Describe the research, experiments, and protocols you used in your project. It is designed to provide sufficient information for other teams to replicate your work.
Astronaut DNA

Strain 1: Autotrophic Acetate Producer

Core Design

Goals

  • Enable E. coli autotrophy via a minimal CBB cycle.
  • Overproduce & secrete acetate (pta–ackA).
Autotrophy module (pCBB⁺ + FDH helper)

The Autotrophic Acetate Producer Module is designed as the upstream half of our two-strain system, supplying a stable and storable carbon intermediate to the PHBV production chassis. Instead of relying on a natural acetogen (such as S. ovata), we proposed engineering an autotrophic E. coli to couple CO2 fixation with acetate secretion.

Core Design

  1. Autotrophy

    We engineer E. coli BL21(DE3) for autotrophic growth by installing a minimal Calvin-cycle module (cf. Nissan et al., 2024) plus CO2-supply and for enhanced reduction supports. The goal was to enable E. coli to fix atmospheric CO2 as its primary carbon source, reducing dependence on sugars and enabling sustainable biomanufacturing in resource-limited settings.

  2. Acetate Production

    We engineer E. coli BL21(DE3) for the overproduction and secretion of acetate through expression of a recombinant pta–ackA pathway.

Construction of our Autotrophy Expression Module

Our autotrophy module expresses cbbL/cbbS (Form I RuBisCO, R. capsulatus), rbcX (Picosynechococcus sp.), and prkA (R. sphaeroides), with FDH (Pseudomonas sp. 101) for enhanced reduction and β-CA (Dolichospermum circinale) to enhance local CO2 near RuBisCO by dehydrating local HCO3- to CO2.

These genes are expressed using a two-plasmid system: the megaplasmid pCBB+, encoding the minimal Calvin–Benson–Bassham (CBB) module plus the supporting β-carbonic anhydrase (β-CA), and a companion plasmid expressing formate dehydrogenase (FDH).

  1. The pCBB⁺ megaplasmid was assembled in pSB1C3— a high-copy CmR vector with a ColE1/pMB1-derived ori—by cloning two composite, T7–lacO–driven operons. Two polycistronic cassettes—(i) rhc_cbbL–psp_rbcX–rhc_cbbS and (ii) rhs_prkA–dci_bCA—are each driven by a T7–lacO regulatory region (T7 promoter with a lac operator for IPTG-tunable, T7 RNAP–dependent expression). Each cassette includes a ribosome binding site (RBS, BBa_B0034) upstream of every coding sequence (CDS) and terminates with the iGEM double terminator BBa_B0015 (rrnB T1 + T7Te).
  2. The FDH plasmid was assembled in pSB3T5 (BioBrick prefix/suffix), a medium-copy TetR vector with a p15A origin. The insert encodes psp_FDH (Pseudomonas sp. 101) under the lac promoter, with a strong RBS (BBa_B0034) immediately upstream of the coding sequence, and with transcription terminated by the iGEM double terminator BBa_B0015 (rrnB T1 + T7Te).

Individual Part Characterization & Data

Individual parts (cbbL, rbcX/cbbS, prkA)

rhc_cbbL — Rhodobacter capsulatus Form I RuBisCO large subunit (UniProt: O32740 · RBL1_RHOCB)

The Rhodobacter capsulatus cbbL gene encodes the large subunit of Form I RuBisCO. In Form I RuBisCO, eight large subunits assemble with eight small subunits (rhc_cbbS) to form the L8S8 holoenzyme. The large subunit houses the active site which catalyzes the carboxylation of ribulose-1,5-bisphosphate (RuBP) to yield two molecules of 3-phosphoglycerate (RuBP + CO2 + H2O → 2 × 3-PGA). Like all RuBisCOs, Form I enzymes can also catalyze an oxygenase side reaction (RuBP + O2 → 3-PGA + 2-phosphoglycolate), establishing a trade-off between CO2 fixation and photorespiratory flux (Andersson, 2007).

In engineered systems, cbbL can be recombinantly co-expressed with cbbS (and typically prkA, phosphoribulokinase) to reconstitute the Calvin–Benson–Bassham (CBB) cycle in heterotrophs like E. coli (Nissan et al., 2024). Optimal performance generally requires chaperone-assisted folding/assembly (e.g., GroEL/ES and/or RbcX) and a balanced RuBP supply to favor the carboxylase reaction (Nissan et al., 2024).

In our system, we co-expressed rhc_cbbL/rhc_cbbS and prkA with a β-carbonic anhydrase from Dolichospermum circinale based on these considerations for optimal performance. These enzymes route fixed carbon through glycolysis to acetyl-CoA, which feeds our PHB/V biosynthetic pathway.

BioBrick

The rhc_cbbL coding sequence (UniProt O32740, RBL1_RHOCB; R. capsulatus Form I RuBisCO large subunit) was assembled as a BioBrick and ordered from IDT. The rhc_cbbL BioBrick is flanked by the standard prefix/suffix, and expressed from a T7–lac cassette (T7 promoter with a lac operator for IPTG-tunable control). An RBS (BBa_B0034) is positioned immediately upstream of the coding region within the cassette.

rhc_cbbL schematic
PCR

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
rhc_cbbL PCR gel
Successful PCR of the rhc_cbbL BioBrick with general F/R primers, showing the expected ~1.6 kb band in all lanes (0.8% TAE agarose gel; ladder at left).
Cloning

The rhc_cbbL insert was cloned into the iGEM backbone pSB1C3. The PCR product (rhc_cbbL) and pSB1C3 were double-digested with EcoRI FD and PstI FD (Thermo Fisher Scientific) and purified using a PCR & DNA Cleanup Kit (NEB). The backbone was dephosphorylated with Quick CIP (NEB) to minimize self-ligation. Insert and vector were ligated in a 3:1 ratio to generate pSB1C3::rhc_cbbL, transformed into E. coli, selected on chloramphenicol plates, and verified by colony PCR and EcoRI/PstI diagnostic digest. Final candidate clones were submitted to Plasmidsaurus for sequencing.

psp_rbcX / rhc_cbbS bicistronic unit — Picosynechococcus RuBisCO chaperone RbcX (UniProt: Q44177 · RBCX_PICP2) & R. capsulatus RuBisCO small subunit (UniProt: O32741)

RuBisCO chaperone (rbcX) is a specific assembly chaperone that acts downstream of GroEL/ES to promote formation of the RuBisCO large-subunit core (Saschenbrecker et al., 2007). As a homodimer (RbcX2), it binds the exposed C-terminal tail of newly folded RbcL in a central cleft, stabilizes that segment, and bridges RbcL dimers so they assemble into the L8 core. Subsequent RuBisCO small subunit binding displaces RbcX to yield the L8S8 holoenzyme. When co-expressed in E. coli, RbcX increases accumulation of RbcL/S and improves holoenzyme activity; loss-of-function variants reduce RuBisCO yield and activity (Onizuka et al., 2004).

In our system, recombinant psp_rbcX from Picosynechococcus sp. is co-expressed with rhc_cbbL and rhc_cbbS to boost L8 core assembly and L8S8 reconstitution in heterologous E. coli. We selected this ortholog because it is mechanistically well characterized and natively assembles Form I RuBisCO, making it suitable to assemble our R. capsulatus CbbL/CbbS subunits.

BioBrick

The psp_rbcX–rhc_cbbS coding sequences were synthesized as a BioBrick (standard prefix/suffix; IDT) and subcloned as the middle cistron of a Calvin-module operon. It is co-expressed with rhc_cbbL in a bicistronic unit positioned downstream of rhc_cbbL. Transcription of the operon is driven by a single upstream T7–lac regulatory region (T7 promoter with a lac operator for IPTG-tunable, T7 RNAP–dependent expression). A dedicated RBS (BBa_B0034) precedes each CDS, and transcription terminates once after rhc_cbbS using the iGEM double terminator BBa_B0015 (rrnB T1 + T7Te).

psp_rbcX–rhc_cbbS schematic
PCR

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using the same primer pair:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
psp_rbcX–rhc_cbbS PCR gel
Successful PCR of psp_rbcX – rhc_cbbS BioBrick with general F/R primers, showing the expected ~1.1 kb band in all lanes (0.8% TAE agarose gel; ladder at left).
Cloning

The rhc_cbbS insert was cloned into the iGEM backbone pSB1C3. The PCR product (rhc_cbbS) and pSB1C3 were double-digested with EcoRI FD and PstI FD (Thermo Fisher Scientific) and purified using a PCR cleanup kit (NEB). The backbone was dephosphorylated with Quick CIP (NEB) to minimize self-ligation. Insert and vector were ligated in a 3:1 ratio to generate pSB1C3::rhc_cbbS, transformed into E. coli DH5α, selected on chloramphenicol plates, and verified by colony PCR and EcoRI/PstI diagnostic digest. Final candidate clones were submitted to Plasmidsaurus for sequencing.

