved, the temperature of the gel solution needs to be lowered to room temperature before being loaded onto the column, as the adsorption column has a weaker ability to bind DNA at higher temperatures.). ）Add the solution obtained in the previous step into an adsorption column CA2 (place the adsorption column in the collection tube) and let it stand at room temperature for 2 minutes. Centrifuge at 12000 rpm for 30-60 seconds, discard the waste liquid from the collection tube, and place the adsorption column CA2 into the collection tube. Attention: The adsorption column has a volume of 800 μ l. If the sample volume is greater than 800 μ l, it can be added in batches. Add 600 μ l of rinsing solution PW to the adsorption column CA2 (please check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 30-60 seconds, discard the waste liquid in the collection tube, and place the adsorption column CA2 into the collection tube. Repeat the previous step. Place adsorption column CA2 in the recovery manifold, centrifuge at 12000 rpm for 2 minutes, and try to remove the rinse solution as much as possible.Place the adsorption column CA2 at room temperature for several minutes and thoroughly air dry it to prevent residual rinsing solution from affecting the next step of the experiment. Attention: The residual ethanol in the rinse solution can affect subsequent enzyme reactions (such as enzyme digestion, PCR, etc.) experiments. Place the adsorption column CA2 in a clean centrifuge tube and suspend an appropriate amount of elution buffer E in the middle of the adsorption membrane. (If the recovered target fragment is>10 kb, the elution buffer EB should be preheated in a water bath at 65-70 ℃.) Let it stand at room temperature for 2 minutes. Collect DNA solution by centrifugation at 12000 rpm for 2 minutes.

Topic：Construction of pTopo-CER1 Vector

Recorder：LIU LUJIA

Process：Preparation before the connection reaction, establish a 10 μ l reaction system at room temperature (20-30 ℃), insert different fragments of different sizes, connect the reaction and transform the competent state of Escherichia coli. Connect at room temperature (20-30 ℃) for 5 minutes, and the connecting product can be directly transformed into competent cells or stored at -20 ℃. Transforming Escherichia coli competent DH5 α: Take out 100 μ l of Escherichia coli competent cells from the -80 ℃ refrigerator, quickly insert them into an ice bath, thaw and melt (about 3 minutes).

Immediately add 5-10 μ l of the connecting product, gently mix by hand at the bottom of the centrifuge tube (avoid using a gun to suck), and ice bath for 30 minutes. A 30 minute ice bath helps to effectively bind the product to Escherichia coli cells. Heat shock in a 42 ℃ water bath for 90 seconds, then quickly ice bath for 2-3 minutes. Do not shake the centrifuge tube during this process. Add 400 μ l of LB free medium and shake the transformed Escherichia coli at 37 ℃ and 200 rpm for 45-60 minutes. Coat the board and collect monoclonal colonies in the ultra clean workbench.

Result：Comparing sequencing results, open DNAMAN software, select Alignment in Sequence, click Mutiple Sequence Alignment, click File to enter the corresponding file, select DNA for alignment, and determine if there are sequence differences. If there is no difference from the CDS in the database, the CDS in the database will be used as the final gene result for the subsequent construction of other vectors. If there are differences, there may be natural evolutionary mutations. Repeat the above steps multiple times to ensure the reliability of the experimental results, and the final sequencing results shall prevail.

Topic：Construction of NbCER1 gene knockout vector

Recorder：LIULUJIA

Process:

Firstly, log in to the website http://crispr.hzau.edu.cn/CRISPR2/ Click on Start Dessin; Select U6 for snoRNA promoter, 19 for Guide Sequence Length, Nicotiana benthamiana (v0.4.4) for Target Genome, and default for other values. After setting the parameters, input the CDS sequence or segmented exon sequence of NbCER1 in Sequence, and then select two suitable targets with a hit rate greater than 0.6 and a miss rate less than 0.1, mainly in the non coding region. Generally, the target not far behind ATG is chosen because editing often leads to premature termination of translation. At the same time, the score is relatively high, there is no off target, and the GC content is moderate. For example, we selected two sgRNAs and confirmed ATAGCATTGCTGCACGCTGG (sg1)

The two sequences, GTTAGCACTGTCACAATGG (sg2), are completely consistent with the above sequencing results and can proceed to the next step

DT1-BsF: ATATATGGTCTCGATTGATAGCAGCATTGCTGCACGCGTT

DT1-F0: TGATAGCAGCATTGCTGCACGCGTTTTAGAGCTAGAAATAGC

DT2-R0: AACTTGTTGGTGACAGTGCTAACCAATCTCTTAGTCGACTCTAC

DT2-BsR: ATTATTGGTCTCGAAACTTGTTGGTGACAGTGCTAACCAA

In addition, we also performed four primer amplification, purified and recovered PCR products, established an enzyme cleavage ligation system, and the ligation products can be directly transformed into E. coli competent cells or stored at -20 degrees Celsius. Afterwards, the following experiments were conducted in sequence: transforming E. coli competence, coating with kanamycin resistance, selecting monoclonal antibodies, and using U626-IDF and U629-IDR primers for colony PCR identification. Use U626-IDF forward sequencing (around 700bp to detect 2 targets). Preserving bacteria (Escherichia coli/Agrobacterium), extracting plasmids from Escherichia coli, and transforming Agrobacterium GV3101.

