Epidermal wax is a hydrophobic barrier formed by plants during evolution to adapt to complex and changing growth environments. It is a general term for a series of organic compounds that are easily soluble in organic solvents. The main function of epidermal wax is to reduce the loss of non stomatal water from plant epidermis, improve drought resistance, and also prevent UV damage, reduce the deposition of air pollutants, and resist pests and diseases. Therefore, plant epidermal wax has important practical significance in stress resistant breeding, pest control, and other aspects. Alkanes are the main products of the decarbonylation pathway during wax formation and are one of the important components in plant cuticle wax, accounting for about 80% of all wax components. Therefore, we can explore the key pathways controlling the synthesis of alkane wax, modify them to increase wax content, thereby enhancing plant resistance and providing abundant raw materials for the industrial field.

CER1 belongs to Fatty acid hydroxylase superfamily, FAH. It belongs to a complex of alkane synthesis and can convert acyl CoA into alkanes. It plays an important role in the biosynthesis of VLC alkanes.

After domain prediction, we found that NbCER1 has a FA hydroxylase domain（Position:94 to 271），Their molecular structure contains two HXHH motifs，belonging to membrane integration protein.These enzymes are involved in the biosynthesis of cholesterol and the generation of plant cuticle wax.Additionally, it has an uncharacterized Wax2-C domain（Position:450 to 612），having a conservative LEGW sequence motif.This domain is approximately 170 amino acids long，usually associated with certain specific protein complexes.It has a certain similarity in structure with short chain dehydrogenases.

Protein three-dimensional structure prediction discovery：FA-hydroxylase, the structural domain is located on the endoplasmic reticulum membrane, which is consistent with its wax synthesis function.

The promoter region of CER1 gene in Nicotiana benthamiana plants.

The CER1 gene promoter region is a region composed of multiple functional elements that provide binding sites for various proteins, primarily transcription factors.

the core promoter of CER1 gene (especially the TATA box and promoter) ensures that RNA polymerase II starts transcription at the correct DNA position,this is the first step in producing functional mRNA.The core promoter and proximal regulatory elements (such as CAAT and GC frames) jointly determine the "basal" expression level of genes in the absence of specific stimuli, and can also maintain sustained and stable low-level expression of genes. The promoter region can also respond to internal and external signals (controllability). Cells need to precisely control gene expression and determine the spatiotemporal specificity of gene expression based on developmental stages, environmental changes, hormone levels, stress responses, etc.

Light, as a key environmental factor, regulates multiple important processes throughout the plant life cycle, including seed germination, seedling morphogenesis, organ development, and reproductive processes. Light signals trigger complex signal network regulation in plants through the perception and transduction of different light receptors, thereby integrating hormone balance and metabolic activities to coordinate growth and development. It is worth noting that the light environment also plays an important regulatory role in resisting pathogen infection by affecting plant immune response mechanisms.

The core transcription factor (HY5) of the plant light signal transduction pathway belongs to the alkaline leucine zipper bZIP transcription factor family, and its protein structure exhibits obvious modular characteristics. This protein consists of two functional regions:

The N-terminus contains a dynamic disordered region, in which the 77th amino acid undergoes conformational changes under specific light conditions, forming a soluble spherical structure that can be recognized by E3 ubiquitin ligase (COP1), thereby mediating the ubiquitination degradation of HY5.The basic domain composed of 78-110 amino acids plays a crucial role in directly binding to the promoter region of the target gene. The C-end contains a typical coiled coil leucine zipper structural module.This domain can form dimers with other bZIP family members through hydrophobic interactions in the leucine zipper region. This dimerization is not only a necessary prerequisite for HY5 to bind to DNA, but also the structural basis for its transcriptional activation function.

Prediction of NbHY5 protein structure reveals that HY5 contains a BRLZ domain（Position:85 to 149），defined as basic region leucin zipper.The alkaline leucine zipper (bZIP) domain transcription factor is a protein that contains an alkaline region responsible for sequence specific DNA binding, followed by a leucine zipper region crucial for dimerization.

In order to knock out the key wax synthesis gene CER1 in Nicotiana benthamiana, we designed and constructed a modular CRISPR-Cas9 system.We have created two high-quality gRNA expression units and successfully cloned them into CRISPR vectors. These components follow the BioBrick standard and have high reusability. In the future, any team can easily replace the spacer sequence of gRNA to target any other gene for plant genetic editing.

pCBC-DT1T2 is an intermediate entry vector used for gRNA cloning in the CRISPR-Cas9 system. It is specifically designed for Golden Gate assembly and contains two BsaI cleavage sites for rapid, efficient, and unidirectional cloning of gRNA spacer sequences. This vector contains the chloramphenicol resistance gene for prokaryotic screening.

The carrier is a functional particle with core features including:

• Chloramphenicol resistance gene (ChlR): used for screening in Escherichia coli.
• BsaI enzyme cleavage site: flanking the cloning site, with pre-defined overhangs T1 and T2.
• gRNA scaffold skeleton: The downstream of the cloning site contains a complete gRNA backbone sequence.

The function of this carrier is to serve as a modular cloning tool.Researchers can clone double stranded DNA oligos containing the target spacer sequence (with protruding ends complementary to T1/T2 at both ends) into the vector through a Golden Gate reaction (BsaI endonuclease/ligase), thereby rapidly constructing a complete gRNA expression unit. Subsequently, this unit can be cleaved again and assembled into the final plant CRISPR vector.

Open source tool: Although the vector was originally developed by academic laboratories such as Davidson Lab, we successfully applied it to the gene editing workflow of Nicotiana benthamiana and verified its effectiveness and reliability.

Standardized workflow: We optimized and standardized the complete process of gRNA cloning using this vector, including primer design, annealing, and Golden Gate reaction conditions.

The final gRNA components we submitted (such as BBa_K4761101) were constructed using this carrier as an intermediate tool. In the future, any iGEM team that wants to build plant gRNAs can reuse the efficient technology path we have validated.

pKSE402 is a binary vector used for CRISPR-Cas9-mediated gene knockout in plants. This carrier is based on the classic pCAMBIA skeleton,Contains Cas9 nucleases optimized for plant codons and a single gRNA expression unit.It can be delivered to plant cells through Agrobacterium mediated transformation, achieving specific targeted editing of target genes. This component is the core tool for us to successfully knock out the NbCER1 gene in Nicotiana benthamiana.