Assembly of a RuBisCO / RuBisCO-chaperone expression plasmid

Subcloning of rhc_cbbL–1C3 and psp_rbcX–rhc_cbbS–1C3 was performed using the following steps. rhc_cbbL–1C3 (destination backbone) was digested with AccI/XmaI (Thermo) and PstI FastDigest (Thermo), then PCR-purified and dephosphorylated with Quick CIP (NEB) to limit self-ligation. In parallel, psp_rbcX–rhc_cbbS–1C3 (insert donor) was digested with NarI (NEB) and PstI FastDigest (Thermo) and PCR-purified. Insert and vector were ligated at a 5:1 (insert:vector) molar ratio to generate pSB1C3::rhc_cbbL–psp_rbcX–rhc_cbbS. Ligation mixes were transformed into E. coli DH5α, plated on chloramphenicol, and screened by colony PCR and EcoRI/PstI diagnostic digest.

Despite multiple iterations, no confirmed clones were recovered within the duration of the experimental timeframe.

csp_prkA — Cereibacter sphaeroides Phosphoribulokinase 1 (UniProt: P12033 · KPPR1_CERSP)

The Cereibacter sphaeroides phosphoribulokinase (prkA) is a soluble, cytosolic bacterial Form I-type PRK that catalyzes the ATP-dependent phosphorylation of ribulose-5-phosphate (Ru5P) to ribulose-1,5-bisphosphate (RuBP), the committed substrate for RuBisCO in the CBB cycle: (Ru5P + ATP → RuBP + ADP + H+). By regenerating RuBP from pentose-phosphate pathway intermediates, prkA completes the CBB cycle and sets the RuBP supply rate that gates RuBisCO carboxylation (Kung et al., 1999).

In our system, csp_prkA is co-expressed with rhc_cbbL/rhc_cbbS (Form I RuBisCO) and β-carbonic anhydrase to reconstitute the CBB module in E. coli. We selected the C. sphaeroides ortholog because it is a bacterial PRK that does not require plant-style thioredoxin redox regulation, simplifying control in E. coli, and it has a track record for robust heterologous expression useful for CBB reconstitution (Kung et al., 1999; Hallenbeck & Kaplan, 1987).

BioBrick

The csp_prkA coding sequence (UniProt Q3J4A4, KPRK_RHOSH; Rhodobacter sphaeroides phosphoribulokinase) was assembled as a BioBrick and ordered from IDT. The csp_prkA BioBrick is flanked by the standard BioBrick prefix/suffix and includes an RBS (BBa_B0034) immediately upstream of the coding sequence. It is intended to be expressed from a T7–lac regulatory cassette as the first gene in a bicistronic operon, followed by a single downstream gene (e.g., dci_bCA).

csp_prkA schematic
PCR

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
csp_prkA PCR gel
Successful PCR of csp_prkA with general F/R primers, showing the expected ~1.1 kb band in all lanes (0.8% TAE agarose gel; ladder at left).
Cloning

The csp_prkA insert was cloned into the iGEM backbone pSB1C3. The PCR product (csp_prkA) and pSB1C3 were double-digested with EcoRI FD and PstI FD (Thermo Fisher Scientific) and purified using a PCR cleanup kit (NEB). The backbone was dephosphorylated with Quick CIP (NEB) to minimize self-ligation. Insert and vector were ligated in a 3:1 ratio to generate pSB1C3::csp_prkA, transformed into E. coli DH5α, selected on chloramphenicol plates, and verified by colony PCR and EcoRI/PstI diagnostic digest.

Despite multiple iterations, no confirmed clones were recovered within the duration of the experimental timeframe.

dci_bCA — Dolichospermum circinale β-Carbonic anhydrase (UniProt: A0A0C1N7A1 · A0A0C1N7A1_9CYAN)

The Dolichospermum circinale β-carbonic anhydrase (β-CA) is a zinc metalloenzyme that catalyzes the rapid, reversible hydration of carbon dioxide to bicarbonate: (CO2 + H2O ⇌ HCO3− + H+). β-CAs are typically small, soluble cytosolic enzymes that assemble as dimers/tetramers and use a Zn2+-bound hydroxide to attack CO2 (Ferraroni, 2024). By accelerating the CO2–bicarbonate interconversion, β-CA maintains near-instantaneous inorganic carbon availability for pathways that specifically use either CO2 (e.g., RuBisCO carboxylation) or HCO3− (e.g., bicarbonate-responsive sensors).

In our work, we chose to recombinantly express β-CA from Dolichospermum circinale, a cyanobacterium; cyanobacterial β-CAs are present in carboxysomes, catalyzing the dehydration of HCO3− to CO2 as surrounding CO2 is consumed by RuBisCO (Langella et al., 2022). Additionally, its smaller size reduces stress on the cell without sacrificing its conserved β-CA active site (NCBI, 2025). By co-expressing dci_bCA with rhc_cbbL/rhc_cbbS and prkA, our system can mimic efficient autotrophic capabilities through a small number of recombinant genes and without a carboxysome.

BioBrick

The dci_bCA coding sequence (UniProt Q3M6X9, CAH_DOLCI; Dolichospermum circinale β-carbonic anhydrase) was assembled as a BioBrick and ordered from IDT. The BioBrick is flanked by the standard iGEM prefix/suffix and includes an RBS (BBa_B0034) immediately upstream of the coding sequence. Transcription terminates with BBa_B0015 (rrnB T1 + T7Te). The construct is designed for downstream cloning into an IPTG-inducible T7–lacO cassette for co-expression with csp_prkA in the second bicistronic operon within the pCBB⁺ megaplasmid.

dci_bCA schematic
PCR

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
dci_bCA PCR gel
Successful PCR of dci_bCA with general F/R primers, showing the expected ~955 bp band in all lanes (0.8% TAE agarose gel; ladder at left).
Cloning

The dci_bCA insert was cloned into the iGEM backbone pSB1C3. The PCR product (dci_bCA) and pSB1C3 were double-digested with EcoRI FD and PstI FD (Thermo Fisher Scientific) and purified using a PCR cleanup kit (NEB). The backbone was dephosphorylated with Quick CIP (NEB) to minimize self-ligation. Insert and vector were ligated in a 3:1 ratio to generate pSB1C3::dci_bCA, transformed into E. coli DH5α, selected on chloramphenicol plates, and verified by colony PCR and EcoRI/PstI diagnostic digest.

dci_bCA cloning gel

Assembly of prkA – bCA Expression Plasmid

The following workflow was planned to assemble pSB1C3::csp_prkA–dci_bCA. The destination backbone (csp_prkA–1C3) would be digested with AccI/XmaI (Thermo) and PstI FastDigest (Thermo), PCR-purified, and dephosphorylated with Quick CIP (NEB) to limit self-ligation. In parallel, the insert donor (dci_bCA–1C3) would be digested with NarI (NEB) and PstI FastDigest (Thermo) and PCR-purified. Insert and vector were to be ligated at a 5:1 (insert:vector) molar ratio to generate pSB1C3::csp_prkA–dci_bCA. The ligation product would then be transformed into E. coli DH5α, selected on chloramphenicol, and screened by colony PCR and EcoRI/PstI diagnostic digest. Any potential clones would be verified by Plasmidsaurus sequencing.

Assembly of Final pCBB⁺ Megaplasmid

The subcloning workflow for pSB1C3::rhc_cbbL–psp_rbcX–rhc_cbbS and pSB1C3::csp_prkA–dci_bCA was planned as follows. The destination backbone (pSB1C3::rhc_cbbL–psp_rbcX–rhc_cbbS) would be digested with AseI (NEB) and PstI FastDigest (Thermo), PCR-purified, and dephosphorylated with Quick CIP (NEB) to limit self-ligation. In parallel, the insert donor (pSB1C3::csp_prkA–dci_bCA) would be digested with NdeI FastDigest (Thermo) and PstI FastDigest (Thermo) to excise the csp_prkA–dci_bCA insert, and PCR-purified. Insert and vector were to be ligated at a 3:1 (insert:vector) molar ratio to generate the pCBB⁺ construct. The ligation product would then be transformed into E. coli DH5α, selected on chloramphenicol, and screened by colony PCR and EcoRI/PstI diagnostic digest. Any potential clones would be verified by Plasmidsaurus sequencing.

psp_FDH — Pseudomonas sp. NAD+-dependent Formate Dehydrogenase (UniProt: P33160 · FDH_PSESR)

The Pseudomonas sp. NAD+-dependent formate dehydrogenase (FDH) catalyzes oxidation of formate to CO2 with reduction of NAD+ to NADH: (HCOO− + NAD+ → CO2 + NADH + H+). This enzyme is a soluble, cytosolic homodimer (~400 aa per subunit) with an N-terminal Rossmann fold for nucleotide binding; catalysis proceeds by direct hydride transfer from formate to NAD+ at the active site (Tishkov et al., 1993).

