Acquisition of target gene NbCER1 and NbHY5 sequences

Looking through the official website of Arabidopsis (https://www.arabidopsis.org/), select the gene option, search for CER1, click on the gene ID corresponding to CER1, AT1G02205 (CER1), select Protein in Sequences, and copy the protein sequence. Logging in to the tobacco database (https://solgenomics.net/organism/Nicotiana_benthamiana/genome), click on the Blast option, select blastp (protein to protein), and choose N.benthamiana Genome V1.0.1 predicted proteins as the Database. Enter the protein sequence of Arabidopsis CER1 for alignment.

Based on the alignment results, selecting the gene with the highest Score value, an evalue of 0, and a Wax2 domain-containing feature. The gene ID is Niben101Scf17024g00002.1. Click on the ID, select "View in genome context", right-click and select "View details" to obtain the gene DNA sequence and CDS sequence. Use the same method to obtain the HY5 gene. The Arabidopsis thaliana HY5 gene ID is AT5G11260 (HY5). Through Blast alignment, the gene ID of HY5 in Nicotiana benthamiana is Niben101Scf15744g00003.1.

Extraction of DNA from tobacco leaves
  1. 1.Take approximately 50 to 100 mg of fresh tobacco leaf tissue and grind it thoroughly in liquid nitrogen.
  2. 2.Collect the ground powder into a centrifuge tube (self-provided), add 700μl of preheated solution A at 65℃ (add β-mercaptoethanol to the preheated solution A before use to make its final concentration 0.1%), quickly invert and mix, then place the centrifuge tube in a 65℃ water bath for 20 minutes, during which invert the centrifuge tube several times to mix the sample.
  3. 3.Note: If RNA removal is required, after completing the above steps, add 4μl of RNase A solution with a concentration of 100 mg/ml, shake and mix, and leave it at room temperature for 5-10 minutes.
  4. 4.Add 700μl of chloroform, mix thoroughly, and centrifuge at 12,000 rpm for 5 minutes.
  5. 5.Carefully transfer the upper aqueous phase into a new centrifuge tube (provided by yourself), add 700μl of solution B, and mix thoroughly.
  6. 6.Add all the solution obtained in Step 4 into the spin column (Spin Column DM) that has been placed in the collection tube. If the solution cannot be added all at once, transfer it in multiple portions. Centrifuge at 10,000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the spin column back into the collection tube.
  7. 7.Add 500μl of solution C to the adsorption column (check if anhydrous ethanol has been added before use), centrifuge at 10,000 rpm for 1 minute, discard the waste liquid in the collection tube, and replace the adsorption column back into the collection tube.

Extraction and quality assessment of RNA from tobacco leaves
RNA extracting
  1. 1.Using scissors treated with RNase inhibitor to cut 50-100 mg of young tobacco leaves (approximately 2.0 cm * 2.0 cm in size), place them into a 2.0 ml RNase-free centrifuge tube, add steel balls that have been sterilized with alcohol, and quickly place the tube into liquid nitrogen. Note: Place the materials in the dark for 24 hours before the experiment to reduce the starch content in the materials.
  2. 2.Placing the centrifuge tube containing the sample into the plant tissue grinding instrument, grind for 30 seconds, and repeat the grinding process twice.
  3. 3.Taking out the sample, add 1ml of Trizol reagent, vortex on a vortex mixer for 30 seconds to mix thoroughly, let it stand at room temperature for 5 minutes to allow for complete lysis, and centrifuge at 12000 rpm for 5 minutes.
  4. 4.Pipette the supernatant (no more than 700ul) into another clean 1.5ml RNase-free centrifuge tube, add 200ul of chloroform, and mix quickly by shaking. At this point, the solution should be in a uniform emulsion state. Let it stand at room temperature for 15 minutes.
  5. 5.Centrifuge at 12000 rpm for 10 minutes using a low-temperature centrifuge (4°C), aspirate the supernatant into another centrifuge tube, add 500 μl of isopropanol, mix well (to precipitate RNA), and let it stand at room temperature for 5-10 minutes.
  6. 6.Centrifuge at 12000RPM for 10 minutes at 4℃, discard the supernatant, and the RNA will precipitate at the bottom of the tube. Add 1ml of 75% ethanol, gently shake the centrifuge tube, and suspend the precipitate.
  7. 7.Centrifuge at 8000RPM for 5 minutes at 4℃, and discard as much of the supernatant as possible.
  8. 8.Let it dry at room temperature or dry in vacuum for 5-10 minutes. Note: The RNA sample should not be too dry, otherwise it will be difficult to dissolve.
  9. 9.Dissolve the RNA sample with 50ul of RNase-free ultrapure water at 55-65℃ for 5-10 minutes to obtain total plant RNA. Store the extracted RNA at -80℃.
RNA concentration determination

Using a pipette to aspirate 2μl of the extracted solution, open the Nanodrop software, use elution buffer as a blank control, and measure the RNA concentration and the relative absorbance of A260/A280 on the RNA Nanodrop 2000 Spectrophotometer. The A260/A280 ratio for pure RNA should be between 1.8 and 2.2.