Collected multiple expression elements:

Promoter: CaMV 35S promoter，Strong constitutive promoter,Drive the sustained high-level expression of Cas9 gene in plant cells.

Encoding sequence: SpCas9，Optimized plant codons to improve translation efficiency in plants.

Terminate the child: CaMV poly(A) signal，Provide transcription termination signals.

Promoter: U6-26p (Arabidopsis thaliana U6-26 promoter)，A RNA polymerase III promoter for precise initiation of gRNA transcription.

Cloning site: a pair of BbsI enzyme cleavage sites used for rapid cloning of a target spacer sequence composed of a pair of annealed oligos.

gRNA scaffold: Guide the universal skeleton sequence of RNA to bind with Cas9 protein.

Termination sub:U6-26t (Arabidopsis thaliana U6-26 terminator)，Provide termination signals for gRNA transcription.

Plant screening: Bar gene ( Phosphinothricin Acetyltransferase)，Endow genetically modified plants with resistance to glyphosate. Driven by plant promoters.

Bacterial screening: Kanamycin Resistance (KanR)，Used for screening clones containing this plasmid in Escherichia coli and Agrobacterium.

• This vector is a self-contained gene editing system. After transformation into plant cells through Agrobacterium:
• The P35S promoter drives the expression of SpCas9 gene and produces Cas9 protein.
• The U6-26p promoter drives gRNA expression and generates guide RNA targeting the target gene.
• Cas9 protein assembles with gRNA to form a ribonucleoprotein complex.
• The complex scans the genome within the nucleus and binds to the target DNA site through the spacer sequence of gRNA.
• The Cas9 protein undergoes double strand breaks at the target site.
• Cells use a non homologous end effector repair mechanism that is prone to errors to repair breaks, thereby introducing insertion or deletion mutations at the target site and achieving gene knockout.

Functional verification:We successfully used this vector to infiltrate Nicotiana benthamiana with Agrobacterium tumefaciens, and through sequencing verification, achieved efficient editing at the NbCER1 gene locus, demonstrating the effectiveness of the vector in plants.

Standardized workflow: We optimized and documented the complete process of cloning custom gRNA spacers into this vector using BbsI enzyme digestion and ligation, providing a reproducible solution for future teams.

Reusability and modularity:The core value of this carrier lies in its modular design. In the future, any iGEM team only needs to synthesize a new pair of spacer oligos (targeting any other gene), and can quickly construct new plant CRISPR knockout tools using this universal vector without rebuilding the entire Cas9 system.

This is a complete gRNA expression unit consisting of a U6-26 terminator, a 20nt spacer sequence targeting the first exon of the NbCER1 gene, and a gRNA scaffold added to another site of the NbCER1 gene targeting the U6-29 promoter.

Target 1+ gRNA scaffold + U6-26 terminator+U6-29 promoter+Target 2

Transcription of gRNA in tobacco cells guides the cleavage of specific positions (Target 1 and Target 2) of the Cas9 protein NbCER1 gene, resulting in double strand breaks.

Plasmid

A binary vector for transient expression analysis in plants. This vector contains a firefly luciferase reporter gene with multiple cloning sites upstream, which can be used to insert the promoter to be studied

MCS➡ LUC: Multiple cloning sites are used to clone target promoters and drive firefly luciferase reporter genes.

Plant screening markers（Kanamycin Resistance）。

Spectamycin resistance is used for screening in Escherichia coli; Tetracycline resistance is used for screening in Agrobacterium.

Used for studying promoter activity. After cloning the test promoter into MCS, the plant can be infiltrated with Agrobacterium and the luciferase activity can be detected to reflect the strength of the promoter and its response to transcription factors.

We have verified the reliability of this vector in the transient expression system of Nicotiana benthamiana and successfully resolved the function of the CER1 promoter using it.

Plasmid

A binary vector for overexpression of target genes (effectors) in plants. This vector contains a strong promoter that drives the insertion of the target gene at multiple cloning sites.

P35S➡ MCS:The strong CaMV 35S promoter is used to drive high-level expression of target genes (such as transcription factors) cloned in MCS.

Plant/Bacterial Selection: Familiar with the pGreenII 0800-LUC

Used to express transcription factors, enzymes, or any other functional proteins. Co infiltration with the reporting vector can be used to study the regulatory effects of transcription factors on reporter genes.

We over-expressed the HY5 transcription factor in Nicotiana benthamiana using this vector and validated its function.

A part of the binary vector pKSE402 used for plant transgenics, its core function is to serve as a key recognition site for the VirD2/VirD1 enzyme complex, initiating the cleavage of T-DNA from the vector plasmid, acting as a "molecular signal" for the cleavage of T-DNA from the vector, and guiding the transfer of T-DNA to the plant nucleus.

taaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgatccaagctcaagctgctctagcattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttcgacttgccttccgcacaatacatcatttcttcttagctttttttcttcttcttcgttcatacagtttttttttgtttatcagcttacattttcttgaaccgtagctttcgttttcttctttttaactttccattcggagtttttgtatcttgtttcatagtttgtcccaggattagaatgattaggcatcgaaccttcaagaatttgattgaataaaacatcttcattcttaagatatgaagataatcttcaaaaggcccctgggaatctgaaagaagagaagcaggcccatttatatgggaaagaacaatagtatttcttatataggcccatttaagttgaaaacaatcttcaaaagtcccacatcgcttagataagaaaacgaagctgagtttatatacagctagagtcgaagtagtgattgggagacc

A partial sequence was obtained by cleaving the binary vector pKSE402 at the BsaI site, mainly including the RB T-DNA repeat sequence and the BsaI enzyme cleavage site used for recombination recognition. When Agrobacterium perceives the signaling molecules produced by plant injury, such as acetyl eugenol, the vir gene on its chromosome is activated. VirD1 and VirD2 proteins form a complex that specifically recognizes and binds to the boundary sequences at both ends of T-DNA (LB left boundary and RB right boundary). The VirD2 protein has endonuclease activity and cleaves specific positions in the RB and LB sequences, releasing single stranded T-DNA (known as T-strands) from the vector and guiding the transfer of T-DNA to the plant nucleus.