In our work, psp_FDH is used as a cofactor-recycling module to generate NADH in situ from inexpensive formate, whose benign by-product is CO2. Coupling FDH to NADH-dependent steps (e.g., dehydrogenases/reductases) sustains high reducing-equivalent supply without excessive glucose drain. The Pseudomonas ortholog was chosen due to its established history of successful recombinant expression in E. coli, multiple high-quality crystal structures, and comprehensive biochemical characterization (Tishkov et al., 1993; UniProt P33160).

BioBrick

The psp_FDH coding sequence (UniProt P33160, FDH_PSESR; Pseudomonas sp. 101 formate dehydrogenase) was assembled as a BioBrick and ordered from IDT. The part is flanked by the standard iGEM prefix/suffix and includes an RBS (BBa_B0034) immediately upstream of the coding region. Transcription terminates with BBa_B0015 (rrnB T1 + T7Te). The construct is placed under lac promoter–operator control and is intended for cloning into pSB3T5 as the second plasmid in our two-part autotrophy system to supply FDH expression (enabling NADH-coupled CO2 reduction).

psp_FDH schematic
PCR

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
psp_FDH PCR gel
Successful PCR of psp_FDH with general F/R primers, showing the expected ~1.5 kb band in all lanes (0.8% TAE agarose gel; ladder at left).
Cloning

The psp_FDH insert was cloned into the iGEM backbone pSB3T5. The PCR product (psp_FDH) and pSB3T5 were double-digested with EcoRI FD and PstI FD (Thermo Fisher Scientific) and purified using a PCR cleanup kit (NEB). The backbone was dephosphorylated with Quick CIP (NEB) to minimize self-ligation. Insert and vector were ligated in a 3:1 ratio to generate pSB3T5::psp_FDH, transformed into E. coli DH5α, selected on tetracycline, and verified by colony PCR and EcoRI/PstI diagnostic digest.

Acetate Production Module

Construction of our Acetate Production Module

Our acetate module expresses ckl_pta (Clostridium kluyveri phosphate acetyltransferase) and bsu_ackA (Bacillus subtilis acetate kinase) as a recombinant pta–ackA operon for acetate metabolism (acetyl-CoA ⇄ acetyl-phosphate ⇄ acetate).

The operon is assembled on the pRHA-113 backbone for rhamnose-inducible expression. Each coding sequence is preceded by an RBS (BBa_B0034), and transcription terminates with BBa_B0015 (rrnB T1 + T7Te).

ckl_pta — Clostridium kluyveri Phosphate acetyltransferase (UniProt: A5N801 · A5N801_CLOK5)

Phosphate acetyltransferase (pta) from C. kluyveri catalyzes the reversible conversion of acetyl-CoA and inorganic phosphate to CoA-SH and acetyl phosphate (acetyl-CoA + Pi ⇌ CoA-SH + acetyl phosphate) (Ferry, 2011; UniProt A5N801).

Together with acetate kinase (ackA), pta forms the pta–ackA pathway, channeling excess acetyl-CoA into acetate via acetyl-phosphate. This pathway underlies acetate overflow; when acetyl-CoA accumulates, pta and ackA divert flux toward acetate, preventing toxic buildup and maintaining metabolic balance (Ferry, 2011).

In engineered systems, pta can be co-expressed with ackA to promote acetate secretion or enable efficient co-consumption of acetate (Enjalbert et al., 2017). Activity must be tuned, as excessive acetate can inhibit growth (Pinhal et al., 2019).

We express C. kluyveri pta to pair with heterologous B. subtilis ackA. In its native physiology, C. kluyveri favors the forward pta–ackA reaction during ethanol + acetate chain elongation (Seedorf et al., 2008). Pairing ckl_pta with bsu_ackA improves kinetic matching, pulling carbon from acetyl-CoA → acetyl-P → acetate, increasing CoA-SH recycling, ATP generation, and acetate export.

BioBrick

The ckl_pta coding sequence (UniProt A5N801, A5N801_CLOK5) was assembled as a BioBrick and ordered from IDT. It includes an RBS (BBa_B0034) and is designed downstream of the rha promoter on pRHA-113, positioned upstream of bsu_ackA in a bicistronic operon terminated by BBa_B0015.

ckl_pta BioBrick schematic
PCR

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
ckl_pta PCR gel
Cloning

The ckl_pta insert was cloned into pRHA-113. The ckl_pta PCR product and pRHA-113 were double-digested with XbaI (NEB) and Acc65I (Thermo) and purified using a PCR cleanup kit (NEB). The backbone was dephosphorylated with Quick CIP (NEB). Insert and vector were ligated at a 5:1 (insert:vector) ratio to generate pRHA-113::ckl_pta, transformed into E. coli DH5α, selected on ampicillin, and verified by colony PCR and XbaI/Acc65I diagnostic digest.

Despite multiple iterations, no confirmed clones were recovered within the duration of the experimental timeframe.

bsu_ackA — Bacillus subtilis Acetate kinase (UniProt: P37877 · ACKA_BACSU)

Acetate kinase (AckA) catalyzes acetyl-phosphate + ADP ⇌ acetate + ATP and is a homodimeric ASKHA-family enzyme with active sites at the dimer interface (Buss et al., 2001; Ingram-Smith et al., 2015).

With pta, AckA completes the pta–ackA node to direct excess acetyl-CoA to acetate (Enjalbert et al., 2017). Acetyl-phosphate can also act as a signaling metabolite in global regulation (Klein et al., 2007). Tuning is required to avoid growth inhibition from acetate (Pinhal et al., 2019).

We express B. subtilis AckA (rather than E. coli AckA) to bias flux toward the forward reaction (acetyl-P + ADP → acetate + ATP) and exploit interspecies kinetic diversity that can better sustain net acetate production under our conditions.

BioBrick

The bsu_ackA coding sequence (UniProt P37877, ACKA_BACSU) was assembled as a BioBrick with an RBS (BBa_B0034). It is positioned downstream of ckl_pta on pRHA-113 under the rhaBAD promoter, with BBa_B0015 terminating transcription.

bsu_ackA BioBrick schematic
PCR

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
bsu_ackA PCR gel
Successful PCR of bsu_ackA with general F/R primers, showing the expected ~1.5 kb band in all lanes (0.8% TAE agarose gel; ladder at left).
Cloning

The bsu_ackA insert was cloned into the pRHA-113 backbone. The bsu_ackA PCR product and pRHA-113 were double-digested with XbaI (NEB) and Acc65I (Thermo) and purified using a PCR cleanup kit (NEB). The backbone was dephosphorylated with Quick CIP (NEB) to minimize self-ligation. Insert and vector were ligated at a 5:1 (insert:vector) molar ratio to generate pRHA-113::bsu_ackA, transformed into E. coli DH5α, selected on ampicillin plates, and verified by colony PCR and XbaI/Acc65I diagnostic digest.

Despite multiple iterations, no confirmed clones were recovered within the duration of the experimental timeframe.

Assembly of Final pRHA–pta–ackA Plasmid

The subcloning workflow for pRHA113::ckl_pta and pRHA113::bsu_ackA was planned as follows. The destination backbone (pRHA113::ckl_pta) would be digested with AccI/XmaI (Thermo) and Acc65I (Thermo), PCR-purified, and dephosphorylated with Quick CIP (NEB) to limit self-ligation. In parallel, the insert donor (pRHA113::bsu_ackA) would be digested with NarI (NEB) and Acc65I (Thermo) to excise the bsu_ackA insert, and PCR-purified. Insert and vector were to be ligated at a 5:1 (insert:vector) molar ratio to generate the pRHA–pta–ackA construct. The ligation product would then be transformed into E. coli DH5α, selected on ampicillin, and screened by colony PCR and XbaI/Acc65I diagnostic digest. Any potential clones would be verified by Plasmidsaurus sequencing.

Final Transformation of BL21(DE3) Autotrophic Acetate Producer (Strain 1)

The following series of transformations and tests was planned in the event that successful clones were obtained.

BL21(DE3) competent cells would be transformed in stages:

  1. Stage 1 — pCBB⁺ (CmR): Transform with pCBB⁺ and select on chloramphenicol plates. Screen colonies by diagnostic digest and/or colony PCR. Only verified clones proceed.
  2. Stage 2 — pSB3T5–FDH (TetR): Transform the verified pCBB⁺ strain with pSB3T5–FDH. Select on Cm + Tet plates and re-verify by diagnostic digest/colony PCR.
  3. Stage 3 — pRHA–pta–ackA (AmpR): Transform the double-plasmid strain with pRHA–pta–ackA. Select on Cm + Tet + Amp plates and confirm the triple-plasmid strain by diagnostic digest and/or colony PCR.