Agarose gel electrophoresis for detecting RNA integrity
  1. 1.Making gel：Weigh 0.9g of agarose and pour it into a 200ml conical flask. Use a graduated cylinder to measure 60ml of 1×TAE solution and heat it in the microwave for 2 minutes. Wrap the opening of the flask with a towel, rinse the body of the flask with running water for 10 seconds, add 6μl of nucleic acid dye, mix well, pour it into a gel preparation plate, remove any air bubbles, insert a comb, and wait for it to cool down.
  2. 2.RNA Treatment：In a clean RNase-free PCR tube


  1. 3.Point sample：Pipette the liquid from the PCR tube and dispense it into the sample wells in order；Put the condensed gel into the electrophoresis tank, for sample loading, the voltage is approximately 50V~70V. After 10 minutes of electrophoresis, the samples were placed in a gel imaging system for observation and analysis of the results.

The main components of the total RNA sample are 28s rRNA, 18s rRNA, and 5s rRNA. After electrophoresis, three distinct bands appear on the gel. The brightness of the 28s rRNA band is twice that of the 18s rRNA band, indicating that the result is relatively complete.

cDNA synthesis

In this experiment, we utilized the AMV First-strand cDNA Synthesis Kit [Sangon Biotech (Shanghai) Co., Ltd.] with product number B532445.

  1. 1.Add 2μg of total RNA, 1μl of Oligo dT, and RNase-free ddH2O to a RNase-free PCR tube in an ice bath, and dilute to 12μl.
  2. 2.After gently mixing, centrifuge for 3-5 seconds. The reaction mixture is then placed in a 65°C water bath for 5 minutes, followed by an ice bath for 30 seconds, and finally centrifuged for another 3-5 seconds.
  3. 3.Add the following components to a clean RNase-free PCR tube:


  1. 4.Gently mix and centrifuge for 3-5 seconds.
  2. 5.Perform reverse transcription reaction in the PCR machine according to the following conditions.42℃, 30-60 minutes; terminate the reaction, 85℃, 5 minutes (enzyme inactivation), after treatment, cDNA is obtained and stored in a 4℃ refrigerator for future use.

Clone primer design
  1. 1.Open Snapgene software, select File, enter new DNA or RNA software, and input the CDS sequences of NbCER1 and NbHY5 respectively.
  2. 2.According to the primer design principles, the primer length should be 15-35 bp, avoiding the presence of more than five consecutive purine or pyrimidine nucleotide sequences. The content of G+C should be preferably between 40%-60%. Complementarity between primers should be avoided to prevent primer dimer formation. Select a sequence from the ATG site, click "Add Primer", and choose the top strand or bottom strand. At this point, you can see the annealing temperature, binding site, and GC content values. Ensure that the difference in Tm values between upstream and downstream primers is less than 5℃.
  3. 3.Send the primer name and the sequence from the 5' end to the 3' end of the primer to the biotechnology company for primer synthesis.
PCR amplification of CDS sequences of NbCER1 and NbHY5 genes
  1. 1.Firstly, prepare the cDNA template, primer, ddH2O, and M5-Taq polymerase.
  2. 2.In a sterile and clean PCR tube, establish the reaction system according to the following requirements.


  1. 3.Place it in the PCR machine and proceed according to the following reaction program

(The annealing time can be adjusted based on the transcription speed of the enzyme used and the maximum length of the fragment that needs to be copied.)

Agarose gel electrophoresis
  1. 1.Preparation of TAE buffer: Dilute 50× TAE solution to 1× TAE solution according to the ratio.
  2. 2.Prepare agarose gel mixture: According to the size of the DNA/RNA fragments to be separated, prepare an agarose solution of appropriate concentration using electrophoresis buffer. In this experiment, the concentration of the agarose gel is 1.5% (suitable for separating linear DNA fragments ranging from 0.2 to 3Kb). Weigh 0.9 g of agarose and mix it with 60 ml of 1×TAE solution in a conical flask.
  3. 3.Dissolving agarose: Gently cover the neck of the conical flask with KimWipes wiping paper and place it in the microwave for heating and melting. If it is not completely dissolved, wear heat-resistant gloves and carefully rotate the conical flask to ensure that the unmelted agarose particles sticking to the wall enter the solution. Repeat the heating process until it is completely melted.
  4. 4.Transfer the conical flask to a 55°C water bath using heat-resistant gloves. After the melted gel has cooled slightly, add 6 μl of GelRed nucleic acid dye. Gently swirl to mix the gel solution thoroughly.
  5. 5.Pour into gel mold: Pour the warm liquid gel into the gel mold, remove any air bubbles, insert a comb, and wait for about 20 minutes until the gel is completely dry. Gently pull out the comb and then remove the gel from the mold (depending on the gel plate, choose a comb with large or small holes as needed).
  6. 6.Prepare the electrophoresis tank: Pour the TAE solution into the electrophoresis tank and place the gel inside. Continue to add electrophoresis buffer until it just covers the gel by about 1mm.
  7. 7.Sample loading: Add the PCR product and Marker to the wells of the gel. The amount added can be determined based on the size of the gel. (Extracted RNA should be added with 0.2 times the volume of 6×loading buffer).
  8. 8.Gel running: Close the lid of the electrophoresis tank and connect the electrode plugs. DNA migrates towards the positive pole (red plug) side. The loading well should be positioned at the negative pole. Turn on the power supply, and when dense small bubbles emerge from the electrophoresis tank, it indicates that the program is running. Electrophoresis is performed at a constant voltage of 150V for 15 minutes. If necessary, increase the running time until the product migrates to at least the middle of the gel. To obtain clearer results, the voltage can be reduced and the running time can be extended.
  9. 9.Observation result: Observe the position of the band with a gel imager.

