Description

3. Experimental design

3.1 Basic experiments

3.1.1 Preparation of LB medium

[Experimental apparatus]
Electronic balance, autoclave, electric stove, medicine spoon, weighing paper, measuring cylinder, beaker, pH test paper, triangular flask, dropper

[Experimental reagents]
LB medium formula is shown in the table:
peptone 10 g; yeast powder 5 g; NaCl 10 g; agar 3 g/200 ml; deionised water to 1000 ml

[Experimental steps]
1. Accurately calculate and weigh the actual amount of each drug according to the recipe.
2. Use a measuring cylinder to weigh 1000 mL of tap water and pour it into a beaker. Then add each drug (except agar) to the beaker and stir to dissolve.
3. Adjust the pH to 7.2–7.6 with 1 mol/L HCl or 1 mol/L NaOH.
4. Dispense the prepared medium into triangular flasks to no more than 1/2 the height (100 mL of medium for a 250 mL triangular flask, 1.5 g of agar). If preparing solid or semi-solid media, place the weighed agar directly into the triangular flask. Cover with a rubber stopper.
5. Pack the flask with kraft paper, label, and sterilise at 121 °C for 30 min (total cycle ≤1 h 30 min including heat-up/cool-down). Take out the medium promptly after sterilisation and cool it down.
6. Store the sterilised and cooled medium in a cool room.

3.1.2 Plasmid extraction by kit

[Experimental reagents]
Plasmid extraction related reagents (Solution I, Solution II, Solution III, Buffer S, Wash Solution, Elution Buffer), anhydrous ethanol, ddH₂O

[Laboratory equipment]
Pipette tips (blue, yellow), EP tube racks, EP tubes, adsorption columns, small centrifuges, micropipettes, thermostatic water baths, EZ-10 column plasmid extraction kits

[Experimental procedure]
1. Collect 1.5–5 ml overnight culture (OD₆₀₀ ≥ 2.0), spin 12,000 rpm into 1.5 ml tubes, discard medium.
2. Add 250 μl Solution I, fully resuspend. (Ensure RNase A is added when first using Solution I.)
3. Add 250 μl Solution II along the wall, gently invert 5–10×, stand 2 min at RT. (Do not vortex.)
4. Add 250 μl Solution III, gently invert 5–10×. After white floc appears, stand 5 min, spin 12,000 rpm 10 min. Transfer supernatant, add 1/2 vol anhydrous ethanol, invert to mix. (If much starting material, stand 2 min to remove RNA.)
5. Prime EZ-10 Column with 200 μl Buffer S, stand 1 min, spin 8,000 rpm 1 min, discard flow-through. (Use within a day.)
6. Load solution from step 4 (≤750 μl per pass), stand 1 min, spin 8,000 rpm 2 min; repeat until finished.
7. Add 500 μl Wash Solution along the wall, or invert 2–3×, spin 10,000 rpm 1 min.
8. Repeat wash once.
9. Empty and spin 10,000 rpm 2 min to remove residual wash.
10. Air-dry column 10 min at RT or 50 °C 5 min to remove ethanol.
11. Elute with 50 μl Elution Buffer (60 °C), stand 2 min, spin 10,000 rpm 2 min.
12. Store plasmid at −20 °C or use.

3.1.3 PCR

[Experimental reagents]
10× PCR buffer, dNTPs, primers, DNA template, Pfu DNA polymerase, ddH₂O

[Laboratory instruments]
PCR instrument, micropipettes, tips (blue/yellow), EP racks, EP tubes, mini-centrifuge

[Experimental steps]
Configure a 20 μl reaction: 10× Buffer (Mg²⁺) 2 μl; dNTPs 2 μl; each primer 1 μl; template 1 μl; polymerase 0.5 μl; ddH₂O 12.5 μl.
Program: 95 °C 5 min; 95 °C 45 s; anneal at T_m 45 s; 72 °C X min (30 cycles); final 72 °C 10 min. (Pfu 600 bp/min; Taq/Ex Taq 1000 bp/min.)
Brief spin; start program.

3.1.4 Agarose gel electrophoresis

[Experimental apparatus]
Horizontal electrophoresis, tabletop centrifuge, UV transilluminator, micropipette, Erlenmeyer flask, microwave oven

[Experimental reagents]
Ethidium bromide (10 mg/mL), agarose, loading buffer, marker

[Experimental procedure]
1. Dissolve 1.0 g agarose in 100 ml 1× TAE by microwaving (use PPE).
2. Cool to 50–60 °C, add 2 μl EB, mix, pour into gel tray with comb (3–5 mm thick). Add 1× TAE to tank (level ≈1 mm above gel).
3. Mix 5 μl PCR product with 1 μl 6× loading buffer, load carefully (new tip each sample).
4. Run 110 V (>40 mA) until bromophenol blue is ~2 cm from the gel front.
5. Image on gel imager (limit UV exposure to protect fragments for gel extraction).