Strain 2: PHBV Producer

Core Design

Goals

  • Produce PHBV in E. coli from acetate via PHB core genes + endogenous propionyl-CoA (tdcB/tdcE) for PHV incorporation.
  • Boost yield with CRISPRi knockdown of gltA (citrate synthase) using SadCas9.
PHBV module (pPHBV + pCo⁺ + CRISPRi)

The PHBV Producer Module is the downstream half of our two-strain system: it consumes acetate secreted by Strain 1 and converts it into PHBV. Rather than using a native PHB producer (e.g., Cupriavidus necator or I. basilensis), we propose engineering E. coli to produce PHBV by (i) introducing the essential PHB biosynthetic genes, (ii) enabling endogenous propionyl-CoA formation to permit PHV incorporation (via the threonine → 2-ketobutyrate → propionyl-CoA route mediated by tdcB/tdcE), and (iii) applying CRISPRi to knock down competing flux (e.g., gltA/citrate synthase) to improve yield.

Construction of our PHBV Production Module

Our PHBV module expresses bktB (β-ketothiolase, Haloferax mediterranei), phaB (acetoacetyl-CoA reductase, Synechocystis sp.), and phaC (PHA synthase, Allochromatium vinosum) for PHB biosynthesis; tdcB/tdcE (L-threonine dehydratase from Shigella flexneri and a glycyl-radical pyruvate formate-lyase family enzyme from E. coli) to enable endogenous propionyl-CoA formation and thereby permit PHV incorporation; and the thioesterases yciA (S. flexneri) and tesB (Y. pestis) to maintain free 3HB/3HV pools and prevent CoA sequestration. Furthermore, we use SadCas9 with an sgRNA targeting the transcription-start-site (TSS)–proximal region of E. coli gltA to repress transcription via CRISPRi.

These genes are expressed using a three-plasmid system: (i) pPHBV, which carries the PHB/PHBV biosynthesis operon; (ii) the companion plasmid pCo⁺, which enables endogenous propionyl-CoA formation through the threonine → 2-ketobutyrate → propionyl-CoA route (tdcB, tdcE) and incorporates tesB and yciA to support 3HB/3HV availability and CoA balance; and (iii) pSB1A3-sgRNA–SadCas9, a CRISPRi module targeting endogenous E. coli gltA (citrate synthase) to reduce acetyl-CoA flux into the citric acid cycle and divert acetyl-CoA toward polymer production.

  1. pPHBV (TetR, p15A ori) was assembled in pSB3T5 (BioBrick prefix/suffix) by cloning a composite, T7–lacO–driven operon. A single polycistronic cassette—ssp_phaB–avi_phaC–hme_bktBα–hme_bktBβ—is driven by a T7–lacO regulatory region, includes an RBS (BBa_B0034) upstream of every coding sequence (CDS), and terminates with the iGEM double terminator BBa_B0015 (rrnB T1 + T7Te).

  2. pCo⁺ (CmR, pSC101 ori) was cloned in pSB4C5 and supports propionyl-CoA biosynthesis and CoA balance. The construct contains tdcB–tdcE (L-threonine dehydratase and glycyl-radical pyruvate formate-lyase family enzyme), saz_aCA (α-carbonic anhydrase, S. azorense), hsa_thsaccat (soluble adenylyl cyclase, human ADCY10), and the thioesterases tesB (Y. pestis) and yciA (S. flexneri). Expression is governed by a lac promoter–operator system for IPTG-inducible control, with each CDS preceded by an RBS (BBa_B0034) and terminated by BBa_B0015.

  3. pPHBV vs. pPHBV⁺ (CRP box): The pPHBV plasmid exists in two versions that differ only by a CRP box placed immediately upstream of the T7–lacO element driving the first gene, ssp_phaB. In pPHBV, transcription is governed solely by IPTG-inducible T7–lacO control. In the CRP-box variant (pPHBV⁺), the upstream CRP-binding site enables additional regulation through intracellular cAMP–CRP. When co-expressed with pCo⁺, α-carbonic anhydrase elevates intracellular bicarbonate (HCO3−), stimulating ADCY10 to generate cAMP, which activates CRP and enhances transcription of the phaB–phaC–bktBα/β operon in response to CO2/HCO3− levels.

  4. CRPbox_msGFP2 reporter: To assay transcriptional increase from the CRP box, we designed a CRPbox_msGFP2 fluorescent reporter (see project description).

Individual Part Characterization & Data

ssp_phaB — Synechocystis sp. acetoacetyl-CoA reductase (UniProt: P73826 · PHAB_SYNY3)

The Synechocystis sp. acetoacetyl-CoA reductase (phaB) is an SDR-family dehydrogenase that catalyzes the stereospecific, NADPH-dependent reduction of acetoacetyl-CoA to (R)-3-hydroxybutyryl-CoA, supplying the PHB monomer downstream of phaA/bktB in the canonical phaA/phaB/phaC pathway (Liu et al., 2015).

In heterologous hosts, recombinant expression of Synechocystis phaB confers robust PHB production (up to ~12% CDW depending on carbon source), making it a reliable monomer producer. We leverage this precedent to drive monomer formation in our PHB/PHBV module.

BioBrick

The ssp_phaB coding sequence (UniProt P73826) was assembled as a BioBrick and ordered from IDT. The part is flanked by the standard iGEM prefix/suffix and includes an RBS (BBa_B0034). Transcription is driven by a T7–lacO cassette and terminates with T7Te. This is the first gene in the pPHBV operon.

ssp_phaB construct map
PCR

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
ssp_phaB PCR gel
Successful PCR of ssp_phaB with general F/R primers, ~900 bp (0.8% TAE agarose; ladder at left).
Cloning

The ssp_phaB insert was cloned into the iGEM backbone pSB3T5. The PCR product and pSB3T5 were double-digested with EcoRI FD and PstI FD, purified, and the backbone dephosphorylated with Quick CIP. A 3:1 ligation generated pSB3T5::ssp_phaB, transformed into E. coli DH5α, selected on tetracycline, and verified by colony PCR and EcoRI/PstI digest. Despite multiple iterations, no confirmed clones were recovered within the experimental timeframe.

CRPbox_T7-phaB (Synechocystis sp.)

This composite expresses Synechocystis sp. phaB, an SDR enzyme that uses NADPH to reduce acetoacetyl-CoA to (R)-3-hydroxybutyryl-CoA, supplying the 3HB monomer for PHB/PHBV biosynthesis.

A CRP (cAMP receptor protein) binding site (“CRP box”) is inserted immediately upstream of the promoter driving phaB. When intracellular cAMP rises, CRP–cAMP binds and activates transcription, coupling phaB expression to cAMP signaling. In our system, this links phaB output to CO2/HCO3− status via the sAC module (higher bicarbonate → more cAMP → stronger phaB expression), allowing carbon-responsive tuning of 3HB supply.

BioBrick

The CRPbox_T7-phaB variant places a CRP binding site immediately upstream of the T7–lacO regulatory cassette, enabling cAMP-CRP–responsive modulation of the promoter. Flanked by the standard iGEM prefix/suffix with an RBS (BBa_B0034) directly upstream of the CDS.

CRPbox_T7-phaB construct map

CRPbox_T7-phaB — PCR & Cloning

PCR

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
CRPbox_T7-phaB PCR gel
Successful PCR of CRPbox_T7-phaB, ~930 bp (0.8% TAE agarose; ladder at left).
Cloning

The CRPbox_T7-phaB insert was cloned into pSB3T5. The PCR product and pSB3T5 were double-digested (EcoRI FD, PstI FD), purified, and the backbone dephosphorylated with Quick CIP. A 3:1 ligation generated pSB3T5::CRPbox_T7-phaB, transformed into E. coli DH5α, selected on tetracycline, and verified by colony PCR and EcoRI/PstI digest; candidates were submitted for Plasmidsaurus sequencing.

avi_phaC — Allochromatium vinosum PHA synthase (UniProt: P45370)

The A. vinosum PhaC is the catalytic subunit of a Class III PHA synthase (PhaC–PhaE heterodimer) that polymerizes (R)-3-hydroxyacyl-CoA thioesters into PHA, releasing CoA (Lawrence et al., 2005). Catalysis uses an active-site Cys with His/Asp support and proceeds via a covalent acyl–enzyme intermediate; the enzyme is enantioselective for (R) monomers (Zher Neoh et al., 2022). Substrate scope supports PHB and PHBV formation with suitable 3HB/3HV supply.