In the PKSE402 vector, all sequences located between RB and LB (such as your target gene, screening marker gene, etc.) will be transferred to the plant. The skeletal sequences of carriers outside of RB will not be transferred.

The core component of a binary vector pKSE402 used for plant transgenics, which enables pKSE402 to play a key role in gene knockout function. Containing Cas9 nucleases optimized for plant codons and a single gRNA expression unit, the fundamental function of the Cas9 protein is to precisely cleave DNA double strands at specific locations in the genome. This kind of cleavage triggers the cell's own DNA repair mechanism, and it is precisely through this repair process that we can achieve gene knockout.

ggtctcggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttttgcaaaattttccagatcgatttcttcttcctctgttcttcggcgttcaatttctggggttttctcttcgttttctgtaactgaaacctaaaatttgacctaaaaaaaatctcaaataatatgattcagtggttttgtacttttcagttagttgagttttgcagttccgatgagataaaccaataagcttgcatgcaaaaaagtcaacatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgataacatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagaggacctcgacctcaacacaacatatacaaaacaaacgaatctcaagcaatcaagcattctacttctattgcagcaatttaaatcatttcttttaaagcaaaagcaattttctgaaaattttcaccatttacgaacgatactcgagtaatttttttggattacaaggaccacgacggggattacaaggaccacgacattgattacaaggatgatgatgacaagatggctccgaagaagaagaggaaggttggcatccacggggtgccagctgctgacaagaagtactcgatcggcctcgatattgggactaactctgttggctgggccgtgatcaccgacgagtacaaggtgccctcaaagaagttcaaggtcctgggcaacaccgatcggcattccatcaagaagaatctcattggcgctctcctgttcgacagcggcgagacggctgaggctacgcggctcaagcgcaccgcccgcaggcggtacacgcgcaggaagaatcgcatctgctacaaaaaagagattttctccaacgagatggcgaaggttgacgattctttcttccacaggctggaggagtcattcctcgtggaggaggataagaagcacgagcggcatccaatcttcggcaacattgtcgacgaggttgcctaccacgagaagtaccctacgatctaccatctgcggaagaagctcgtggactccacagataaggcggacctccgcctgatctacctcgctctggcccacatgattaagttcaggggccatttcctgatcgagggggatctcaacccggacaatagcgatgttgacaagctgttcatccagctcgtgcagacgtacaaccagctcttcgaggagaaccccattaatgcgtcaggcgtcgacgcgaaggctatcctgtccgctaggctctcgaagtctcggcgcctcgagaacctgatcgcccagctgccgggcgagaagaagaacggcctgttcgggaatctcattgcgctcagcctggggctcacgcccaacttcaagtcgaatttcgatctcgctgaggacgccaagaaaaaactctccaaggacacatacgacgatgacctggataacctcctggcccagatcggcgatcagtacgcggacctgttcctcgctgccaagaatctgtcggacgccatcctcctgtctgatattctcagggtgaacaccgagattacgaaggctccgctctcagcctccatgatcaagcgctacgacgagcaccatcaggatctgaccctcctgaaggcgctggtcaggcagcagctccccgagaagtacaaggagatcttcttcgatcagtcgaagaacggctacgctgggtacattgacggcggggcctctcaggaggagttctacaagttcatcaagccgattctggagaagatggacggcacggaggagctgctggtgaagctcaatcgcgaggacctcctgaggaagcagcggacattcgataacggcagcatcccacaccagattcatctcggggagctgcacgctatcctgaggaggcaggaggacttctaccctttcctcaaggataaccgcgagaagatcgagaagattctgactttcaggatcccgtactacgtcggcccactcgctaggggcaactcccgcttcgcttggatgacccgcaagtcagaggagacgatcacgccgtggaacttcgaggaggtggtcgacaagggcgctagcgctcagtcgttcatcgagaggatgacgaatttcgacaagaacctgccaaatgagaaggtgctccctaagcactcgctcctgtacgagtacttcacagtctacaacgagctgactaaggtgaagtatgtgaccgagggcatgaggaagccggctttcctgtctggggagcagaagaaggccatcgtggacctcctgttcaagaccaaccggaaggtcacggttaagcagctcaaggaggactacttcaagaagattgagtgcttcgattcggtcgagatctctggcgttgaggaccgcttcaacgcctccctggggacctaccacgatctcctgaagatcattaaggataaggacttcctggacaacgaggagaatgaggatatcctcgaggacattgtgctgacactcactctgttcgaggaccgggagatgatcgaggagcgcctgaagacttacgcccatctcttcgatgacaaggtcatgaagcagctcaagaggaggaggtacaccggctgggggaggctgagcaggaagctcatcaacggcattcgggacaagcagtccgggaagacgatcctcgacttcctgaagagcgatggcttcgcgaaccgcaatttcatgcagctgattcacgatgacagcctcacattcaaggaggatatccagaaggctcaggtgagcggccagggggactcgctgcacgagcatatcgcgaacctcgctggctcgccagctatcaagaaggggattaaaaaaaccgtgaaggttgtggacgagctggtgaaggtcatgggcaggcacaagcctgagaacatcgtcattgagatggcccgggagaatcagaccacgcagaagggccagaagaactcacgcgagaggatgaagaggatcgaggagggcattaaggagctggggtcccagatcctcaaggagcacccggtggagaacacgcagaaaaaaaatgagaagctctacctgtactacctccagaatggccgcgatatgtatgtggaccaggagctggatattaacaggctcagcgattacgacgtcgatcatatcgttccacagtcattcctgaaggatgactccattgacaacaaggtcctcaccaggtcggacaagaaccggggcaagtctgataatgttccttcagaggaggtcgttaagaagatgaagaactactggcgccagctcctgaatgccaagctgatcacgcagcggaagttcgataacctcacaaaggctgagaggggcgggctctctgagctggacaaggcgggcttcatcaagaggcagctggtcgagacacggcagatcactaagcacgttgcgcagattctcgactcacggatgaacactaagtacgatgagaatgacaagctgatccgcgaggtgaaggtcatcaccctgaagtcaaagctcgtctccgacttcaggaaggatttccagttctacaaggttcgggagatcaacaattaccaccatgcccatgacgcgtacctgaacgcggtggtcggcacagctctgatcaagaagtacccaaagctcgagagcgagttcgtgtacggggactacaaggtttacgatgtgaggaagatgatcgccaagtcggagcaggagattggcaaggctaccgccaagtacttcttctactctaacattatgaatttcttcaagacagagatcactctggccaatggcgagatccggaagcgccccctcatcgagacgaacggcgagacgggggagatcgtgtgggacaagggcagggatttcgcgaccgtcaggaaggttctctccatgccacaagtgaatatcgtcaagaagacagaggtccagactggcgggttctctaaggagtcaattctgcctaagcggaacagcgacaagctcatcgcccgcaagaaggactgggatccgaagaagtacggcgggttcgacagccccactgtggcctactcggtcctggttgtggcgaaggttgagaagggcaagtccaagaagctcaagagcgtgaaggagctgctggggatcacgattatggagcgctccagcttcgagaagaacccgatcgatttcctggaggcgaagggctacaaggaggtgaagaaggacctgatcattaagctccccaagtactcactcttcgagctggagaacggcaggaagcggatgctggcttccgctggcgagaaaaaaaaggggaacgagctggctctgccgtccaagtatgtgaacttcctctacctggcctcccactacgagaagctcaagggcagccccgaggacaacgagcagaagcagctgttcgtcgagcagcacaagcattacctcgacgagatcattgagcagatttccgagttctccaagcgcgtgatcctggccgacgcgaatctggataaggtcctctccgcgtacaacaagcaccgcgacaagccaatcagggagcaggctgagaatatcattcatctcttcaccctgacgaacctcggcgcccctgctgctttcaagtacttcgacacaactatcgatcgcaagaggtacacaagcactaaggaggtcctggacgcgaccctcatccaccagtcgattaccggcctctacgagacgcgcatcgacctgtctcagctcgggggcgacaagcggccagcggcgacgaagaaggcggggcaggcgaagaagaagaagtgagctcagagctttcgttcgtatcatcggtttcgacaacgttcgtcaagttcaatgcatcagtttcattgcgcacacaccagaatcctactgagtttgagtattatggcattgggaaaactgtttttcttgtaccatttgttgtgcttgtaatttactgtgttttttattcggttttcgctatcgaactgtgaaatggaaatggatggagaagagttaatgaatgatatggtccttttgttcattctcaaattaatattatttgttttttctcttatttgttgtgtgttgaatttgaaattataagagatatgcaaacattttgttttgagtaaaaatgtgtcaaatcgtggcctctaatgaccgaagttaatatgaggagtaaaacacttgtagttgtaccattatgcttattcactaggcaacaaatatattttcagacctagaaaagctgcaaatgttactgaatacaagtatgtcctcttgtgttttagacatttatgaactttcctttatgtaattttccagaatccttgtcagattctaatcattgctttataattatagttatactcatggatttgtagttgagtatgaaaatattttttaatgcattttatgacttgccaattgattgacaacaaaaaagtaatcatgtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattggctagagcagcttgccaacatggtggagcacgacactctcgtctactccaagaatatcaaagatacagtctcagaagaccaaagggctattgagacttttcaacaaagggtaatatcgggaaacctcctcggattccattgcccagctatctgtcacttcatcaaaaggacagtagaaaaggaaggtggcacctacaaatgccatcattgcgataaaggaaaggctatcgttcaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgaacatggtggagcacgacactctcgtctactccaagaatatcaaagatacagtctcagaagaccaaagggctattgagacttttcaacaaagggtaatatcgggaaacctcctcggattccattgcccagctatctgtcacttcatcaaaaggacagtagaaaaggaaggtggcacctacaaatgccatcattgcgataaaggaaaggctatcgttcaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagaggacacgctgaaatcaccagtctctctctacaaatctatctctctcgagctttcgcagatctgtcgatcgaccatggggattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgtttcggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactccaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacacatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcggatcgatcctctagctagagtcgatcgacaagctcgagtttctccataataatgtgtgagtagttcccagataagggaattagggttcctatagggtttcgctcatgtgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtactaaaatccagatcccccgaattaattcggcgttaattcagtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccgggacggcgtcagcgggagagccgttgtaaggcggcagactttgctcatgttaccgatgctattcggaagaacggcaactaagctgccgggtttgaaacacggatgatctcgcggagggtagcatgttgattgtaacgatgacagagcgttgctgcctgtgatcaccgcggtttcaaaatcggctccgtcgatactatgttatacgccaactttgaaaacaactttgaaaaagctgttttctggtatttaaggttttagaatgcaaggaacagtgaattggagttcgtcttgttataattagcttcttggggtatctttaaatactgtagaaaagaggaaggaaataataaatggctaaaatgagaatatcaccggaattgaaaaaactgatcgaaaaataccgctgcgtaaaagatacggaaggaatgtctcctgctaaggtatataagctggtgggagaaaatgaaaacctatatttaaaaatgacggacagccggtataaagggaccacctatgatgtggaacgggaaaaggacatgatgctatggctggaaggaaagctgcctgttccaaaggtcctgcactttgaacggcatgatggctggagcaatctgctcatgagtgaggccgatggcgtcctttgctcggaagagtatgaagatgaacaaagccctgaaaagattatcgagctgtatgcggagtgcatcaggctctttcactccatcgacatatcggattgtccctatacgaatagcttagacagccgcttagccgaattggattacttactgaataacgatctggccgatgtggattgcgaaaactgggaagaagacactccatttaaagatccgcgcgagctgtatgattttttaaagacggaaaagcccgaagaggaacttgtcttttcccacggcgacctgggagacagcaacatctttgtgaaagatggcaaagtaagtggctttattgatcttgggagaagcggcagggcggacaagtggtatgacattgccttctgcgtccggtcgatcagggaggatatcggggaagaacagtatgtcgagctattttttgacttactggggatcaagcctgattgggagaaaataaaatattatattttactggatgaattgttttagtacctagaatgcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagggtgccttgatgtgggcgccggcggtcgagtggcgacggcgcggcttgtccgcgccctggtagattgcctggccgtaggccagccatttttgagcggccaaaaaccccgataggccgacgcgaagcggcggggcgtagggagcgcagcgaccgaagggtaggcgctttttgcagctcttcggctgtgcgctggccagacagttatgcacaggccaggcgggttttaagagttttaataagttttaaagagttttaggcggaaaaatcgccttttttctcttttatatcagtcacttacatgtgtgaccggttcccaatgtacggctttgggttcccaatgtacgggttccggttcccaatgtacggctttgggttcccaatgtacgtgctatccacaggaaacagaccttttcgacctttttcccctgctagggcaatttgccctagcatctgctccgtacattaggaaccggcggatgcttcgccctcgatcaggttgcggtagcgcatgactaggatcgggccagcctgccccgcctcctccttcaaatcgtactccggcaggtcatttgacccgatcagcttgcgcacggtgaaacagaacttcttgaactctccggcgctgccactgcgttcgtagatcgtcttgaacaaccatctggcttctgccttgcctgcggcgcggcgtgccaggcggtagagaaaacggccgatgccgggatcgatcaaaaagtaatcggggtgaaccgtcagcacgtccgggttcttgccttctgtgatctcgcggtacatccaatcagctagctcgatctcgatgtactccggccgcccggtttcgctctttacgatcttgtagcggctaatcaaggcttcaccctcggataccgtcaccaggcggccgttcttggccttcttcgtacgctgcatggcaacgtgcgtggtgtttaaccgaatgcaggtttctaccaggtcgtctttctgctttccgccatcggctcgccggcagaacttgagtacgtccgcaacgtgtggacggaacacgcggccgggcttgtctcccttcccttcccggtatcggttcatggattcggttagatgggaaaccgccatcagtaccaggtcgtaatcccacacactggccatgccggccggccctgcggaaacctctacgtgcccgtctggaagctcgtagcggatcacctcgccagctcgtcggtcacgcttcgacagacggaaaacggccacgtccatgatgctgcgactatcgcgggtgcccacgtcatagagcatcggaacgaaaaaatctggttgctcgtcgcccttgggcggcttcctaatcgacggcgcaccggctgccggcggttgccgggattctttgcggattcgatcaaaaaccccttgccacgattcaccggggcgtgcttctgcctcgatgcgttgccgctgggcggcctgcgcggccttcaacttctccaccaggtcatcacccagcgccgcgccgatttgtaccgggccggatggtttgcgaccgctcacgccgattcctcgggcttgggggttccagtgccattgcagggccggcaggcaacccagccgcttacgcctggccaaccgcccgttcctccacacatggggcattccacggcgtcggtgcctggttgttcttgattttccatgccgcctcctttagccgctaaaattcatctactcatttattcatttgctcatttactctggtagctgcgcgatgtattcagatagcagctcggtaatggtcttgccttggcgtaccgcgtacatcttcagcttggtgtgatcctccgccggcaactgaaagttgacccgcttcatggctggcgtgtctgccaggctggccaacgttgcagccttgctgctgcgtgcgctcggacggccggcacttagcgtgtttgtgcttttgctcattttctctttacctcattaactcaaatgagttttgatttaatttcagcggccagcgcctggacctcgcgggcagcgtcgccctcgggttctgattcaagaacggttgtgccggcggcggcagtgcctgggtagctcacgcgctgcgtgatacgggactcaagaatgggcagctcgtacccggccagcgcctcggcaacctcaccgccgatgcgcgtgcctttgatcgcccgcgacacgacaaaggccgcttgtagccttccatccgtgacctcaatgcgctgcttaaccagctccaccaggtcggcggtggcccatatgtcgtaagggcttggctgcaccggaatcagcacgaagtcggctgccttgatcgcggacacagccaagtccgccgcctggggcgctccgtcgatcactacgaagtcgcgccggccgatggccttcacgtcgcggtcaatcgtcgggcggtcgatgccgacaacggttagcggttgatcttcccgcacggccgcccaatcgcgggcactgccctggggatcggaatcgactaacagaacatcggccccggcgagttgcagggcgcgggctagatgggttgcgatggtcgtcttgcctgacccgcctttctggttaagtacagcgataaccttcatgcgttccccttgcgtatttgtttatttactcatcgcatcatatacgcagcgaccgcatgacgcaagctgttttactcaaatacacatcacctttttagacggcggcgctcggtttcttcagcggccaagctggccggccaggccgccagcttggcatcagacaaaccggccaggatttcatgcagccgcacggttgagacgtgcgcgggcggctcgaacacgtacccggccgcgatcatctccgcctcgatctcttcggtaatgaaaaacggttcgtcctggccgtcctggtgcggtttcatgcttgttcctcttggcgttcattctcgaaaacccccagggcgtcggcctcggtcaatgcgtcctcacggaaggcaccgcgccgcctggcctcggtgggcgtcacttcctcgctgcgctcaagtgcgcggtacagggtcgagcgatgcacgccaagcagtgcagccgcctctttcacggtgcggccttcctggtcgatcagctcgcgggcgtgcgcgatctgtgccggggtgagggtagggcgggggccaaacttcacgcctcgggccttggcggcctcgcgcccgctccgggtgcggtcgatgattagggaacgctcgaactcggcaatgccggcgaacacggtcaacaccatgcggccggccggcgtggtggtgtcggcccacggctctgccaggctacgcaggcccgcgccggcctcctggatgcgctcggcaatgtccagtaggtcgcgggtgctgcgggccaggcggtctagcctggtcactgtcacaacgtcgccagggcgtaggtggtcaagcatcctggccagctccgggcggtcgcgcctggtgccggtgatcttctcggaaaacagcttggtgcagccggccgcgtgcagttcggcccgttggttggtcaagtcctggtcgtcggtgctgacgcgggcatagcccagcaggccagcggcggcgctcttgttcatggcgtaatgtctccggttctagtcgcaagtattctactttatgcgactaaaacacgcgacaagaaaacgccaggaaaagggcagggcggcagcctgtcgcgtaacttaggacttgtgcgacatgtcgttttcagaagacggctgcactgaacgtcagaagccgactgcactatagcagcggaggggttggatcaaagtactttgatcccgaggggaaccctgtggttggcatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgattattctaa

PSKE402-R includes the core Cas9 protein and CaMV strong promoter. Under the guidance of guide RNA, the Cas9 protein can accurately locate specific target sequences on the genome and cut DNA double strands like scissors. The CaMV promoter is a constitutive strong promoter. Composition type means that it continues to work actively in almost all tissues and developmental stages of plants. Just like a building with an always on main power switch. A strong promoter means it can efficiently initiate gene transcription, produce a large amount of mRNA, and translate a large amount of protein.

• CER1 is connected to the intermediate carrier pCBC-DT1T2
• pKSE402-CRISPR_CER1 recombinant plasmid vector construction successful
• CRISPR_CER1 PCR Amplification Gel Electrophoresis Results
• pKSE402-CRISPR_CER1 Plasmid Transformation of Agrobacterium Teralis Competent Cells GV3101
• Obtaining CER1 loss-of-function mutants

A plasmid skeleton containing the Luc reporter gene, abbreviated as luciferase, was obtained by cleaving the pGreenII 0800-LUC plasmid vector using HindIII endonuclease. It originates from organisms such as fireflies and can catalyze the oxidation reaction of substrate fluorescein, emitting bioluminescence that is invisible to the naked eye but detectable by instruments.

TTTTTATCCCCGGAAGCCTGTGGATAGAGGGTAGTTATCCACGTGAAACCGCTAATGCCCCGCAAAGCCTTGATTCACGGGGCTTTCCGGCCCGCTCCAAAAACTATCCACGTGAAATCGCTAATCAGGGTACGTGAAATCGCTAATCGGAGTACGTGAAATCGCTAATAAGGTCACGTGAAATCGCTAATCAAAAAGGCACGTGAGAACGCTAATAGCCCTTTCAGATCAACAGCTTGCAAACACCCCTCGCTCCGGCAAGTAGTTACAGCAAGTAGTATGTTCAATTAGCTTTTCAATTATGAATATATATATCAATTATTGGTCGCCCTTGGCTTGTGGACAATGCGCTACGCGCACCGGCTCCGCCCGTGGACAACCGCAAGCGGTTGCCCACCGTCGAGCGCCTTTGCCCACAACCCGGCGGCCGGCCGCAACAGATCGTTTTATAAATTTTTTTTTTTGAAAAAGAAAAAGCCCGAAAGGCGGCAACCTCTCGGGCTTCTGGATTTCCGATCCCCGGAATTAGATCTTGGCAGGATATATTGTGGTGTAACGTTATCGTACCCCTACTCCAAAAATGTCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATTTCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCGAAAGGACAGTAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCATTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGCCCAAGCTCTAGCCACCATGACTTCGAAAGTTTATGATCCAGAACAAAGGAAACGGATGATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGGCCTGATATTGAAGAAGATATTGCGTTGATCAAATCTGAAGAAGGAGAAAAAATGGTTTTGGAGAATAACTTCTTCGTGGAAACCATGTTGCCATCAAAAATCATGAGAAAGTTAGAACCAGAAGAATTTGCAGCATATCTTGAACCATTCAAAGAGAAAGGTGAAGTTCGTCGTCCAACATTATCATGGCCTCGTGAAATCCCGTTAGTAAAAGGTGGTAAACCTGACGTTGTACAAATTGTTAGGAATTATAATGCTTATCTACGTGCAAGTGATGATTTACCAAAAATGTTTATTGAATCGGACCCAGGATTCTTTTCCAATGCTATTGTTGAAGGTGCCAAGAAGTTTCCTAATACTGAATTTGTCAAAGTAAAAGGTCTTCATTTTTCGCAAGAAGATGCACCTGATGAAATGGGAAAATATATCAAATCGTTCGTTGAGCGAGTTCTCAAAAATGAACAATAATTCTAGGGTACGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAATAATGTGTGAGTAGTTTCCCGATAAGGGAAATTAGGGTTCTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATCGATAACATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTT

A sequence containing the Rluc reporter gene and CaMV 35S promoter as core elements was obtained by cutting the pGreenII 0800-LUC vector with the endonuclease HindIII.

Placing the Luc reporter gene downstream of a promoter (the "switch" that controls gene activation) to be studied, if this promoter is activated (for example, by a certain drug, hormone, or transcription factor), it will initiate the transcription and translation of downstream Luc genes, and the cell will produce luciferase. After adding a luciferase substrate, cells with luciferase will emit light, and the intensity of the luminescence directly reflects the activity of the promoter.

Using HindIII endonuclease to cleave the pGreenII 0800-LUC plasmid vector, a segment containing the luciferase gene and Kana screening resistance plasmid skeleton was obtained. Together with pGreenII 0800-LUC-F, a complete pGreenII 0800-LUC plasmid vector was constructed. A promoter sequence to be studied (possibly the promoter of a certain gene or an artificially synthesized response element) was connected upstream of the luciferase gene to detect whether certain genes or proteins could bind to the promoter.

GTGCAGGGGGGGATCCGGGGGGTTTTTTAAAAAAAACACCGCGGTGGAGATCAAAAAACATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGCTGTTTCTGAGGAGCCTTCAGGATTACAAGATTCAAAGTGCGCTGCTGGTGCCAACCCTATTCTCCTTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATTGCTTCTGGTGGCGCTCCCCTCTCTAAGGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCTGCCAGGTATCAGGCAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACACTTCTTCATCGTTGACCGCCTGAAGTCTCTGATTAAGTACAAAGGCTATCAGGTGGCTCCCGCTGAATTGGAATCCATCTTGCTCCAACACCCCAACATCTTCGACGCAGGTGTCGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAATTTTTTTAAAAAAGGTACGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAATAATGTGTGAGTAGTTTCCCGATAAGGGAAATTAGGGTTCTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATCCACTAGCCTTGACAGGATATATTGGCGGGTAAACTAAGTCGCTGTATGTGTTTGTTTGAGATCTCATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAGAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGTGTAACATTGGTCTAGTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCTGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGGTAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTTGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCTTCCCGACAACGCAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGTCCACCTACAACAAAGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGATGGGGCGATTCAGGCGATCCCCATCCAACAGCCCGCCGTCGAGCGGGCT

By cleaving the pGreenII 0800-LUC vector with HindIII and PstI endonucleases, a sequence containing the luciferase gene and Kana resistance structure as core elements was obtained, exposing a PstI binding site at the front end of the sequence.