3.1.5 Gel Recovery

[Experimental apparatus]
Water bath, balance, high-speed centrifuge, float, 1.5 ml tubes, Thermo GeneJET Gel Extraction Kit (K0692), scalpel

[Experimental reagents]
Ethanol 96–100%, isopropanol, 3 M sodium acetate pH 5.2, kit buffers (binding/wash/elution)

[Experimental steps]
1. Excise target band with clean blade; minimise UV; record gel weight in pre-weighed tube.
2. Add binding solution 1:1 (v/w) to gel (2:1 if agarose >2%).
3. Dissolve at 50–60 °C for ~10 min; invert intermittently; ensure fully dissolved (yellow indicates optimal pH; if orange/purple add 10 μl 3 M NaOAc).
4. Optional: ≤500 bp add isopropanol 1:2 (v/v); >10 kb add water 1:2 (v/v).
5. Load ≤800 μl per spin to GeneJET column; spin; discard flow-through; repeat until finished (≤1 g agarose/column).
6. Optional: Add 100 μl binding solution; spin; discard.
7. Wash with 700 μl diluted wash; spin 1 min; discard.
8. Spin empty column 1 min to remove ethanol.
9. Elute with 20–50 μl elution buffer (pre-heat to 65 °C for >10 kb). Stand 1 min; spin 1 min.
10. Discard column; store DNA at −20 °C.

3.1.6 Transformation of E. coli Top10 by heat-excited receptor cells

[Experimental reagents]
LB liquid/solid media, antibiotic, 0.1 M CaCl₂, 30% glycerol

[Experimental instruments]
Inoculation loop, plate reader, ice box, centrifuges, water bath, incubator, sterile flasks/plates, tubes, micropipettes, tips

[Experimental steps]
1. Pick a single colony and culture in LB at 37 °C, 220 rpm for 12–16 h.
2. Inoculate 1–2% into 20 ml LB; 37 °C, 220 rpm to OD₆₂₀ 0.2–0.3.
3. Chill, spin 3000 rpm 10 min on ice.
4. Resuspend in 15–20 ml pre-chilled 0.1 M CaCl₂, stand 30 min.
5. Spin; discard supernatant.
6. Resuspend in 1 ml 0.1 M CaCl₂ + 1 ml 30% glycerol; aliquot 200 μl; store −20 °C.
7. Thaw on ice; add plasmid; ice 30 min.
8. Heat-shock 42 °C 2 min; ice 3 min.
9. Recover with 800 μl LB at 37 °C for 1–2 h.
10. Spin briefly; plate on selective LB; 37 °C 12–16 h.

3.1.7 Preparation of electroshock receptor states

[Experimental materials]
Plates, plasmid, LB, 10% glycerol, antibiotics, tubes, 2 mm electroporation cuvettes

[Laboratory equipment]
Incubator, shaker, ice bath, centrifuges, water bath

[Experimental steps]
1. Inoculate a single colony into 50 ml LB; 37 °C, 220 rpm overnight.
2. Grow to OD₆₀₀=0.5; chill on ice ≥15 min.
3. Spin 3000 g, 4 °C, 10 min; discard supernatant.
4. Wash with 30 ml ice-cold 10% glycerol; repeat twice (3000 g, 5 min, 4 °C).
5. Resuspend in 500 μl 10% glycerol; aliquot 100 μl to 1.5 ml tubes.
6. Add 100–200 ng plasmid (~10 μl); ice 10 min; pre-chill cuvette 5 min.
7. Electroporate (2.5 kV, 5 ms; two pulses).
8. Add 900 μl LB; recover 37 °C 1–2 h.
9. Spin 3000 rpm 2 min; resuspend 100 μl LB; plate on selective LB; 37 °C 16 h.

3.2 Engineering bacterial construction of downstream plasmid 21a-raldh-IIdR-blh

3.2.1 Amplification and electrophoretic verification of target gene raldh, IIdR, blh fragments

The amplification method is the same as that described in 3.1.2, and the electrophoresis method is the same as that described in 3.1.4.

Primer name   Primer sequence 5′→3′
IIdR-F   gaggggttttttgGGAATTCc
IIdR-R   caggacccactagtatgattg
blh-F   ctgggtaaaacaatcatactag
blh-R   gtggtggtggtggtgcTCGAGCGGTT
raldh-F   gtttaactttaagaaggag
raldh-R   ggtgagaatgGAATTCCcaa

Figure 1. blh amplification results.