BioBrick

The avi_phaC CDS (UniProt P45370) was synthesized as a BioBrick (std. prefix/suffix) with RBS (BBa_B0034). In pPHBV, avi_phaC is the second cistron (downstream of ssp_phaB, upstream of hme_bktB).

avi_phaC construct map
PCR
  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
avi_phaC PCR gel
Successful PCR of avi_phaC, ~1.2 kb (note: smear in lane 3 due to undissolved agarose).
Cloning

avi_phaC was cloned into pSB3T5 via EcoRI/PstI, backbone dephosphorylated, 3:1 ligation, DH5α transformation, Tet selection, and EcoRI/PstI verification; candidates submitted for sequencing.

hme_bktB — Haloferax mediterranei β-ketothiolase (α/β)

H. mediterranei uses heterotetrameric thiolases (α/β) to initiate PHB/V biosynthesis. The system condenses acetyl-CoA→acetoacetyl-CoA and also accepts propionyl-CoA to produce 3-ketovaleryl-CoA, enabling 3HV incorporation. Compared with canonical bacterial PhaA, bktB supports broader substrate scope and HV diversification.

BioBrick

The hme_bktB CDS (α/β) was assembled as a BioBrick (std. prefix/suffix) with RBS (BBa_B0034). In the pPHBV operon it is the third cistron; transcription terminates with BBa_B0015.

hme_bktB construct map
PCR
  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
hme_bktB PCR gel (placeholder)
Successful PCR of hme_bktB, ~1.8 kb (0.8% TAE agarose; ladder at left).
Cloning

hme_bktB was cloned into pSB3T5 (EcoRI/PstI), backbone dephosphorylated, 3:1 ligation, DH5α transformation, Tet selection, EcoRI/PstI verification; candidates submitted for sequencing.

hme_bktB cloning digest

Assembly of Final pPHBV / pPHBV⁺

  1. Step 1: Linearize pSB3T5::ssp_phaB with AccI/XmiI and PstI; purify & dephosphorylate. Excise avi_phaC from pSB3T5::avi_phaC with NarI/PstI; purify. Ligate (3:1) → pSB3T5::T7–lacO–ssp_phaB–avi_phaC; transform DH5α; Tet select; EcoRI/PstI screen; sequence.

  2. Step 2: Linearize new destination with AseI/VspI and PstI; purify & dephosphorylate. Excise hme_bktB from pSB3T5::hme_bktB with NdeI/PstI; purify. Ligate (3:1) → pPHBV; transform DH5α; Tet select; EcoRI/PstI screen; sequence.

  3. pPHBV⁺ variant: identical workflow but starting from pSB3T5::CRPbox_T7-phaB.

sfl_tdcB — Shigella flexneri L-threonine dehydratase (catabolic)

tdcB converts L-threonine → 2-ketobutyrate + NH4+ (anaerobic), feeding the HV branch (with TdcE + BktB) toward 3-ketovaleryl-CoA.

BioBrick

The sfl_tdcB CDS (UniProt P0AGF9) was assembled as a BioBrick with RBS (BBa_B0034); first cistron of the propionyl-CoA cassette on pSB4C5 (lac/ IPTG-inducible), terminating with BBa_B0015.

sfl_tdcB construct map
PCR
  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
sfl_tdcB PCR gel
Successful PCR of sfl_tdcB, ~1.3 kb.
Cloning

sfl_tdcB was cloned into pSB4C5 via EcoRI/PstI, backbone dephosphorylated, 3:1 ligation → pSB4C5::sfl_tdcB; DH5α transform; Cm select; EcoRI/PstI verify.

Despite multiple iterations, no confirmed clones were recovered within the experimental timeframe.

eco_tdcE — E. coli pyruvate formate-lyase family (propionyl-CoA)

tdcE cleaves 2-ketobutyrate → propionyl-CoA + formate (and pyruvate → acetyl-CoA + formate) under anaerobic conditions, supplying the C3 precursor for 3HV incorporation.

BioBrick

The eco_tdcE CDS (UniProt P42632) was assembled as a BioBrick with RBS (BBa_B0034); second cistron of the tdcB–tdcE operon on pSB4C5 (lac/ IPTG-inducible), with BBa_B0015 terminator.

eco_tdcE construct map
PCR
  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
eco_tdcE PCR gel
Successful PCR of eco_tdcE, ~2.6 kb.
Cloning

eco_tdcE was cloned into pSB4C5 (EcoRI/PstI), backbone dephosphorylated, 3:1 ligation → pSB4C5::eco_tdcE; DH5α transform; Cm select; EcoRI/PstI verify.

Despite multiple iterations, no confirmed clones were recovered within the experimental timeframe.

saz_aCA — Sulfurihydrogenibium azorense α-carbonic anhydrase

saz_aCA rapidly hydrates CO2 ⇄ HCO3−, elevating intracellular bicarbonate to activate soluble adenylyl cyclase (ADCY10), linking inorganic carbon to cAMP signaling and CRP-responsive promoters.

BioBrick

The saz_aCA CDS (UniProt C1DTU5) was assembled as a BioBrick (RBS BBa_B0034; std. prefix/suffix) with BBa_B0015 terminator.

saz_aCA construct map
PCR
  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
saz_aCA PCR gel
Successful PCR of saz_aCA, ~1.0 kb.
Cloning

saz_aCA → pSB4C5 (EcoRI/PstI), 3:1 ligation, DH5α transform, Cm select, EcoRI/PstI verify.

Despite multiple iterations, no confirmed clones were recovered within the experimental timeframe.

hsa_thsaccat — human soluble adenylyl cyclase (ADCY10)

Human sAC (ADCY10) produces cAMP from ATP in response to HCO3−/Ca2+, independent of GPCRs, making it a direct CO2/HCO3− sensor for coupling to CRP-responsive control.

BioBrick

The hsa_thsaccat CDS (UniProt Q96PN6) was assembled as a BioBrick (RBS BBa_B0034; std. prefix/suffix). Intended for cloning into an inducible cassette (e.g., lac or T7–lacO); terminator provided by destination cassette. Paired with saz_aCA to generate a bicarbonate-activated sAC → cAMP signal.

ADCY10 construct map

hsa_thsACcat — human soluble adenylyl cyclase (ADCY10)

PCR

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
hsa_thsACcat PCR gel
Successful PCR of hsa_thsACcat, ~1.7 kb (0.8% TAE agarose; ladder at left).
Cloning

The hsa_thsACcat insert was cloned into pSB4C5. PCR product and pSB4C5 were double-digested (EcoRI FD, PstI FD), purified; backbone dephosphorylated with Quick CIP. A 3:1 ligation yielded pSB4C5::hsa_thsACcat, transformed into E. coli DH5α, Cm-selected, and verified by colony PCR and EcoRI/PstI digest.

Despite multiple iterations, no confirmed clones were recovered within the experimental timeframe.

ype_tesB — Yersinia pestis acyl-CoA thioesterase II

Acyl-CoA thioesterase II (TesB) hydrolyzes acyl-CoA → free acid + CoA-SH, aiding CoA recycling and relieving inhibitory acyl-CoA buildup. Overexpressed TesB can raise 3HB titers and support PHB production when balanced with PhaA/PhaB (Ku & Lan, 2018).

BioBrick

The ype_tesB CDS (UniProt A0A3N4BCC7) was assembled as a BioBrick with RBS (BBa_B0034) under a lac–lacO cassette; terminates with BBa_B0015.

ype_tesB construct map
PCR
  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
ype_tesB PCR gel
Successful PCR of ype_tesB, ~1.7 kb.
Cloning

ype_tesB → pSB4C5 via EcoRI/PstI; backbone dephosphorylated; 3:1 ligation → pSB4C5::ype_tesB; DH5α transform; Cm select; EcoRI/PstI verify.

Despite multiple iterations, no confirmed clones were recovered within the experimental timeframe.

sfl_yciA — Shigella flexneri acyl-CoA thioesterase

YciA (hot-dog fold thioesterase) broadly hydrolyzes acyl-CoAs including acetyl-CoA, acetoacetyl-CoA, and (R)/(S)-3HB-CoA, buffering CoA homeostasis and stabilizing upstream flux.

BioBrick

The sfl_yciA CDS was assembled as a BioBrick with RBS (BBa_B0034) under a lac–lacO cassette; BBa_B0015 terminator.

sfl_yciA construct map
PCR
  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
sfl_yciA PCR gel
Successful PCR of sfl_yciA, ~700 bp.
Cloning

sfl_yciA → pSB4C5 via EcoRI/PstI; backbone dephosphorylated; 3:1 ligation → pSB4C5::sfl_yciA; DH5α transform; Cm select; EcoRI/PstI verify.

Despite multiple iterations, no confirmed clones were recovered within the experimental timeframe.