The Luciferase reporter gene system is a reporting system that uses luciferin as a substrate to detect firefly luciferase activity. Luciferase can catalyze the oxidation of luciferin to oxyluciferin, and during the process of luciferin oxidation, bioluminescence is emitted. Then, the biological fluorescence released during the oxidation of luciferin can be measured using a fluorescence analyzer, also known as a chemiluminescence analyzer or a liquid scintillation analyzer. The bioluminescence system of luciferin and luciferase can detect gene expression extremely sensitively and efficiently. It is a detection method for detecting the interaction between transcription factors and target gene promoter DNA.

A plasmid skeleton containing CaMV 35S promoter was obtained by cutting the pGreenII 62sk plasmid vector with PstI and HindIII endonucleases. In the pGreen62-SK map, the CaMV 35S promoter is located upstream of the multi cloning site. After cloning the target gene (such as an insect resistant gene Bt or a reporter gene GUS/GFP) into the multi cloning site of pGreen62-SK, the CaMV 35S promoter becomes the "switch" for this newly constructed gene.

TTTTTATCCCCGGAAGCCTGTGGATAGAGGGTAGTTATCCACGTGAAACCGCTAATGCCCCGCAAAGCCTTGATTCACGGGGCTTTCCGGCCCGCTCCAAAAACTATCCACGTGAAATCGCTAATCAGGGTACGTGAAATCGCTAATCGGAGTACGTGAAATCGCTAATAAGGTCACGTGAAATCGCTAATCAAAAAGGCACGTGAGAACGCTAATAGCCCTTTCAGATCAACAGCTTGCAAACACCCCTCGCTCCGGCAAGTAGTTACAGCAAGTAGTATGTTCAATTAGCTTTTCAATTATGAATATATATATCAATTATTGGTCGCCCTTGGCTTGTGGACAATGCGCTACGCGCACCGGCTCCGCCCGTGGACAACCGCAAGCGGTTGCCCACCGTCGAGCGCCTTTGCCCACAACCCGGCGGCCGGCCGCAACAGATCGTTTTATAAATTTTTTTTTTTGAAAAAGAAAAAGCCCGAAAGGCGGCAACCTCTCGGGCTTCTGGATTTCCGATCCCCGGAATTAGATCTTGGCAGGATATATTGTGGTGTAACGTTATCAGCTTGGTACGTACCCCTACTCCAAAAATGTCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATTTCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCGAAAGGACAGTAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCATTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGCCCAAGCTGAGCTCCACCGCGGTGAAAACCCCGAATTTGAATTTGGATCCCCCGGGGTGCAC

The pGreenII 62sk vector was cleaved using the PstI and HindIII endonucleases to expose a PstI binding site at the front end of the sequence, resulting in a sequence with CaMV 35S promoter as the core element.

The CaMV 35S promoter plays the role of an "engine" in the pGreen62 SK vector, driving high-intensity, constitutive transcription and expression of any exogenous gene downstream of the multi cloning site in the vector in plant cells. After integrating the entire vector into the plant genome through Agrobacterium, the 35S promoter will continuously initiate the transcription of downstream target genes, generate mRNA, and translate it into proteins. This enables researchers to ensure that the target gene is efficiently and stably expressed in transgenic plants during the research process, thereby observing the phenotype it brings (such as insect resistance, color changes, accumulation of specific metabolites, etc.).

A plasmid skeleton containing CaMV poly (A) signal and KanR core elements was obtained by cutting the pGreenII 62sk plasmid vector with PstI and HindIII endonucleases, CaMV poly(A) signal， As a transcription termination signal, it ensures the correct processing and stability of mRNA molecules. KanR is used as a selection marker to screen and enrich bacteria or plant cells that have successfully transformed into vectors.

AAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCAATTCGGTACGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAATAATGTGTGAGTAGTTTCCCGATAAGGGAAATTAGGGTTCTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATCCACTAGCCTTGACAGGATATATTGGCGGGTAAACTAAGTCGCTGTATGTGTTTGTTTGAGATCTCATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAGAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGTGTAACATTGGTCTAGTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCTGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGGTAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTTGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCTTCCCGACAACGCAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGTCCACCTACAACAAAGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGATGGGGCGATTCAGGCGATCCCCATCCAACAGCCCGCCGTCGAGCGGGCT

The pGreenII 62sk vector was cleaved using the PstI and HindIII endonucleases to expose a HindIII binding site at the front end of the sequence, resulting in a segment of the plasmid skeleton with CaMV poly (A) signal and KanR as core elements.

After RNA polymerase transcribes the target gene along the DNA template, the poly (A) signal will emit a signal that "transcription ends here", causing the transcription process to terminate. In eukaryotes, newly formed mRNA precursors require the addition of a poly (A) tail consisting of 100-250 adenine (A) residues at the 3 'end, known as polyadenylation. The poly (A) tail acts as a protective shell, effectively preventing mRNA from being rapidly degraded by nucleases in the cytoplasm, thereby significantly improving mRNA stability. Stable mRNA can be efficiently recognized and translated by ribosomes to produce sufficient protein. The poly (A) tail facilitates the transport of mature mRNA from the nucleus to the cytoplasm.

Not all bacteria can successfully receive the vector during vector construction. Only those bacteria that have been successfully transferred into the pGreenII 62sk vector and expressed the KanR gene can survive and form colonies on this antibiotic medium. After integrating T-DNA (including the target gene and KanR gene) into plant cells through Agrobacterium, kanamycin also needs to be added to the plant culture medium. Only plant cells that successfully integrate T-DNA and express the KanR gene can survive and grow, ultimately regenerating complete transgenic plants.

Vector Construction: Primers containing restriction sites were designed to amplify the CER1 promoter region via PCR (Figure A, blue box). The amplified gel fragment was ligated into the pGreenII 0800-LUC empty vector and transformed into E. coli competent cells (Figure B), then sent to the company for sequencing. Sequencing results were compared against the template sequence using SnapGene software, revealing perfect alignment (Figure C), confirming successful construction of the pGreenII 0800-LUC-CER1 recombinant plasmid vector.

