Engineering
Circuit
We researched various promoters that would increase the yields of our product of interest and we selected the promoter HpFMD for our circuit. Our main goal is to increase the production of scFv against the reported yields in the literature.
scFv LR
- Yield in P. pastoris: 44.6 ± 5.3 mg/L (using vector pPICZαA)
- Comparison with E. coli: 3.6 ± 0.8 mg/L
- Improvement: ~12-fold higher than expression in E. coli
- Molecular weight: ~27.9 kDa
- Expression conditions: 500 mL cultures, 3 days of induction with 1% methanol
- (Chang et al., 2018)
scFv-6009FV (variant of 6009F)
- In BMMY medium: 31.6 ± 2.0 mg/L (54.4% of total protein)
- In BMM medium: 18.78 ± 0.3 mg/L (46.9% of total protein)
- Molecular weight: ~28.3 kDa
- Expression observed from 48 h to 96 h post-induction
- (Adame et al., 2024)
- Specifically scFv-LR, which is designed for neutralizing the Cn2 toxin of scorpion venom.
Why HpFMD promoter?
The HpFMD promoter is a 623-base pair regulatory sequence from Hansenula polymorpha that controls the gene expression of formate dehydrogenase (FMD). This promoter is strongly derepressed and inducible by methanol, making it exceptionally valuable for protein production in Pichia pastoris (Vogl. et al., 2020).
Advantages of this promoter
- It reaches approximately 75% of methanol-induced AOX1 levels without methanol, enabling methanol-free production.
- It outperforms the standard P. pastoris AOX1 promoter by 2.1- to 3-fold when induced with methanol.
- It provides both methanol-free expression and the strongest methanol-inducible expression reported in P. pastoris.
Performance of the HpFMD Promoter vs. AOX1 Promoter*
| Reporter protein | Protein type | Measurement method | Methanol-induced yield | Derepressed yield | Key notes |
|---|---|---|---|---|---|
| eGFP | Intracellular | Fluorescence (RFU/OD₆₀₀) | 210% (2.1 times higher) | ~75% of methanol-induced AOX1 | Primary reporter, best characterized |
| HRP | Secretory | Enzymatic activity (U/mL) in supernatant | 152% of AOX1 | Outperformed derepressed AOX1 | Limited by secretion pathway |
| CalB | Secretory | Enzymatic activity (U/mL) in supernatant | 98% of AOX1 | Outperformed derepressed AOX1 | Smaller improvement, secretion-limited |
| MeHNL | Intracellular | Enzymatic activity (U/mL) in natural extracts | 254% (2.5 times higher) | Strong derepressed expression | Highest improvement achieved |
* Vogl, T., Fischer, J. E., Hyden, P., Wasmayer, R., Sturmberger, L., & Glieder, A. (2020). Orthologous promoters from related methylotrophic yeasts surpass expression of endogenous promoters of Pichia pastoris. AMB Express, 10(1), 38.
Overall, the promoter HpFMD had a better performance compared to AOX1 and the possibility of having a stronger expression without induction. This promoter would solve issues related to the scaling in production.
Designed vector
We decided to use pPICZα as our vector, as previous articles that work with scFvLR expression used it. To compare with our work, we incorporated the elements of the vector into our design with elements like golden assembly and syntax from the OYC collection (elements in the IGEM distribution kit).
Our design is divided in two phases.
Design process:
Phase 1:
Circuit Design
The target product to be produced is ScFv-LR, whose amino acid sequence is available in the NCBI database under accession numbers 4V1D_A and 4V1D_B. To obtain the coding DNA sequence for this protein, the codon optimization tool from VectorBuilder was used with standard parameters for Komagataella phaffii, while avoiding recognition sites for the restriction enzymes XbaI and XhoI. The following sequence was generated:
GAAGTTCAATTGGTTGAATCTGGTGGTGGATTGGTTCAACCTGGTGGTTCATTGGCTTTGTCTTGTACTGGATCAGGTTTTACATTTGATAACTA
CGCTATGCATTGGTTGAGACAAGTTCCTGGTGAAGGATTGGAATGGGTTTCAGGTATTTCGAGATCATCTGGAGACATTGACTACGCTGATTCTG
TTAAGGGTAGATTCACTATTTCCAGAGATGACGCTAAGAAGACCTTGTCTTTGCAAATGAATTCCTTGAGAGCTGAAGACACTGCTGTTTATTAC
TGTGCAAGAGGTGGTGAAGGTTCATTCGATACTATTTGGGGTCAAGGTACTATGGTCACTGTTTCATCCGGTGGTGGAGGTTCTGGTGGTGGTGG
TTCTGGTGGTGGAGGTTCTGAAATTGTTTTGACTCAATCTCCAGCTACTTTGTCTGTTTCTCCAGGTGAAAGAGCTACTTTGTCTTGTAGAGCCT
CTCAAAGTGTTAGATCTTACTTGGCATGGTATCAACAGAAGCCAGGACAAGCCCCAAGACTACTGGAATCTGATGCTTCAAACAGAGCTACTGGA
ATTCCAGCTAGATTTACCGGTTCTGGTTCTGGAACTGATTTCACTTTAACTATCTCTTCTTTGGAACCAGAAGATTTTGCTATTTACTACTGTCA
ATACAGATATTCACCAAGAACATTTGGTCAAGGTACCAAGGTTGAAATTAAGAGAGCTGCAGCTGAACAAAAGCTTATTTCTGAAGAGGACTTGA
ATGGAGCTGCTCATCATCATCATCATCATTAA
Based on the restriction enzyme cut sites used, in silico cloning was performed using Serial Cloner.