Assembly of final pCo⁺ plasmid

Each subcloning event is performed separately, then combined:

  1. tdcB–tdcE operon: Linearize pSB4C5::eco_tdcE with NarI + PstI; purify & dephosphorylate. Excise sfl_tdcB from pSB4C5::sfl_tdcB with AccI/XmiI + PstI; purify. Ligate (3:1) → pSB4C5::sfl_tdcB–eco_tdcE; transform DH5α; Cm select; EcoRI/PstI screen; sequence.

  2. hsa_thsACcat–saz_aCA module: Linearize pSB4C5::hsa_thsACcat with AccI/XmiI + PstI; purify & dephosphorylate. Excise saz_aCA from pSB4C5::saz_aCA with NarI + PstI; purify. Ligate (3:1) → pSB4C5::hsa_thsACcat–saz_aCA; transform; Cm select; screen; sequence.

  3. tesB–yciA module: Linearize pSB4C5::ype_tesB with AccI/XmiI + PstI; purify & dephosphorylate. Excise sfl_yciA from pSB4C5::sfl_yciA with NarI + PstI; purify. Ligate (3:1) → pSB4C5::ype_tesB–sfl_yciA; transform; Cm select; screen; sequence.

Final joins:

  1. Linearize pSB4C5::sfl_tdcB–eco_tdcE with AseI/VspI + PstI; purify & dephosphorylate. Excise hsa_thsACcat–saz_aCA with NdeI + PstI; ligate (3:1) → pSB4C5::sfl_tdcB–eco_tdcE–hsa_thsACcat–saz_aCA; transform; Cm select; screen; sequence.

  2. Linearize the above with AseI/VspI + PstI; purify & dephosphorylate. Excise ype_tesB–sfl_yciA with NdeI + PstI; ligate (3:1) → pCo⁺ (pSB4C5::sfl_tdcB–eco_tdcE–hsa_thsACcat–saz_aCA–ype_tesB–sfl_yciA); transform DH5α; Cm select; EcoRI/PstI screen; sequence.

CRISPRi Module — SadCas9 + sgRNA

CRISPRi module — SadCas9 + sgRNA (gltA)

pSB1A3 backbone (AmpR, pUC ori). sgRNA driven by J23119; SadCas9 driven by a pTet-derived promoter (BBa_K3171173; aTc-inducible). Each CDS has RBS (BBa_B0034) and terminates with BBa_B0015.

  • Reporter: gltA-recognition sequence placed TSS-proximal upstream of msGFP2 on a separate plasmid to assay knockdown vs. controls.
SadCas9 background

S. aureus dCas9 (SadCas9) retains sequence-programmable binding (PAM 5′-NNGRRT-3′) without nuclease activity. Binding blocks transcription; TSS-proximal, non-template strand targeting yields strongest repression. Its compact size (~3.2 kb) eases delivery vs. SpdCas9 (~4.1 kb).

BioBrick

SadCas9 (UniProt A0A386IRG9) was ordered in two parts (SadCas9pt1/pt2), assembled as a BioBrick (std. prefix/suffix, RBS BBa_B0034) and placed under pTet-derived control; terminates with BBa_B0015.

SadCas9 part 1
SadCas9 assembly schematic
SadCas9 part 2

SadCas9 (continued)

SadCas9 schematic / part image
PCR — SadCas9pt1

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
SadCas9pt1 PCR gel
Successful PCR of SadCas9pt1, ~1.7 kb (0.8% TAE agarose; ladder at left).
PCR — SadCas9pt2

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
SadCas9pt2 PCR gel
Successful PCR of SadCas9pt2, ~1.8 kb (0.8% TAE agarose; ladder at left).
Cloning — SadCas9pt1

The SadCas9pt1 insert was cloned into the iGEM backbone pSB1A3. The PCR product (SadCas9pt1) and pSB1A3 were double-digested with EcoRI FD and PstI FD (Thermo Fisher Scientific) and purified using a PCR cleanup kit (NEB). The backbone was dephosphorylated with Quick CIP (NEB) to minimize self-ligation. Insert and vector were ligated in a 3:1 ratio to generate pSB1A3::SadCas9pt1, transformed into E. coli DH5α, selected on ampicillin plates, and verified by colony PCR and EcoRI/PstI diagnostic digest.

Despite multiple iterations, no confirmed clones were recovered within the duration of the experimental timeframe.

Cloning — SadCas9pt2

The SadCas9pt2 insert was cloned into the iGEM backbone pSB1A3. The PCR product (SadCas9pt2) and pSB1A3 were double-digested with EcoRI FD and PstI FD (Thermo Fisher Scientific) and purified using a PCR cleanup kit (NEB). The backbone was dephosphorylated with Quick CIP (NEB) to minimize self-ligation. Insert and vector were ligated in a 3:1 ratio to generate pSB1A3::SadCas9pt2, transformed into E. coli DH5α, selected on ampicillin plates, and verified by colony PCR and EcoRI/PstI diagnostic digest. Final candidate clones were submitted to Plasmidsaurus for sequencing.

SadCas9pt2 cloning gel / map

Assembly of Final SadCas9 Construct

The destination backbone pSB1A3::SadCas9pt2 would be linearized with EcoRI FastDigest (Thermo) and BstAPI (NEB), PCR-purified, and dephosphorylated with Quick CIP (NEB) to limit self-ligation. In parallel, the insert donor pSB1A3::SadCas9pt1 would be digested with EcoRI FastDigest (Thermo) and BstAPI (NEB) to excise the SadCas9pt1 fragment and PCR-purified. Insert and vector would then be ligated at a 3:1 (insert:vector) molar ratio to generate pSB1A3::SadCas9. Ligation products would be transformed into E. coli DH5α, selected on ampicillin, and screened by colony PCR and EcoRI/PstI diagnostic digest; candidate clones would be sequence-verified (Plasmidsaurus).

Despite multiple iterations, no confirmed clones were recovered within the duration of the experimental timeframe.

sgRNA — gltA (citrate synthase) targeting

The single-guide RNA (sgRNA) fuses crRNA (spacer) and tracrRNA (scaffold) to direct dCas9 to the target locus. For Sa-dCas9, a 5′-NNGRRT-3′ PAM is required. Targeting the promoter/TSS-proximal region enables strong CRISPRi repression.

We express a Staphylococcus aureus–specific sgRNA scaffold with ~21-nt spacers adjacent to 5′-NNGRRT-3′ PAM sites near the gltA TSS. Knockdown is first quantified via a gltA recognition (gltArec)–msGFP2 reporter assay.

BioBrick

For assay purposes, sgRNA was fused to gltArec–msGFP2; this reporter cassette is removed in the final construct. The gltArec–msGFP2 reporter was assembled as a BioBrick (std. prefix/suffix, RBS BBa_B0034), lac–lacO driven, and terminates with BBa_B0015.

gltArec–msGFP2 schematic
PCR — sgRNA–gltArec–msGFP2

Standardized 5′/3′ primer sites were added across constructs so they can be PCR-amplified using a single primer pair we designed:

  • General Forward — 5′ CGGACTTTCGGTCAACCACAATTC 3′
  • General Reverse — 5′ GGCAGCAGTGCATTGAAACTTC 3′
sgRNA–gltArec–msGFP2 PCR gel
Successful PCR of sgRNA–gltArec–msGFP2, ~1.4 kb.
Cloning — sgRNA–gltArec–msGFP2

The sgRNA–gltArec–msGFP2 insert was cloned into pSB1A3. PCR product and pSB1A3 were double-digested with EcoRI FD and PstI FD, purified; backbone dephosphorylated with Quick CIP. A 3:1 ligation yielded pSB1A3::sgRNA–gltArec–msGFP2, transformed into E. coli DH5α, Amp-selected, and verified by colony PCR and EcoRI/PstI digest.

Despite multiple iterations, no confirmed clones were recovered within the duration of the experimental timeframe.

Assembly of Final pSB1A3–SadCas9–sgRNA Plasmid

The destination backbone pSB1A3::SadCas9 would be linearized with NarI (NEB) and EcoRI FastDigest (Thermo), PCR-purified, and dephosphorylated with Quick CIP (NEB). In parallel, the insert donor pSB1A3::sgRNA–gltArec–msGFP2 would be digested with AccI/XmiI (Thermo) and EcoRI FastDigest (Thermo) to excise the sgRNA fragment and PCR-purified. Insert and vector would then be ligated at a 3:1 (insert:vector) molar ratio to generate pSB1A3::sgRNA–SadCas9. Ligation products would be transformed into E. coli DH5α, Amp-selected, and screened by colony PCR and EcoRI/PstI digest; candidate clones would be sequence-verified (Plasmidsaurus).

Final Transformation of BL21(DE3) PHBV Producer Strain 2

The following series of transformations and tests was planned in the event that successful clones were obtained.