PCR Product purification and recovery
  1. 1.Column equilibration step: Add 500μl of equilibration buffer BL to the adsorption column CA2 (with the adsorption column placed in the collection tube), centrifuge at 12,000 rpm for 1 minute, discard the waste liquid in the collection tube, and replace the adsorption column back into the collection tube. (Please use the column processed on the same day)
  2. 2.Cut the single target DNA band from the agarose gel (try to remove excess parts) and place it into a clean centrifuge tube, then weigh it.
  3. 3.Add 3 times the volume of sol solution PN to the gel block; when the target fragment to be recovered is <150 bp or the agarose gel concentration is >2%, 6 times the volume of sol solution PN is required (if the gel weight is 0.1 g, its volume can be considered as 100 μl, and so on).
  4. 4.Place the centrifuge tube in a 50℃ water bath for 10 minutes, gently flipping it up and down during the process to ensure complete dissolution of the gel block. If there are still undissolved gel blocks, add some more sol solution or continue to place it for a few more minutes until the gel blocks are completely dissolved (if the volume of the gel block is too large, it can be cut into smaller pieces beforehand). (Note: After the gel block is completely dissolved, the temperature of the gel solution needs to be lowered to room temperature before loading onto the column, as the adsorption column has a weaker ability to bind DNA at higher temperatures.)
  5. 5.Add the solution obtained in the previous step to an adsorption column CA2 (with the adsorption column placed in a collection tube) and let it stand at room temperature for 2 minutes.
  6. 6.Centrifuge at 12,000 rpm for 30-60 seconds, discard the waste liquid in the collection tube, and place the adsorption column CA2 into the collection tube. Note: The adsorption column has a capacity of 800 μl. If the sample volume is greater than 800 μl, it can be added in batches.
  7. 7.Add 600 μl of rinsing solution PW (please check if anhydrous ethanol has been added before use) to the adsorption column CA2, centrifuge at 12000 rpm for 30-60 seconds, discard the waste liquid in the collection tube, and place the adsorption column CA2 into the collection tube. Repeat the previous step.
  8. 8.Place adsorption column CA2 in the recovery manifold, centrifuge at 12000 rpm for 2 minutes, and try to remove the rinse solution as much as possible. Place the adsorption column CA2 at room temperature for several minutes and thoroughly air dry it to prevent residual rinsing solution from affecting the next step of the experiment. Attention: The residual ethanol in the rinse solution can affect subsequent enzyme reactions (such as enzyme digestion, PCR, etc.) experiments.
  9. 9.Place the adsorption column CA2 in a clean centrifuge tube and suspend an appropriate amount of elution buffer E in the middle of the adsorption membrane. (If the recovered target fragment is>10 kb, the elution buffer EB should be preheated in a water bath at 65-70 ℃.) Let it stand at room temperature for 2 minutes. Collect DNA solution by centrifugation at 12000 rpm for 2 minutes.

(Note: The elution volume should not be less than 30 μ l, as a small volume can affect the recovery efficiency.). The pH value of the eluent has a significant impact on the elution efficiency. If sequencing is to be performed later, deionized water should be used as the eluent, and its pH value should be kept within the range of 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). A pH value below 7.0 will reduce the elution efficiency; And DNA products should be stored at -20 ℃ to prevent DNA degradation. DNA can also be eluted with buffer solution (10 mM Tris CI, pH 8.0). To improve the recovery of DNA, the solution obtained by centrifugation can be added back to the centrifugal adsorption column, left at room temperature for 2 minutes, centrifuged at 12000 rpm for 2 minutes, and the DNA solution collected in a centrifuge tube）

Construction of pTopo-CER1 vector
Preparation before Connection Reaction

Establish the following reaction system (10 μ l system) at room temperature (20-30 ℃)