Vector Construction: Design primers containing restriction enzyme sites and amplify the HY5 coding region via PCR (Figure A, blue box). The amplified gel fragment was ligated into the pGreenII 62sk empty vector, transformed into E. coli competent cells (Figure B), and subsequently sent to the company for sequencing. Sequence alignment with the template using SnapGene software revealed perfect match (Figure C), confirming successful construction of the pGreenII 62-SK-HY5 recombinant plasmid vector.

This is a plant binary expression vector used for Agrobacterium transformation. It contains the SpCas9 gene optimized for plant codons and the two gRNA expression units mentioned above.

RB+U6-26P+gRNA_target1+gRNA scaffold+U6-26 terminator + U6-29P+gRNA_target2+ gRNA scaffold + U6-26 terminator + CaMV 35S promoter + Cas9 +LB

This vector delivers the CRISPR-Cas9 system into Nicotiana benthamiana cells through Agrobacterium mediated transformation. Cas9 and gRNAs are co expressed to achieve specific editing of the NbCER1 gene at dual sites.

We rigorously validated the functionality of the constructed components through the following experiments:

The gRNA unit was cloned into the intermediate vector through Golden Gate assembly, and validated by colony PCR and sequencing to confirm that all component sequences were correct and the assembly was error free.

Transform the final constructed pKSE402-CRISPR_CER1 vector into Agrobacterium GV3101 strain and successfully screen positive clones on plates containing corresponding antibiotics, preparing for subsequent plant infection experiments.

• Infuse tobacco leaves with Agrobacterium tumefaciens and transiently express the CRISPR-Cas9 system.
• Extract plant genomic DNA from the infiltrated area.
• PCR amplification was performed using primers designed for the sequences surrounding the CER1 target.
• Send the PCR products to the company for high-throughput sequencing analysis.
• The sequencing results further confirmed the successful introduction of insertion deletion mutations (indels) at the target site, which fully demonstrates the high activity and specificity of the two gRNA components we designed.

Composite Part (Device)

HindIII and PstI

A reporting vector for monitoring the activity of the CER1 gene promoter in Nicotiana benthamiana. Based on the pGreenII 0800-LUC skeleton, the CER1 natural promoter drives the firefly luciferase reporter gene.

pGreenII 0800-LUC backbone + CER1 Promoter + Firefly Luciferase CDS + Terminator

This vector reports the intrinsic activity of the CER1 promoter. When co infiltrated with effector vectors, the regulatory effect of transcription factors (such as HY5) can be quantified.

We demonstrated through dual luciferase assays that the reporter vector can effectively respond to the activation of HY5, with significantly enhanced fluorescence signals, providing key evidence for the HY5-CER1 pathway.

PstI and HindIIII

An effector vector for overexpression of the light signal transcription factor HY5 in Nicotiana benthamiana. Based on the pGreenII 62 SK skeleton, driven by a potent 35S promoter.

pGreenII 62-SK backbone + 35S Promoter + HY5 CDS + Terminator

When infiltrating plant cells through Agrobacterium, the vector efficiently expresses HY5 protein as a transcriptional activator to regulate the expression of downstream genes.

We successfully cloned the HY5 coding sequence from Nicotiana benthamiana and constructed this expression vector, providing a "switch" for pathway validation.

Verify the transcriptional activation effect of HY5 on the CER1 promoter

We validated the function of the above components through dual luciferase reporter gene experiments. The HY5 gene coding region and CER1 promoter region were constructed onto pGreenII 62-SK and pGreenII 0800-LUC plasmids, respectively. Using these two plasmid vectors, we investigated whether CER1 and HY5 could bind and successfully resolved the HY5-CER1 pathway.

Vector construction: we designed primers with enzyme digestion sites to amplify the HY5 coding region and CER1 promoter region (Figure 4A) by PCR, recycled their gel, connected them to pGreenII 62-SK and pGreenII 0800-LUC empty plasmids, and transformed them into competent cells of E. coli (Figure 4B), sent them to the company for sequencing. The sequencing results were compared with the template sequence by SnapGene software, and found that the sequencing results were completely consistent with the template sequence (Figure 4C and D), indicating that we successfully constructed pGreenII 62-SK-HY5 and pGreenII 0800-LUC-CER1 recombinant plasmid vectors.

We used the dual luciferase reporter technique to investigate whether there is a relationship between CER1 and the light regulating factor HY5. Transform the pGreenII 62sk-HY5 and pGreenII 0800-luc-CER1 plasmids into Agrobacterium GV3101, respectively (Figure 8A), and prepare a suspension of agricultural stems to infect tobacco leaves. Mix pGreenII 62sk-HY5 and pGreenII 0800-luc-CER1 stem suspensions to prepare one group, and prepare pGreenII 62sk-HY5 and pGreenII 0800-luc empty stem suspensions to prepare one group. Transfer the two groups into the same tobacco plant on both sides and observe the luciferase activity after dark cultivation (Figure 8B and C). The luciferase complementary imaging instrument showed that the combination of pGreenII 62sk-HY5 and pGreenII 0800-luc-CER1 agricultural stem suspension exhibited strong activity signals, and the specific LUC/REN values detected by the enzyme-linked immunosorbent assay also showed that the group had significantly higher values than the control group. The above results indicate that the light regulating factor HY5 can bind to the CER1 promoter region and promote the expression of CER1, suggesting the existence of a HY5-CER1 mediated wax synthesis pathway in plants.

This result strongly demonstrates that HY5 can specifically activate the transcription of CER1 promoter, thereby establishing a key pathway for light regulated wax synthesis at the molecular level:

Light signal → HY5 → CER1 promoter → CER1 expression → wax synthesis.

What we have created is not only a series of DNA sequences, but also a functionally validated toolkit that can be used to study plant gene regulation. Any future iGEM team wishing to study the regulation of other light responsive genes or wax synthesis related genes can utilize our provided effector vector (62SK-35S:: HY5) or draw on our complete method for constructing reporter vectors and analyzing pathways.