Topic： Construction of pGreenII 62-SK-HY5 Vector

Recorder：YU QIYAO

Process：Cloning of the CDS fragment of HY5 gene, with a CDS fragment size of 477bp, an extension time of 20s, and a cycle number of 32. Then the CDS fragment of HY5 was purified by agarose gel electrophoresis and gel recovery. (Using a marker of 1000). Connect the HY5 gene to pGreenII 62 SK homologous B using Snapgene software, open the pGreenII 62 SK vector map, and select two unique endonuclease sites PstI and HindIII. Select the left PstI enzyme cleavage site 6bp+the left 15bp on the carrier skeleton as the left homologous B, and select the right HindIII enzyme cleavage site 6bp+the right 15bp on the carrier skeleton as the right homologous B. Add them to the 5 'end of the HY5 cloning primer F/R for primer synthesis. The primer name sequence is as follows:

62-SK-HY5-F:AGTGGATCCCCCGGGCTGCAGATGCAGGAGCAAGCGA (Tm:69℃)

62-SK-HY5-R:GTCGACGGTATCGATAAGCTTTCACTCACCGCTTCTCCT (Tm:68℃)

Continue PCR reaction with annealing temperature set to 62 ℃ and extension time set to 30s. Plasmid digestion (pGreenII 62-SK and pGreenII 0800-LUC). Determine the required endonuclease based on different carrier maps, and then perform enzyme cleavage operations according to the properties of the endonuclease. The required endonucleases for pGreenII 62-SK are PstI and HindIII, while the required endonucleases for pGreenII 0800-LUC are HindIII and PstI. Take a clean PCR tube and add the enzyme digestion system. Place the PCR tube in the PCR machine and perform enzyme digestion at 37 ℃ for 2 hours. Separation and purification of enzyme digestion products. Use a pipette to aspirate 6 μ l of plasmid before enzyme digestion and 1 μ l of 6 × Loading Buffer. Use the pipette to beat and mix well as a control sample. At the same time, 8.8 μ l of 6 × Loading Buffer was added to the PCR tube after enzyme digestion, and the mixture was shaken and mixed with a pipette, followed by agarose electrophoresis. After electrophoresis, place the gel in the gel imager to observe whether the enzyme is cut. The cut vector fragment is linear, and during electrophoresis, the migration rate is slower than that of the circular plasmid. Then, the target band is cut and purified by gel recovery. Take a clean PCR tube and add homologous recombination system.

Calculate based on the measured concentration and add the corresponding fragments with homologous B and the vector after cleavage. Recombinant at 37 ℃ for 30 minutes. (After homologous recombination, E. coli is transformed, then the plasmid is extracted and transformed into Agrobacterium competent state for preservation and future use.)

Topic：Construction of pGreenII 0800-LUC-CER1 Vector

Recorder：YU QIYAO

Process：Cloning of NbCER1 gene promoter fragment, annealed at 50 ℃, with a promoter sequence fragment size of 2000bp, extension time set to 40s, and cycle number of 32. Then the CDS fragment of NbCER1 was purified by agarose gel electrophoresis and gel recovery. (Using a marker of 5000). The NbCER1 promoter sequence is connected to pGreenII 0800-LUC homology B. Using Snapgene software, open the 0800-LUC vector map and select two unique endonuclease sites, HindIII and PstI. Select the left HindIII enzyme cleavage site 6bp+the left 15bp on the carrier skeleton as the left homologous B, and select the right PstI enzyme cleavage site 6bp+the right 15bp on the carrier skeleton as the right homologous B. Add them to the 5 'end of the CER1 cloning primer F/R for primer synthesis. Continue the PCR reaction, set the annealing temperature to 62 ℃, the extension time to 1 minute, and set other conditions as in process 6; The homologous recombination operation is described in process 11.5. After homologous recombination, transform Escherichia coli in sequence; Coating board; Picking bacteria; Bacterial P; Sequencing; Shaking bacteria; Quality enhancing granules; Transforming Agrobacterium GV3101; Coating board; Picking bacteria; Bacteria P; Protecting bacteria.