Figure 2. lldR (IIdR) amplification results.

Figure 3. raldh amplification results.

3.2.2 Gel recovery of target gene raldh, IIdR, blh fragments

The gel recovery method is the same as described in 3.1.3.

3.2.3 Kit extraction of pET-21a-trc plasmid

The plasmid extraction method is the same as described in 3.1.1.

3.2.4 Reverse PCR and electrophoretic verification of pET-21a-trc plasmid

[Purpose of experiment]
Reverse amplification of pET-21a-trc plasmid to obtain the expression frame without lacI, facilitating homologous recombination with the raldh-IIdR-blh fragment to construct recombinant plasmid 21a-blh-raldh-IIdR.

[Experimental materials]
pET-21a-trc plasmid

Primer name   Primer sequence 5′→3′
ATRA plasmid anti-p primer 1   TTGAACTTGTCATatgtatatctccttcttaaagttaaacaaa
ATRA anti-p primer 2   CGTTCCGTAACCGCTCGAgcaccaccaccaccaccactg

[Experimental reagents]
ddH₂O, 10× PCR buffer, dNTP, Pfu DNA polymerase

[Experimental apparatus]
Mini-centrifuge, PCR instrument, micropipettes, tips, EP tubes, racks, water bath

[Experimental procedure]
1. PCR as in 3.1.1.
2. De-templating system in 1.5 ml tube: ddH₂O 7 μl; Q.Cut DpnI 1 μl; 10× Cut Buffer 2 μl; 21a reverse PCR product 0.5 μl.
3. Incubate 37 °C 1 h.
4. Inactivate at 70 °C 15 min.
5. Electrophoresis as in 3.1.4.

Reverse PCR of pET-21a-trc generated the lacI-free expression frame for recombination.

3.2.6 Construction of plasmid 21a-blh-raldh-IIdR using homologous recombination methods

[Aim of experiment]
Construct plasmid 21a-raldh-IIdR-blh using C115 homologous recombinase

Experimental materials
raldh, IIdR, blh gene fragments, linearised 21a plasmid fragments

[Experimental reagents]
ddH₂O, C115 homologous recombinase

Experimental apparatus
EP tube, rack, PCR instrument, tips, micropipette, water bath

Experimental steps
Configure 30 μl reaction: Linearised 21a 12 μl; blh 1 μl; IIdR 1 μl; raldh 0.8 μl; ddH₂O 0.2 μl; ClonExpress Ultra One-Step 15 μl. Incubate 50 °C 30 min.

3.2.7 Transformation of Top10 by heat-stimulated sensory state

The recombinant plasmid was transformed into E. coli Top10 to amplify the recombinant plasmid for subsequent experiments. Receptor preparation and transformation methods are the same as those shown in 3.1.5.

3.2.8 Colony PCR to verify expression

3.3 Engineering bacterial construction of upstream plasmid 21a-crtEBIY

3.3.1 Amplification and electrophoretic verification of the target gene crtEBIY fragment

Amplification method as described in 3.1.2, electrophoresis method as described in 3.1.4.

Primer name   Primer sequence 5′→3′
Target gene primer 1   ctttaagaaggagatataTTCATGACGGTCTGCGC
Target gene primer 2   ggggttatgctagttattgcTTAACGATGAGTCGTCATAATGGC

3.3.2 Gel recovery of the target gene crtEBIY fragment

The gel recovery method is the same as described in 3.1.3.

3.3.3 Kit extraction of pET-21a-trc plasmid

Same as experiment 3.2.3

3.3.4 Reverse PCR and electrophoretic verification of pTrc99a-crtEBIYZ plasmid

Same as experiment 3.2.4

Primer name   Primer sequence 5′→3′
β-carotene plasmid primer 1   GCGCAGACCGTCATGAAtatatctccttcttaaag
β-carotene plasmid primer 2   ttatgacgactcatcgttaaGCAATAACTAGCATAACCCCTTGG

3.3.5 Construct plasmid 21a-crtEBIY using homologous recombination method

As in experiment 3.2.6, the recombination system is as follows:

makings   dosage
Linearised 21a plasmid fragment 2 μl; crtEBIY gene fragment 3 μl; ClonExpress Ultra One-Step 5 μl

3.3.6 Heat-stimulated sensory state transformation Top10

Same as experiment 3.2.6

3.3.7 Colony PCR to verify expression

3.4 Gene integration of downstream plasmids using the CRISPR-Cas9 system

3.4.1 Design of sgRNA and construction of pEcgRNA plasmid

[Aim of experiment]
Design and construction of sgRNA and pEcgRNA plasmids for targeted knockdown of endA in the EcN genome, in order to facilitate subsequent integration of the raldh-IIdR-blh cassette.