The vector contains the following genetic circuit:
This genetic circuit includes the codon-optimized sequence of scFv-LR for expression in P. pastoris. The circuit is positively activated by methanol through the action of the AOX1 promoter. Therefore, it enables a two-phase process: a growth phase in the absence of methanol and a production phase induced by methanol. In addition, the circuit contains the Saccharomyces cerevisiae mating factor α secretion signal placed upstream of the coding sequence, ensuring that the protein is secreted during production. Furthermore, the expression cassette includes the AOX1 terminator and a ribosome binding site.
Figure 1. Proposal with AOX1 and scFv-LR:
Figure 2. Proposal with HpFMD and scFv-LR:
| pPICZAα/SCFV-LR_AOX1 | pPICZAα/scfv-LR_HpFMD | |
|---|---|---|
| Promoter | 5´ AOX1 promoter | HpFMD |
| Secretion signal | α-factor secretion signal (from Saccharomyces cerevisiae) | Alpha factor |
| His-tag (6xHis) | c-myc epitope (Glu-Gln-Lys-Leu-Ile-Ser-Glu-Glu-Asp-Leu) C-terminal polyhistidine (6His) tag | |
| Termination region | AOX1 transcription termination (TT) region | AOX1 TT |
| Resistance gene promoter | TEF1 promoter (GenBank accession nos. D12478, D01130) | |
| EM7 promoter | ||
| Resistance gene | Zeocin™ resistance gene (Sh ble) | Zeocin |
| CYC1 transcription termination region (GenBank accession no. M34014) | ||
| pUC origin |
*Invitrogen. (2010). pPICZα A, B, and C: Pichia expression vectors for selection on Zeocin™ and purification of secreted recombinant proteins (Cat. no. V195-20, Manual part no. 25-0150, Rev. Date: July 7, 2010). Invitrogen.
Phase 2:
During the first design cycle, we aimed to construct our vector using the Golden Gate assembly strategy. However, our sponsors could not synthesize the pPICZαA backbone due to its Zeocin resistance marker, forcing us to redesign our cloning plan using classical methods. This presented a new challenge: introducing our promoter downstream of the AOX1 promoter was complicated by the presence of a secretion signal already in that region of the pPICZαA backbone. Drawing on previous work that eliminated BsaI restriction sites through mutagenesis, we decided to switch to the pPICA backbone, which lacks the secretion signal, allowing us to include it as part of our insert within the MCS using a resistance cassette with BsaI overhangs following the OYC collection design.
When we attempted to upload our complete vector for synthesis, we encountered additional obstacles. Synthesizing each part individually through our iGEM sponsor would require Golden Gate assembly, but we lacked the necessary reagents (BsaI, T4 Ligase, and Taq polymerase), and the time delays for ordering these materials would prevent timely completion. While sending the complete vector to a synthesis company seemed viable, we discovered that the Zeocin resistance marker was not among their available options. After further investigation, we found that Genescript could synthesize and clone our scFv (scFv-LR) and HpFMD promoter into pPICZα, which they had available, using their vector onboarding service.
This approach, however, introduced a critical design flaw: the HpFMD promoter would be positioned after the secretion factor in pPICZα, disrupting proper expression and secretion of our scFv. We could not simply remove the AOX1 promoter, as its sequences were essential for directing homologous integration of our circuit into the AOX1 locus upon linearization. To resolve this, we changed vectors once again, using pPICA instead of pPICZα. Since pPICA lacks the secretion signal, we incorporated it directly into our insert, creating a complete expression cassette (Promoter-secretion factor-scFvLR) within the MCS.
The inclusion of the AOX1 promoter alongside the HpFMD promoter served a dual purpose: it enabled site-specific integration at the AOX1 locus in the Pichia genome through homologous recombination, while also enhancing the methanol-inducible capacity of the HpFMD promoter (Soltani et al., 2024) by positioning it within the naturally methanol-responsive AOX1 locus.
A
B
Figure 3. Final design of the vectors A) With HpFMD B) Only AOX1 promoter
Vector Template
Vector pPICZα
pPICZα is a Pichia pastoris expression vector (3.6 kb) specifically designed for the production of secreted recombinant proteins. It contains the S. cerevisiae α-factor secretion signal, the AOX1 promoter system, and dual affinity tags (myc and polyhistidine) for protein detection and purification (Vallet et al., 2017).