Recommended usage for inserting fragments of different sizes:

Connection reaction and transformation of Escherichia coli competent state
  1. 1.Connect at room temperature (20-30 ℃) for 5 minutes, and the connecting product can be directly transformed into competent cells or stored at -20 ℃.
  2. 2.Transforming Escherichia coli competent state DH5 α:
  3. 3.Take out 100 μ l of E. coli competent cells from the -80 ℃ refrigerator, quickly insert them into an ice bath, thaw and melt (about 3 minutes).
  4. 4.Immediately add 5-10 μ l of the connecting product, gently mix by hand at the bottom of the centrifuge tube (avoid using a gun to suck), and ice bath for 30 minutes. A 30 minute ice bath helps to effectively bind the product to Escherichia coli cells.
  5. 5.Heat shock in a 42 ℃ water bath for 90 seconds, then quickly ice bath for 2-3 minutes. Do not shake the centrifuge tube during this process.
  6. 6.Add 400 μ l of LB free medium,
  7. 7.Place the transformed Escherichia coli in a shaking table at 37 ℃ and 200 rpm for 45-60 minutes.
Coating
  1. 1.Perform the following operations on the ultra clean workbench: pipette 100-200 μ l of bacterial solution onto the ampicillin plate.
  2. 2.Apply the bacterial solution evenly onto the bacterial culture plate using a coating machine, blow dry it, and seal the plate with a sealing film. Invert the plate and culture it in a 37 ℃ biochemical incubator. (Cultivate for 12-16 hours).
Selecting monoclonal bacterial colonies

Perform the following operation in the ultra clean workbench: add 1ml of LB medium containing ampicillin resistance to a sterile centrifuge tube of 1.5/2.0 ml. Open the resistance plate with well grown colonies, insert a 10 μ l/2.5 μ l pipette into the white tip, gently pick up 5 monoclonal colonies with the tip of the pipette, place them in a centrifuge tube, cover with a lid, label them, and incubate them on a shaking table at 37 ℃ and 200 rpm for 4-5 hours.

Establish a reaction system in a sterile and clean PCR tube according to the following requirements:

Placing it in a PCR machine and react according to the following reaction procedure

The agarose gel electrophoresis detection operation is as shown in process 7 (omitted), and then the bacterial solution with correct bands is sent to the biological company, and the universal primer M13F/R is used for sequencing, waiting for the sequencing result (1 day).


Sequencing result comparison

Open DNAMAN software, select Alignment in Sequence, click Mutiple Sequence Alignment, click File to enter the corresponding file, select DNA for alignment, and determine if there are sequence differences. If there is no difference from the CDS in the database, the CDS in the database will be used as the final gene result for the subsequent construction of other vectors. If there are differences, there may be natural evolutionary mutations. Repeat the above steps multiple times to ensure the reliability of the experimental results, and the final sequencing results shall prevail.

Construction of NbCER1 gene knockout vector
NbCER1 gene target design

Firstly, logging into the website http://crispr.hzau.edu.cn/CRISPR2/ ， then clicking on the button of starting design; Selecting U6 for snoRNA promoter, 19 for Guide Sequence Length, Nicotiana benthamiana (v0.4.4) for Target Genome, and default for other values. After setting the parameters, input the CDS sequence or segmented exon sequence of NbCER1 in Sequence, and then select two suitable targets with a hit rate greater than 0.6 and a miss rate less than 0.1, mainly in the non coding region. Generally, the target not far behind ATG is chosen because editing often leads to premature termination of translation. At the same time, the score is relatively high, there is no off target, and the GC content is moderate. For example, we selected two sgRNAs and confirmed that both ATAGCAATTGCTGCACGCTGG (sg1) and GTTAGCACTGTCACCACAATGG (sg2) sequences were identical to the sequencing results mentioned above, and we can proceed to the next step.


DT1-BsF: ATATATGGTCTCGATTGATAGCAGCATTGCTGCACGCGTT

DT1-F0: TGATAGCAGCATTGCTGCACGCGTTTTAGAGCTAGAAATAGC

DT2-R0: AACTTGTTGGTGACAGTGCTAACCAATCTCTTAGTCGACTCTAC

DT2-BsR: ATTATTGGTCTCGAAACTTGTTGGTGACAGTGCTAACCAA

Four primer amplification
Placing it in a PCR machine and react according to the following reaction procedure

The connecting product can be directly transformed into E. coli competent cells or stored at -20 degrees Celsius.

Afterwards, the following experiments were conducted in sequence: transforming E. coli competence, coating with kanamycin resistance, selecting monoclonal antibodies, and using U626-IDF and U629-IDR primers for colony PCR identification. Use U626-IDF forward sequencing (around 700bp to detect 2 targets).