  1. Stage 1 — pPHBV⁺ (TetR): Transform with pPHBV⁺ and select on tetracycline plates. Screen colonies by diagnostic digest and/or colony PCR. Only verified clones proceed.
  2. Stage 2 — pCo⁺ (CmR): Transform the verified pPHBV⁺ strain with pCo⁺. Select on Cm + Tet plates and re-verify by diagnostic digest/colony PCR.
  3. Stage 3 — pSB1A3–sgRNA–SadCas9 (AmpR): Transform the double-plasmid strain with pSB1A3–sgRNA–SadCas9. Select on Cm + Tet + Amp plates and confirm the triple-plasmid strain by diagnostic digest and/or colony PCR.

Protein Characterization

Protein Quantification: T7-CRP msGFP2 (monomeric superfolder Green Fluorescent Protein 2)

Protein: msGFP2

Expected MW: 26.2 kDa

Reference Standards: recombinant albumin (50 ng/µL, 10 ng/µL)

Load Volume: 10 µL per lane

1. Gel Densitometry – Absolute Target Protein Mass

geldense

4–20% SDS–PAGE. Lane 1: uninduced control lysate; Lanes 2–5: lysates induced with 40, 85, 190, 400 μM IPTG (respectively); Lane 6: molecular weight ladder; Lane 8: 50 ng albumin standard; Lane 10: 10 ng albumin standard. (10 μL loaded per lane.)

2. Bradford Assay–Total Protein Concentration

geldense

3. Integration of Gel and Bradford Data

geldense

Expression of 7–lacO–msGFP2 is reliable but low in abundance relative to host proteins. Transcription/translation appear consistent, and lane-to-lane differences are driven mainly by total-protein background. This is somewhat surprising for a T7-driven cassette, which is typically strong, and likely reflects sub-optimal induction/conditions (e.g., IPTG/T7 RNAP level, temperature, growth phase, or protein solubility) rather than failure of the promoter. Nevertheless, we believe protein levels are sufficient to quantify msGFP2 fluorescence in assays comparing conditions with enhanced CRP binding versus no CRP binding.

Protein Quantification: T7-lacO rhc_cbbL (Form I RuBisCO Large Subunit)

Protein: rhc_cbbL

Expected MW: 53 kDa

Reference Standards: recombinant albumin (50 ng/µL)

Load Volume: 10 µL per lane

Gel Densitometry – Relative Target Protein Mass

geldense

4–20% SDS–PAGE. Lane 1: uninduced control lysate; Lanes 2–5: lysates induced with 0, 85, 190, 400 μM IPTG (respectively); Lane 6: molecular weight ladder; Lane 8: 50 ng albumin standard; Lane 10: 10 ng albumin standard. (10 μL loaded per lane.)

2. Bradford Assay–Total Protein Concentration

geldense

3. Integration of Gel and Bradford Data

geldense

rhc_cbbL is detectable but very low-abundance on SDS–PAGE. A likely explanation is misfolding/aggregation of the RuBisCO large subunit when expressed without its folding partners (e.g., RbcX and/or GroEL/ES). Misfolded cbbL tends to form insoluble inclusion bodies—potentially toxic—so little soluble protein of the expected ~53 kDa remains despite the T7–lacO expression cassette.

(Implications: co-express RbcX ± CbbS, or add GroEL/ES; lower induction temperature/IPTG, or use solubility-enhancing tags to improve recovery.)

Protein Quantification: saz_αCA–4C5 (α-Carbonic Anhydrase)

Protein: saz_αCA

Expected MW: 29.3 kDa

Reference Standards: recombinant albumin (50 ng/µL, 10 ng/µL)

Load Volume: 10 µL per lane

Gel Densitometry – Absolute Target Protein Mass

geldense

4–20% SDS–PAGE. Lane 1: uninduced control lysate; Lanes 2–5: lysates induced with 0, 85, 190, 400 μM IPTG (respectively); Lane 6: molecular weight ladder; Lane 8: 50 ng albumin standard; Lane 10: 10 ng albumin standard. (10 μL loaded per lane.)

→ values obtained directly from the calibrated gel using the two albumin standards