Topic：Experimental steps for dual luciferase reporter gene detection system

Recorder：YU QIYAO

Process：

Agrobacterium infects tobacco. Add the Agrobacterium that has been transferred into the recombinant plasmid to 1-5ml LB liquid medium containing Rif and Kan, and activate and culture it in advance at 200rpm on a shaker at 28 ℃; Take an appropriate amount of activated Agrobacterium and add it to 30ml of LB liquid medium containing Rif and Kan. Shake at 28 ℃ and incubate at 200rpm until OD600 reaches 1.0; Take an appropriate amount of bacterial solution and centrifuge at 4000rpm for 10 minutes at room temperature. Discard the supernatant and resuspend the bacterial solution in MMG or MES solution until the OD600 reaches 0.8-1.0, then set aside for later use; Mix the recombinant plasmid GENE-PGreenII 62-SK infection solution and PROMOTER-pHreenII 0800-LUC infection solution in a volume ratio of 9:1, and let them stand in the dark at 28 ℃ for at least 3 hours; Select Nicotiana benthamiana during its vigorous growth period (about a month, without flowering), use a 1ml syringe to aspirate the mixed infection solution, remove the needle, and select leaves in good condition for injection from the back. After treating the infected Nicotiana benthamiana under dark conditions for 12-24 hours, continue to culture under normal day night alternation light for 24-48 hours before sampling.

Sampling and luciferase activity detection. Sampling: Use a punch to select 1-2 locations near the injection site of Benshi cigarettes, place them in a 2ml centrifuge tube containing steel balls, freeze them in liquid nitrogen, and shake and grind them in a grinder at 30-40Hz for 30 seconds until they are in powder form. Follow the steps of the Genbiyun Tian dual luciferase assay kit (item number RG027/RG028) for subsequent operations. Add 200-300 μ l of cell lysate and shake well. Centrifuge at room temperature at 15000 × g for 5 minutes, and transfer the supernatant to a new 1.5ml centrifuge tube. The supernatant can be directly used for subsequent testing. If it cannot be measured in a timely manner, it can be stored at -20 ℃ for one month until further testing. The frozen sample needs to be thawed and restored to room temperature before measurement. Prepare the reagents. Dissolve the firefly luciferase detection reagent and sea kidney luciferase detection buffer in advance and allow them to reach room temperature; The substrate for detecting sea kidney luciferase (100x) is stored on ice for future use. Sea kidney luciferase detection working solution: Add 1 volume of 100 x sea kidney luciferase detection substrate to 100 times the volume of sea kidney luciferase detection buffer and mix well. Prepare and use immediately. After preparation, wrap it in tin foil and store it in the dark. If there is any remaining detection working solution, it can be stored at -20 ℃ for one week, but the detection effect will decrease with prolonged storage time. Therefore, it cannot be prepared into a working solution and stored for a long time. Add 100 μ l of the test sample to the enzyme-linked immunosorbent assay (ELISA) plate and mix it evenly with 100 μ l of firefly luciferase detection reagent. Then, measure the firefly luciferase activity in the ELISA reader to obtain the LUC value; After the measurement is completed, add 100 μ l of sea kidney luciferase detection working solution and mix it evenly. Measure the sea kidney luciferase and obtain the REN value; Record data.

This experiment used the DEVICES multifunctional enzyme-linked immunosorbent assay (ELISA) reader. After opening the SoftMax pro 6.5.1 software, select "Settings" in the Plate Tools menu at the top to set the software parameters. After completing the software parameter settings, prepare the test samples.

Result: Based on the real-time fluorescence intensity values LUC and REN, the LUC/REN ratio was calculated to compare the activation degree of the target reporter gene between different samples, and subsequent data analysis was conducted.

Topic：Genetic transformation of Nicotiana benthamiana

Recorder：SONG YIMING

Process：

This experiment used agrobacterium mediated leaf disc method for genetic transformation of tobacco. Plant sterile tobacco seedlings, take healthy and tender leaves, rinse the leaves to remove surface dust, use a punch to make circular leaf discs with a diameter of about 5-10 millimeters, then soak them in 2% NaClO (sterile distilled Tween 20 ddH2O) and gently shake them on a horizontal shaker to sterilize. Remove the agrobacterium previously stored in the -80 ℃ refrigerator, take 100 and add it to liquid LB medium. Incubate overnight at 28 ℃ and 200rpm on a shaker for 16 hours to activate the agrobacterium, and adjust the OD600 of the bacteria to 0.2-0.3 using infection solution. Immerse the leaf disc in the prepared Agrobacterium solution for 15 minutes to allow the Agrobacterium to adhere to the wound site. Then remove the leaf disc, absorb excess bacterial liquid, and place it on a co culture medium (without antibiotics). Incubate in the dark at an appropriate temperature for 2-3 days. During this process, Agrobacterium transfers and integrates T-DNA into the genome of tobacco cells. After 48 hours of dark cultivation at 23 ℃, transfer the leaves to a selected medium (containing kanamycin, 6-BA, NAA, Tim) and continue to observe the cultivation until new shoots grow.