Protecting bacteria (Escherichia coli/Agrobacterium)

Preparation: Preparation of Bacillus subtilis glycerol: Pour 50 ml of glycerol into a blue capped glass bottle using a measuring cylinder, add an equal volume of deionized water, and place in a high-pressure sterilization pot at 121 ℃ for 15 minutes until cooled at room temperature.

Perform the following operations on the ultra clean workbench: pipette 500ml of glycerol into a clean centrifuge tube, add an equal volume of bacterial solution, shake and mix well, and store at -80 degrees Celsius.

Extracting plasmids from Escherichia coli
  1. 1.Preparation work: Shake the bacteria the night before extracting plasmids in an ultra clean workbench. Add 50 μ l of kanamycin and 80-100 μ l of bacterial solution to 50ml of LB liquid medium, and shake overnight at 37 ℃ and 200 rpm.
  2. 2.Take 1.5-4.5ml of overnight cultured bacterial solution, centrifuge at 12000 rpm for 30 seconds, try to dry the supernatant as much as possible, and collect the bacterial cells. Collect more than 1.5ml of bacterial solution. After centrifuging and discarding the supernatant, add more bacterial solution into the same 1.5ml tube and repeat step 1 until enough bacterial cells are collected.
  3. 3.Resuspend the bacterial precipitate in 250 μ l solution P1 and vortex until completely suspended.
  4. 4.Add 250 μ l of solution P2, gently flip up and down 6-8 times to fully lyse the bacterial cells, and leave at room temperature for 4 minutes. Mix gently without vigorous shaking to prevent damage to the plasmid.
  5. 5.Add 350 μ l of solution P3 and gently flip it up and down 6-8 times immediately. When thoroughly mixed, white flocculent precipitates will appear. Centrifuge at 12000 rpm for 10 minutes and carefully remove the supernatant. After adding solution P3, it should be mixed immediately to avoid local precipitation of SDS.
  6. 6.Column equilibrium: Take a new silica gel membrane adsorption column and install it in a collection tube. Draw 100 μ l of equilibrium solution into the adsorption column. Centrifuge at 13000rpm for 1 minute, discard the waste liquid from the collection tube, and place the adsorption column back into the recovery collection tube. At this point, the equilibrium liquid pretreatment column is complete. Follow the subsequent steps.
  7. 7.Add the supernatant obtained in the previous step into the adsorption column (place the adsorption column in the collection tube), centrifuge at 12000 rpm for 30-60 seconds, and discard the waste liquid in the collection tube.
  8. 8.Add 600 μ l of rinse solution WB (please check if anhydrous ethanol has been added first!)! ）Centrifuge at 12000rpm for 30 seconds and discard the waste liquid.
  9. 9. Repeat step 6.
  10. 10.Put the adsorption column back into the empty collection tube, centrifuge at 12000rpm for 2 minutes, and try to remove the rinsing solution as much as possible.
  11. 11. Remove the adsorption column AC and place it in a clean centrifuge tube. Add 50-100 μ l of elution buffer EB to the middle of the adsorption membrane (the elution buffer is better heated in a 65-70 ℃ water bath beforehand), let it stand at room temperature for 2 minutes, and centrifuge at 12000rpm for 1 minute. The liquid obtained from the centrifuge tube is the desired plasmid. Store the extracted plasmid at -20 degrees Celsius or directly use it to transform Agrobacterium into a competent state.
Transforming Agrobacterium GV3101

Take out the Agrobacterium susceptible state (100ul) from the -80 °C refrigerator and quickly place it on ice to melt (about 5 minutes). Use a pipette to extract 3-5 ul of the extracted plasmid and add it to the Agrobacterium susceptible state. Ice bath for 5 minutes, liquid nitrogen for 5 minutes, heat shock at 37 °C for 5 minutes, and ice bath for 5 minutes. Add 400ul of non resistant LB liquid culture medium to the ultra clean workbench, place it in a shaking table at 28 ℃ and 200rpm for 3-4 hours, and then coat the plate (LB kana+Rif plate). After coating, cultivate in a 28 degree biochemical incubator for 48 hours.

Afterwards, monoclonal antibodies were also selected, and U626 IDF+U629 IDR=726bp colony PCR identification was performed; The strip can be used correctly to preserve bacteria.