[Experimental Materials]
pEcgRNA, BsaI enzyme

[Experimental reagents]
ddH₂O, G buffer, T4 ligase buffer, LB/Sm plates (50 μg/mL), 5 ml LB+Sm (50 μg/mL)

[Experimental apparatus]
Micropipettes, tips, EP tubes, racks, water bath, applicator, biosafety bench, incubator

Experimental steps
1. Design sgRNA (20 bp) on the target site with CHOPCHOP: cgtagagtgggaacacgtcg, PAM: CGG.
2. Digest ccdB with BsaI to linearise pEcgRNA (cohesive ends 5′-TAGT / 5′-AAAC). Digest 20 μl: pEcgRNA 3; BsaI 1; G buffer 2; ddH₂O 14.
dsDNA (N20) ligation system (50 μl): ddH₂O 35; N20-up 5; N20-dn 5; T4 ligase buffer 5.
3. 95 °C 5 min; cool down stepwise; 16 °C 10 min.
4. Dilute dsDNA 200×, ligate 1 μl dsDNA + 1 μl BsaI-linearised pEcgRNA at 16 °C for 1 h with T4 ligase.
5. Transform into Top10, plate on Sm (50 μg/mL), 37 °C overnight; pick colonies into 5 ml LB+Sm and culture 220 rpm 37 °C overnight; extract plasmid and verify by digestion next day.

3.4.2 Fusion PCR to obtain donor destination fragments

[Purpose of experiment]
Construction of recombinant vector pMD18T-Donor containing upstream and downstream homology arms of endA by fusion PCR method.

[Experimental materials]
pMD 18T vector

Primer name   Primer sequence 5′→3′
endA-up-F   aactctcttacacccagcgc
endA-up-R   tctcgatcctctacggacaaataacggtacatcacttactccg
endA-down-F   atatccggattggcgggcgcgaaagagctaacc
endA-down-R   ttgcaatcttctgccactgct

[Experimental reagents]
T4 ligase, ddH₂O, 10× ligase buffer

[Experimental apparatus]
Micropipette, water bath, balance, 1.5 ml tubes

[Experimental steps]
1. Colony PCR on EcN to amplify endA with its homology arms (PCR as 3.1.1).
2. Ligate with linearised pMD18-T using T4 ligase → pMD18-T-endA.
3. Use pMD18-T-endA as template; reverse-PCR with endA-up-R′/endA-down-F′ to linearise (method as 3.2.4).
4. Use pET-21a-trc-raldh-IIdR-blh (10× diluted) as template to PCR the trc-promoter expression frame (4318 bp).
5. Electrophoresis to verify the expression frame.
6. Gel recovery.
7. Homologous recombination (C115) between the linearised vector and the r-I-b expression frame → pMD18T-Donor (contains r-I-b and endA arms). Finally amplify Donor with endA-up-F′/endA-down-R′ (5289 bp) and verify by electrophoresis.

3.4.4 Preparation of EcN (pEcCas) electroshock receptor cells

The preparation method is the same as described in 3.1.7

3.4.5 Electroshock transformation of DNA fragments with pEcgRNA

The electroporation cuvette was pre-cooled on ice for 5–10 min, then 13 μl of DNA fragment (gene homologous recombination sequence) and 3 μl of pEcgRNA-gene-N20 were added to 200 μl of EcN electrocompetent cells, gently mixed and transferred to a sterile 2 mm cuvette for electroporation (2.5 kV, 5 ms, twice). Add 900 μl drug-free LB, recover 37 °C for 1–2 h, pellet, resuspend in 100 μl LB and plate on LB with Kan (25 μg/mL) + Sm (50 μg/mL), 37 °C overnight. Negative control: cells without L-arabinose induction.

3.4.6 Translator Elimination and Validation

Positive mutant colonies were PCR-checked with gene-up-F/gene-dn-R (wild-type EcN as negative control). Pick positives and culture in LB with 10 mM rhamnose and Kan, 37 °C, 220 rpm overnight; transfer to drug-free LB for 12 h; plate on sucrose LB (3 g/L) to isolate single colonies. Screen on LB, Kan-LB and Sm-LB. Single colonies that fail on Kan and Sm but grow on drug-free plates indicate successful knockout/integration and loss of pEcgRNA-gene-N20 and pEcCas.

3.3 Experimental Results

3.3.1 Integration of Lactic Acid-Targeting Protein Gene

Acquisition and verification of OmpT donor and related fragments

Verification of etlpC gene integration

Expression and functional verification

Visible turbidity around 0.1 mol/L lactic-acid filter paper; absent near the negative control.