Cut off the callus tissue as much as possible, insert the buds vertically into the rooting medium, with about 3-5 plants per bottle. Continue to cultivate under the conditions of 23 ℃ and light/dark cycle of 16 h/8 h until the root system of the plants develops and matures, and then proceed with seedling refinement. Clean the culture medium of Nicotiana benthamiana and plant it in a soil mixture of peat soil and vermiculite in a 1:1 ratio. Wrap the plants with plastic film, keep the soil moist and ventilated, at 23 ℃, with a light/dark cycle of 16 h/8 h. After 30 days of cultivation, the transgenic Nicotiana benthamiana plants can be identified.

Topic：Treat tobacco plants under different light intensities

Recorder：SONG YIMING

Process：

Phase 1: Cultivation and Light Treatment of Plant Materials

Topic：Detecting the expression levels of HY5 protein, CER, and wax content in tobacco plants treated with different light intensities

Recorder:SONGYIMING

Process：

Tobacco plants treated with light were taken from leaves of the same size, and the total protein content was extracted. Western Blot and gel electrophoresis were used to obtain band plots, and anti-HY5 antibodies were used to detect the induced HY5 protein content. The grayscale values of each sample's HY5 band and internal reference band were measured separately, and the HY5/internal reference ratio of each sample was calculated. This ratio represents the relative expression level of HY5 protein, i.e. [HY5] in the equation.

Detection of HY5 protein levels (Western Blot) and CER1 mRNA levels (quantitative real-time fluorescence PCR, qPCR).

The detection method for HY5 protein level is the same as above. The detection of CER1 mRNA level uses a reagent kit (such as TRIzol method) to extract high-quality total RNA. After determining the concentration, an equal amount of RNA is reverse transcribed into cDNA using reverse transcriptase. CER1 specific fluorescent quantitative primers are designed, and qPCR reaction is performed on each cDNA sample to amplify CER1 and internal reference genes, respectively. Calculate the relative expression level of CER1 gene using the Δ Δ Ct method, i.e. [CER1_mRNA]=2 ^ (- Δ Ct), which will obtain the relative expression level of CER1 mRNA in each sample relative to the control group (such as Mock treated samples), i.e. the dependent variable [CER1_mRNA].

The RNA extraction, reverse transcription, and qPCR processes are exactly the same as the previous protocol. Using GC-MS to determine the wax content of tobacco leaves, quantitative analysis was conducted by comparing the peak areas of wax components (alkanes, aldehydes, alcohols, acids, etc.) in the sample with internal standards.

Topic：Identification of positive plants

Recorder：LIU LUJIA

Process：

Number transgenic seedlings and wild-type plants, extract genomic DNA, and use it as a template for PCR identification. Among them, the positive control template used is a vector plasmid with correct sequencing, and the negative control template is wild-type tobacco genomic DNA and sterile water. After gel imaging, determine whether the transgenic plants are positive seedlings according to the size of the bands. Send the PCR products of correctly identified positive plants to a biotech company for sequencing, and determine the editing type based on the sequencing results.

Topic：Analysis of wax content and composition in CER1 knockout plants

Recorder：LIU LUJIA

Process：

Select healthy and mature tobacco leaves. Place the leaves in a test tube containing 20 ml of chloroform at room temperature. Soak for 1 minute, then transfer to a new test tube containing 30 ml chloroform at 60 ℃ and soak for 2 minutes. Then remove the leaves and mix the two chloroform extracts. And add 30 μ g of heptane standard sample, dry and concentrate in a nitrogen dryer until the dissolved substance is slightly wet. Add 100 to the test tube μl N,O-bis（trimethylsilyl）trifluoroacetamide）:trimethylchlorosilane（99:1） Derive the reagent and seal it, then incubate in an oven at 115 ℃ for 30 minutes. Dry the remaining residue in a nitrogen blow dryer, dissolve the extract in 500 μ l of hexane, and transfer it to an injection bottle for storage. The wax content and composition of leaves were determined using gas chromatography-mass spectrometry (GC-MS) analysis method. The initial setting of the instrument is to maintain the temperature of the mass spectrometer detector at 280 ℃, the injection port temperature at 260 ℃, and the power supply voltage at 70eV. Siphon injection was performed through a 30 m × 0.25 mm HP-5 column, with high-purity helium gas as the carrier gas at a constant flow rate of 1.0 mL/min, without splitting the injection. The measurement procedure is to set the initial temperature of the capillary column at 60 ℃, then raise it to 200 ℃ at a rate of 20 ℃/min and maintain it for 2 minutes, and then raise it to 280 ℃ at a rate of 5 ℃/min and maintain it for 8 minutes, using ion selective mode for measurement.