Construction of pGreenII 62-SK-HY5 Vector
Cloning of CDS fragment of HY5 gene

HY5-F: ATGCAGGAGCAAGCGACGAG （Tm:60℃）

HY5-R: TCACTCACCGCTTCTCCTACT (Tm:59℃)

The cloning method is as described in process 6, where the annealing temperature is modified to 57 ℃, the CDS fragment size of HY5 is set to 477bp, the extension time is set to 20s, and the number of cycles is 32. Then the CDS fragment of HY5 was purified by agarose gel electrophoresis and gel recovery. (Using a marker of 1000)

HY5 gene linked to pGreenII 62 SK homologous B
  1. 1.Using Snapgene software, open the pGreenII 62 SK vector map and select two unique endonuclease sites, PstI and HindIII
  2. 2.Select the left PstI enzyme cleavage site 6bp+the left 15bp on the carrier skeleton as the left homologous B, and select the right HindIII enzyme cleavage site 6bp+the right 15bp on the carrier skeleton as the right homologous B. Add them to the 5 'end of the HY5 cloning primer F/R for primer synthesis.
  3. 3. The primer name sequence is as follows:

62-SK-HY5-F:AGTGGATCCCCCGGGCTGCAGATGCAGGAGCAAGCGA (Tm:69℃)

62-SK-HY5-R:GTCGACGGTATCGATAAGCTTTCACTCACCGCTTCTCCT (Tm:68℃)

  1. 4.Continue the PCR reaction, set the annealing temperature to 62 ℃, the extension time to 30s, and set other conditions as in process 6.
Plasmid digestion (pGreenII 62 SK and pGreenII 0800-LUC)
  1. 1.Determine the required endonuclease based on different carrier maps, and then perform enzyme cleavage operations according to the properties of the endonuclease.
  2. 2.The endonucleases required for pGreenII 62-SK are PstI and HindIII, while the endonucleases required for pGreenII 0800-LUC are HindIII and PstI
  3. 3. Take clean PCR tubes and add enzyme digestion system according to the following components (added on ice)
  1. 4. Place the PCR tube in the PCR machine and perform enzyme digestion at 37 ℃ for 2 hours.
Separation and Purification of Enzyme Cut Products

Use a pipette to aspirate 6 μ l of plasmid before enzyme digestion and 1 μ l of 6 × Loading Buffer. Use the pipette to beat and mix well as a control sample. At the same time, 8.8 μ l of 6 × Loading Buffer was added to the PCR tube after enzyme digestion, and the mixture was shaken and mixed with a pipette. Then, agarose electrophoresis was performed. The detailed steps are shown in process 7, which is omitted here.

After electrophoresis, place the gel in the gel imager to observe whether the enzyme is cut. The cut vector fragment is linear, and during electrophoresis, the migration rate is slower than that of the circular plasmid. Then, the target band is cut for gel recovery and purification. The detailed steps of the gel recovery and purification process are shown in process 8.

homologous recombination
  1. 1.The principle of homologous recombination

  1. 2.Take clean PCR tubes and add homologous recombination system according to the following components (added on ice)

(Optimal cloning vector dosage=[0.02 × base pairs] ng)

(Optimal insertion fragment dosage=[0.04 x base pairs] ng)

  1. 3.Calculate based on the measured concentration and add the corresponding fragments with homologous B and the vector after cleavage. Recombinant at 37 ℃ for 30 minutes. (After homologous recombination, E. coli is transformed, then the plasmid is extracted and transformed into Agrobacterium competent state for preservation and future use.)

Construction of pGreenII 0800-LUC-CER1 Vector
Cloning of NbCER1 gene promoter fragment

CER1-6QD-F：TATATTACCCTCGCATACAAT Tm:51℃

CER1-6QD-R：TGTTATTGTTTTAGAAGGTTACAAT Tm:51℃


The cloning method is as follows: the annealing temperature is 50 ℃, the fragment size of the CER1 promoter sequence is 2000bp, the extension time is set to 40s, and the number of cycles is 32. Then the CDS fragment of NbCER1 was purified by agarose gel electrophoresis and gel recovery. (Using a marker of 5000)

NbCER1 promoter sequence connected to pGreenII 0800-LUC homologous B
  1. 1.Using Snapgene software, open the 0800-LUC vector map and select two unique endonuclease sites, HindIII and PstI
  2. 2.Select the left HindIII enzyme cleavage site 6bp+the left 15bp on the carrier skeleton as the left homologous B, and select the right PstI enzyme cleavage site 6bp+the right 15bp on the carrier skeleton as the right homologous B. Add them to the 5 'end of the CER1 cloning primer F/R for primer synthesis. The primer name sequence is as follows:

0800-LUC-CER1-F: TCGACGGTATCGATAAGCTTGGTTCTTCACAAATTATATT (Tm:63)

0800-LUC-CER1-R: AGTGGATCCCCCGGGCTGCAGTGTTATTGTTTTAGAAGG (Tm:69)


  1. 3.Continue the PCR reaction, set the annealing temperature to 62 ℃, the extension time to 1 minute, and other conditions as in process 6; The homologous recombination operation is described in process 11.5. After homologous recombination, transform Escherichia coli in sequence; Coating board; Picking bacteria; Bacterial P; Sequencing; Shaking bacteria; Quality enhancing granules; Transforming Agrobacterium GV3101; Coating board; Picking bacteria; Bacteria P; Protecting bacteria.
Tobacco undergoes genetic transformation