2. Bradford Assay–Total Protein Concentration

geldense

3. Integration of Gel and Bradford Data

geldense

4. Carbonic Anhydrase Activity

geldense

References

References
  1. Acir131c_rs0105130 carbonic anhydrase [dolichospermum circinale awqc131c]—Gene—Ncbi. (n.d.). Retrieved October 7, 2025, from https://www.ncbi.nlm.nih.gov/gene/78012033
  2. Andersson, I. (2007). Catalysis and regulation in Rubisco. Journal of Experimental Botany, 59(7), 1555–1568. https://doi.org/10.1093/jxb/ern091
  3. Ben Nissan, R., Milshtein, E., Pahl, V., de Pins, B., Jona, G., Levi, D., Yung, H., Nir, N., Ezra, D., Gleizer, S., Link, H., Noor, E., & Milo, R. (2024). Autotrophic growth of Escherichia coli is achieved by a small number of genetic changes. eLife, 12, RP88793. https://doi.org/10.7554/eLife.88793
  4. Buss, K. A., Cooper, D. R., Ingram-Smith, C., Ferry, J. G., Sanders, D. A., & Hasson, M. S. (2001). Urkinase: Structure of acetate kinase, a member of the askha superfamily of phosphotransferases. Journal of Bacteriology, 183(2), 680–686. https://doi.org/10.1128/JB.183.2.680-686.2001
  5. Caswell, B. T., de Carvalho, C. C., Nguyen, H., Roy, M., Nguyen, T., & Cantu, D. C. (2022). Thioesterase enzyme families: Functions, structures, and mechanisms. Protein Science, 31(3), 652–676. https://doi.org/10.1002/pro.4263
  6. Chen, Y., Cann, M. J., Litvin, T. N., Iourgenko, V., Sinclair, M. L., Levin, L. R., & Buck, J. (2000). Soluble adenylyl cyclase as an evolutionarily conserved bicarbonate sensor. Science, 289(5479), 625–628. https://doi.org/10.1126/science.289.5479.625
  7. Enjalbert, B., Millard, P., Dinclaux, M., Portais, J.-C., & Létisse, F. (2017). Acetate fluxes in Escherichia coli are determined by the thermodynamic control of the Pta-AckA pathway. Scientific Reports, 7, 42135. https://doi.org/10.1038/srep42135
  8. Ferraroni, M. (2024). Bacterial β-carbonic anhydrases. The Enzymes, 55, 65–91. https://doi.org/10.1016/bs.enz.2024.05.009
  9. Ferreira, J., Levin, L. R., & Buck, J. (2022). Strategies to safely target widely expressed soluble adenylyl cyclase for contraception. Frontiers in Pharmacology, 13. https://doi.org/10.3389/fphar.2022.953903
  10. Ferry, J. G. (2011). Chapter eleven—Acetate kinase and phosphotransacetylase. In A. C. Rosenzweig & S. W. Ragsdale (Eds.), Methods in Enzymology (Vol. 494, pp. 219–231). Academic Press. https://doi.org/10.1016/B978-0-12-385112-3.00011-1
  11. Ganduri, Y. L., Sadda, S. R., Datta, M. W., Jambukeswaran, R. K., & Datta, P. (1993). TdcA, a transcriptional activator of the tdcABC operon of Escherichia coli, is a member of the LysR family of proteins. Molecular & General Genetics (MGG), 240(3), 395–402. https://doi.org/10.1007/BF00280391
  12. Hallenbeck, P. L., & Kaplan, S. (1987). Cloning of the gene for phosphoribulokinase activity from Rhodobacter sphaeroides and its expression in Escherichia coli. Journal of Bacteriology, 169(8), 3669–3678. https://doi.org/10.1128/jb.169.8.3669-3678.1987
  13. Heo, M.-J., Jung, H.-M., Um, J., Lee, S.-W., & Oh, M.-K. (2017). Controlling citrate synthase expression by CRISPR/Cas9 genome editing for n-butanol production in Escherichia coli. ACS Synthetic Biology, 6(2), 182–189. https://doi.org/10.1021/acssynbio.6b00134
  14. Hesslinger, C., Fairhurst, S. A., & Sawers, G. (1998). Novel keto acid formate-lyase and propionate kinase enzymes are components of an anaerobic pathway in Escherichia coli that degrades L-threonine to propionate. Molecular Microbiology, 27(2), 477–492. https://doi.org/10.1046/j.1365-2958.1998.00696.x
  15. Hou, J., Feng, B., Han, J., Liu, H., Zhao, D., Zhou, J., & Xiang, H. (2013). Haloarchaeal-type β-ketothiolases involved in poly(3-Hydroxybutyrate-co-3-Hydroxyvalerate) synthesis in Haloferax mediterranei. Applied and Environmental Microbiology, 79(17), 5104–5111. https://doi.org/10.1128/AEM.01370-13
  16. Ingram-Smith, C., Wharton, J., Reinholz, C., Doucet, T., Hesler, R., & Smith, K. (2015). The role of active site residues in ATP binding and catalysis in the Methanosarcina thermophila acetate kinase. Life, 5(1), 861–871. https://doi.org/10.3390/life5010861
  17. InterPro. (n.d.). Retrieved October 7, 2025, from https://www.ebi.ac.uk/interpro/entry/InterPro/IPR016662/
  18. Ithayaraja, M., Janardan, N., Wierenga, R. K., Savithri, H. S., & Murthy, M. R. N. (2016). Crystal structure of a thiolase from Escherichia coli at 1.8 Å resolution. Acta Crystallographica Section F: Structural Biology Communications, 72(Pt 7), 534–544. https://doi.org/10.1107/S2053230X16008451
  19. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096), 816–821. https://doi.org/10.1126/science.1225829
  20. Klein, A. H., Shulla, A., Reimann, S. A., Keating, D. H., & Wolfe, A. J. (2007). The intracellular concentration of acetyl phosphate in Escherichia coli is sufficient for direct phosphorylation of two-component response regulators. Journal of Bacteriology, 189(15), 5574–5581. https://doi.org/10.1128/JB.00564-07
  21. Ku, J. T., & Lan, E. I. (2018). A balanced ATP driving force module for enhancing photosynthetic biosynthesis of 3-hydroxybutyrate from CO2. Metabolic Engineering, 46, 35–42. https://doi.org/10.1016/j.ymben.2018.02.004
  22. Kung, G., Runquist, J. A., Miziorko, H. M., & Harrison, D. H. (1999). Identification of the allosteric regulatory site in bacterial phosphoribulokinase. Biochemistry, 38(46), 15157–15165. https://doi.org/10.1021/bi991033y
  23. Langella, E., Di Fiore, A., Alterio, V., Monti, S. M., De Simone, G., & D’Ambrosio, K. (2022). α-CAs from photosynthetic organisms. International Journal of Molecular Sciences, 23(19), 12045. https://doi.org/10.3390/ijms231912045
  24. Lawrence, A. G., Choi, J., Rha, C., Stubbe, J., & Sinskey, A. J. (2005). In vitro analysis of the chain termination reaction in the synthesis of poly-(R)-β-hydroxybutyrate by the class III synthase from Allochromatium vinosum. Biomacromolecules, 6(4), 2113–2119. https://doi.org/10.1021/bm0501048
  25. Lin, L., Chen, J., Mitra, R., Gao, Q., Cheng, F., Xu, T., Zuo, Z., Xiang, H., & Han, J. (2021). Optimising PHBV biopolymer production in haloarchaea via CRISPRi-mediated redirection of carbon flux. Communications Biology, 4, 1007. https://doi.org/10.1038/s42003-021-02553-3
  26. Liu, Y., Feng, Y., Cao, X., Li, X., & Xue, S. (2015). Structure-directed construction of a high-performance version of the enzyme FabG from the photosynthetic microorganism Synechocystis sp. PCC 6803. FEBS Letters, 589(20 Pt B), 3052–3057. https://doi.org/10.1016/j.febslet.2015.09.001
  27. Luca, V. D., Vullo, D., Scozzafava, A., Carginale, V., Rossi, M., Supuran, C. T., & Capasso, C. (2013). An α-carbonic anhydrase from the thermophilic bacterium Sulfurihydrogenibium azorense is the fastest enzyme known for the CO2 hydration reaction. Bioorganic & Medicinal Chemistry, 21(6), 1465–1469. https://doi.org/10.1016/j.bmc.2012.09.047
  28. Onizuka, T., Endo, S., Akiyama, H., Kanai, S., Hirano, M., Yokota, A., Tanaka, S., & Miyasaka, H. (2004). The rbcX gene product promotes the production and assembly of ribulose-1,5-bisphosphate carboxylase/oxygenase of Synechococcus sp. PCC7002 in Escherichia coli. Plant & Cell Physiology, 45(10), 1390–1395. https://doi.org/10.1093/pcp/pch160
  29. Pinhal, S., Ropers, D., Geiselmann, J., & de Jong, H. (2019). Acetate metabolism and the inhibition of bacterial growth by acetate. Journal of Bacteriology, 201(13), e00147-19. https://doi.org/10.1128/JB.00147-19
  30. Qi, L. S., Larson, M. H., Gilbert, L. A., Doudna, J. A., Weissman, J. S., Arkin, A. P., & Lim, W. A. (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell, 152(5), 1173–1183. https://doi.org/10.1016/j.cell.2013.02.022
  31. Ran, F. A., Cong, L., Yan, W. X., Scott, D. A., Gootenberg, J. S., Kriz, A. J., Zetsche, B., Shalem, O., Wu, X., Makarova, K. S., Koonin, E. V., Sharp, P. A., & Zhang, F. (2015). In vivo genome editing using Staphylococcus aureus Cas9. Nature, 520(7546), 186–191. https://doi.org/10.1038/nature14299
  32. Saschenbrecker, S., Bracher, A., Rao, K. V., Rao, B. V., Hartl, F. U., & Hayer-Hartl, M. (2007). Structure and function of RbcX, an assembly chaperone for hexadecameric Rubisco. Cell, 129(6), 1189–1200. https://doi.org/10.1016/j.cell.2007.04.025
  33. Sawers, G., Heßlinger, C., Müller, N., & Kaiser, M. (1998). The glycyl radical enzyme TdcE can replace pyruvate formate-lyase in glucose fermentation. Journal of Bacteriology, 180(14), 3509–3516. https://doi.org/10.1128/jb.180.14.3509-3516.1998
  34. Seedorf, H., Fricke, W. F., Veith, B., Brüggemann, H., Liesegang, H., Strittmatter, A., Miethke, M., Buckel, W., Hinderberger, J., Li, F., Hagemeier, C., Thauer, R. K., & Gottschalk, G. (2008). The genome of Clostridium kluyveri, a strict anaerobe with unique metabolic features. Proceedings of the National Academy of Sciences, 105(6), 2128–2133. https://doi.org/10.1073/pnas.0711093105
  35. Swarbrick, C. M. D., Perugini, M. A., Cowieson, N., & Forwood, J. K. (2015). Structural and functional characterization of TesB from Yersinia pestis reveals a unique octameric arrangement of hotdog domains. Acta Crystallographica Section D: Biological Crystallography, 71(4), 986–995. https://doi.org/10.1107/S1399004715002527
  36. Taroncher-Oldenburg, G., Nishina, K., & Stephanopoulos, G. (2000). Identification and analysis of the polyhydroxyalkanoate-specific beta-ketothiolase and acetoacetyl coenzyme A reductase genes in the cyanobacterium Synechocystis sp. strain PCC6803. Applied and Environmental Microbiology, 66(10), 4440–4448. https://doi.org/10.1128/AEM.66.10.4440-4448.2000
  37. Tishkov, V. I., Galkin, A. G., Marchenko, G. N., Tsygankov, Y. D., & Egorov, A. M. (1993). Formate dehydrogenase from methylotrophic bacterium Pseudomonas sp. 101: Gene cloning and expression in Escherichia coli. Biotechnology and Applied Biochemistry, 18(2), 201–207. https://doi.org/10.1111/j.1470-8744.1993.tb00266.x
  38. UniProt. (n.d.). Retrieved October 7, 2025, from https://www.uniprot.org/uniprotkb/P0A8Z2/entry
  39. UniProt. (n.d.). Retrieved October 7, 2025, from https://www.uniprot.org/uniprotkb/P33160/entry
  40. UniProt. (n.d.). Retrieved October 7, 2025, from https://www.uniprot.org/taxonomy/623
  41. UniProt. (n.d.). Retrieved October 7, 2025, from https://www.uniprot.org/uniprotkb/A5N801/entry
  42. UniProt. (n.d.). Retrieved October 7, 2025, from https://www.uniprot.org/uniprotkb/P37877/entry
  43. Valbuena, F. M., Fitzgerald, I., Strack, R. L., Andruska, N., Smith, L., & Glick, B. S. (2020, August). A photostable monomeric superfolder green fluorescent protein. Traffic (Copenhagen, Denmark). https://pmc.ncbi.nlm.nih.gov/articles/PMC7508230/
  44. Zher Neoh, S., Fey Chek, M., Tiang Tan, H., Linares-Pastén, J. A., Nandakumar, A., Hakoshima, T., & Sudesh, K. (2022). Polyhydroxyalkanoate synthase (PhaC): The key enzyme for biopolyester synthesis. Current Research in Biotechnology, 4, 87–101. https://doi.org/10.1016/j.crbiot.2022.01.002
Rocket