This experiment uses Agrobacterium mediated leaf disc method for genetic transformation of tobacco

  1. 1.Plant sterile tobacco seedlings, take healthy and tender leaves, rinse the leaves to remove surface dust, use a punch to make circular leaf discs with a diameter of about 5-10 millimeters, then soak them in 2% NaClO (sterile distilled Tween 20 ddH2O) and gently shake them on a horizontal shaker to sterilize.
  2. 2.Remove the Agrobacterium previously stored in the -80 ℃ refrigerator, take 100 and add it to liquid LB medium. Incubate overnight at 28 ℃ and 200rpm on a shaker for 16 hours to activate the Agrobacterium, and adjust the OD600 of the bacteria to 0.2-0.3 using infection solution.
  3. 3.Immerse the leaf disc in the prepared Agrobacterium solution for 15 minutes to allow the Agrobacterium to adhere to the wound site. Then remove the leaf disc, absorb excess bacterial liquid, and place it on a co culture medium (without antibiotics). Incubate in the dark at an appropriate temperature for 2-3 days. During this process, Agrobacterium transfers and integrates T-DNA into the genome of tobacco cells.
  4. 4.After 48 hours of dark cultivation at 23 ℃, transfer the leaves to a selected medium (containing kanamycin, 6-BA, NAA, Tim) and continue to observe the cultivation until new shoots grow.
  5. 5.Cut off the callus tissue as much as possible, insert the buds vertically into the rooting medium, with about 3-5 plants per bottle. Continue to cultivate under the conditions of 23 ℃ and light/dark cycle of 16 h/8 h until the root system of the plants develops and matures, and then proceed with seedling refinement.
  6. 6.Clean the culture medium of Nicotiana benthamiana and plant it in a soil mixture of peat soil and vermiculite in a 1:1 ratio. Wrap the plants with plastic film, keep the soil moist and ventilated, at 23 ℃ with a light/dark cycle of 16 h/8 h. After 30 days of cultivation, the transgenic Nicotiana benthamiana plants can be identified.
Identification of positive plants

Number transgenic seedlings and wild-type plants, extract genomic DNA, and use it as a template for PCR identification. Among them, the positive control template used is a vector plasmid with correct sequencing, and the negative control template is wild-type tobacco genomic DNA and sterile water. After gel imaging, determine whether the transgenic plants are positive seedlings according to the size of the bands. Send the PCR products of correctly identified positive plants to a biotech company for sequencing, and determine the editing type based on the sequencing results.

Experimental steps for dual luciferase reporter gene detection system
Agrobacterium infection in tobacco
  1. 1.Add the Agrobacterium that has been transferred into the recombinant plasmid to 1-5ml LB liquid medium containing Rif and Kan, and shake at 28 ℃,200rpm early activation culture;
  2. 2.Add an appropriate amount of activated Agrobacterium tumefaciens to 30ml of LB liquid medium containing Rif and Kan, and shake at 28 ℃on a shaker Incubate at a constant temperature of 200rpm until OD600 reaches 1.0;
  3. 3.Take an appropriate amount of bacterial solution and centrifuge at 4000rpm for 10 minutes at room temperature. Discard the supernatant and resuspend the bacteria using MMG solution or MES solution ,Wait until OD600 reaches 0.8-1.0 for later use;
  4. 4.Mix the recombinant plasmid GENE-PGreenII 62-SK infection solution and PROMOTER-pHreenII 0800-LUC infection solution in a volume ratio of 9:1, and let them stand in the dark at 28 ℃ for at least 3 hours;
  5. 5.Select Nicotiana benthamiana during its vigorous growth period (about a month, without flowering), use a 1ml syringe to aspirate the mixed infection solution, remove the needle, and select leaves in good condition for injection from the back. After treating the infected Nicotiana benthamiana under dark conditions for 12-24 hours, continue to culture under normal day night alternation light for 24-48 hours before sampling.

Attention: Remember to water the tobacco thoroughly the day before infection; When injecting tobacco, it is recommended to use a little force to preserve the circular imprint generated during injection for later sampling; The control and experimental groups were injected on the left and right sides of the same leaf, and attention was paid to avoiding overlapping areas of infection on both sides as much as possible.

Picture 1 Schematic diagram of tobacco injection
Sampling and luciferase activity detection
  1. 1. Sampling: Use a punch to select 1-2 locations near the injection site of Benshi cigarettes, place them in a 2ml centrifuge tube containing steel balls, freeze them in liquid nitrogen, and shake and grind them in a grinder at 30-40Hz for 30 seconds until they are in powder form. Follow the steps of the Genbiyun Tian dual luciferase assay kit (item number RG027/RG028) for subsequent operations.
  2. 2.Add 200-300 μ l of cell lysate and shake well. Centrifuge at room temperature at 15000 × g for 5 minutes, and transfer the supernatant to a new 1.5ml centrifuge tube. The supernatant can be directly used for subsequent testing. If it cannot be measured in a timely manner, it can be stored at -20 ℃ for one month until further testing. The frozen sample needs to be thawed and restored to room temperature before measurement.
  3. 3.Prepare reagents

Dissolve the firefly luciferase detection reagent and sea kidney luciferase detection buffer in advance and allow them to reach room temperature; The substrate for detecting sea kidney luciferase (100x) is stored on ice for future use. Sea kidney luciferase detection working solution: Add 1 volume of 100 x sea kidney luciferase detection substrate to 100 times the volume of sea kidney luciferase detection buffer and mix well. Prepare and use immediately. After preparation, wrap it in tin foil and store it in the dark. If there is any remaining detection working solution, it can be stored at -20 ℃ for one week, but the detection effect will decrease with prolonged storage time. Therefore, it cannot be prepared into a working solution and stored for a long time.

  1. 4. Add 100 μ l of the test sample to the enzyme-linked immunosorbent assay (ELISA) plate and mix it evenly with 100 μ l of firefly luciferase detection reagent. Then, measure the firefly luciferase activity in the ELISA reader to obtain the LUC value; After the measurement is completed, add 100 μ l of sea kidney luciferase detection working solution and mix it evenly. Measure the sea kidney luciferase and obtain the REN value; Record data.

(Choosing a white opaque plate for the enzyme-linked immunosorbent assay (ELISA) plate, which can be washed and dried before reuse. Set 6-10 replicates for each sample group. After measuring the control and experimental groups of one sample group, proceed to measure the next set of data.)

Instrumentation

This experiment used the DEVICES multifunctional enzyme-linked immunosorbent assay (ELISA) reader. After opening the SoftMax pro 6.5.1 software, select "Settings" in the Plate Tools menu at the top to set the software parameters. After completing the software parameter settings, prepare the test samples.

The relevant settings are as follows:

Optical Configuration: Select Monochromator

Read Modes: Select LUM, chemiluminescence

Read Type: Select Endpoint, endpoint method detection, which obtains the sample detection value at a single time point

Category dropdown menu:

Wavelength：All Wavelengths

Plate Type Settings: Select 96 Wells from the drop-down menu for Plate Format

Select Specific: 96 Well Standard opaque

Read Area Settings: Select the area where the test sample has been added

PMT and Optics Settings: 1000-5000ms (Biyun Tian Kit)

Shake Settings: Optional pre detection oscillation mixing (optional)

More Settings: Select Row from the dropdown menu for Read Order

Data processing

Based on the real-time fluorescence intensity values of LUC and REN, calculate the LUC/REN ratio to compare the activation level of target reporter genes among different samples, and conduct subsequent data analysis.

Analysis of wax content and composition
  1. 1. Select healthy and mature tobacco leaves. Place the leaves in a test tube containing 20 ml of chloroform at room temperature
  2. 2. Soak for 1 minute, then transfer to a new test tube containing 30 ml chloroform at 60 ℃ and soak for 2 minutes.
  3. 3. Then remove the leaves and mix the two chloroform extracts. And add 30 μ g of heptane standard sample, dry and concentrate in a nitrogen dryer until the dissolved substance is slightly wet.
  4. 4. Add 100 to the test tube μl N,O-bis（trimethylsilyl）trifluoroacetamide）:trimethylchlorosilane（99:1） Derive the reagent and seal it, then incubate in an oven at 115 ℃ for 30 minutes.
  5. 5. Dry the remaining residue in a nitrogen blow dryer, dissolve the extract in 500 μ l of hexane, and transfer it to an injection bottle for storage.
  6. 6. The wax content and composition of leaves were determined using gas chromatography-mass spectrometry (GC-MS) analysis method. The initial setting of the instrument is to maintain the temperature of the mass spectrometer detector at 280 ℃, the injection port temperature at 260 ℃, and the power supply voltage at 70eV. Siphon injection was performed through a 30 m × 0.25 mm HP-5 column, with high-purity helium gas as the carrier gas at a constant flow rate of 1.0 mL/min, without splitting the injection. The measurement procedure is to set the initial temperature of the capillary column at 60 ℃, then raise it to 200 ℃ at a rate of 20 ℃/min and maintain it for 2 minutes, and then raise it to 280 ℃ at a rate of 5 ℃/min and maintain it for 8 minutes, using ion selective mode for measurement.


Lighting treatment (core step): Randomly divide etiolated seedlings into six experimental groups. Set up a dark chamber (L = 0) and five or more different light intensity (L) treatments: 15 × 10⁴, 20 × 10⁴, 25 × 10⁴, 30 × 10⁴, and 35 × 10⁴ Lx/m². Simultaneously move all groups (including the dark chamber) into a lighted incubator and maintain the same temperature (22°C) and bulb on time (1 week). Ensure that all other conditions, except bulb intensity, remain identical.