Purpose
The vector is designed to express proteins that require:
- Secretion into the culture medium to facilitate purification.
- Post-translational modifications (glycosylation, disulfide bond formation).
- High-level expression under methanol-inducible conditions.
- Eukaryotic processing for proper protein folding
It is particularly useful for producing antibodies, enzymes, hormones, and other therapeutic proteins that require eukaryotic processing (Vallet et al., 2017).
New Promoter
- Demonstrated higher transcriptional activity than AOX1, particularly under methanol-induction conditions.
- Promoter adapted to the Open Yeast Collection format with standardized prefixes and suffixes.
- Using HpFMD as part of the system allows direct comparison of its performance against AOX1 within the same plasmid (pPICZα) (Vogl, et al., 2020).
Mechanism of action
Integration Strategy
- The vector lacks a yeast origin of replication — it must integrate into the genome of P. pastoris.
- It will be linearized within the AOX1 region (Sac I, Pme I, or BstX I sites) prior to transformation.
- Integration occurs through homologous recombination at the AOX1 locus.
- This generates stable transformants with the expression cassette integrated chromosomally.
To evaluate the transcriptional efficiency of two different promoters and to express a single-chain antibody fragment (ScFv), two modular constructs were designed and assembled following the standardized OYC (Open Yeast Collection) format (Figure 4).
OYC format
Figure 4. OYC format for modular construct assembly. “Parts are identified according to OYC nomenclature”. (Lee et al., 2015)
To guide the development of these projects, iGEM promotes the use of the engineering cycle, a systematic and iterative framework that emphasizes continuous improvement of biological designs.
Figure 5. The iGEM Engineering Cycle
The iGEM engineering cycle (figure 5) consists of five interconnected stages: Design, Build, Test, Learn, and Improve. In the Design phase, teams propose potential biological solutions and plan the genetic constructs needed. Crucially, this stage should incorporate stakeholder engagement and consideration of real-world context through Human Practices to ensure the proposed solution addresses genuine needs. The Build stage involves constructing the genetic circuits and developing the tools needed for the project, which may include designing expression systems, creating modeling frameworks, or establishing collaborative partnerships and infrastructure. The Test phase focuses on experimental validation, where teams measure outcomes and compare them against expectations. Testing should extend beyond the laboratory to include evaluation of the solution's feasibility, accessibility, and impact in its intended context. During Learn, results are analyzed to identify strengths, limitations, and unexpected behaviors of the system. This learning phase should integrate feedback from stakeholders and experts to understand not only technical performance but also social, ethical, and practical considerations. Finally, in the Improve stage, insights from previous iterations (including both technical findings and Human Practices feedback) are applied to refine and optimize the design. This may involve adjusting the technical approach, expanding the project scope, or pivoting strategy based on stakeholder input. In essence, the cycle is iterative, meaning that these steps are repeated multiple times to gradually achieve a more effective system (iGEM, 2025).
DESIGN
In the design phase, we addressed scorpion envenomation, a major public health concern in Mexico, through extensive stakeholder consultations with biologists, affected communities (Acámbaro and Yautepec), and researchers from the Instituto de Biotecnología (IBT-UNAM). While ScFv LR was originally designed by IBT-UNAM to address limitations of traditional antivenoms—manufacturing variability, animal use, and logistical constraints—stakeholder feedback revealed critical insights that redefined our approach.
Through interviews conducted as part of our Human Practices work, biologists emphasized that Mexican antivenoms are among the best globally and that microbial alternatives face significant polyvalence limitations. Medical professionals identified accessibility, not efficacy, as the primary challenge, with patients in marginalized communities often unable to receive treatment due to healthcare system constraints. Industry representatives indicated their focus on microbial systems for venom production rather than antivenom manufacturing. This feedback led us to recognize that scorpion envenomation cannot be solved through a single technological intervention.
We expanded our approach to three complementary strategies: primary prevention through education in vulnerable communities, healthcare infrastructure improvement in marginalized regions, and therapeutic innovation through recombinant antivenoms. We integrated social modeling for evidence-based advocacy with governmental agencies like the Directorate General of Epidemiology (DGE), deliberately shifting away from presenting recombinant antivenoms as a singular solution.
For the therapeutic component, we utilized scFv LR, a recombinant human-derived single-chain variable fragment developed by Riaño-Umbarila et al. (2005) through directed evolution and phage display. ScFv LR neutralizes Cn2 toxin from Centruroides noxius and Css2 from C. suffusus, as well as complete venoms from both species (Riaño-Umbarila et al., 2011). Its VH3-Vκ3 germline configuration provides optimal stability, expression yields, and antigen recognition (Ewert et al., 2003), while enabling complementary activity with other neutralizing antibodies for combination therapies.
We selected the OpenPichia platform with Komagataella phaffii pep4 yps1 strain as our expression system because literature demonstrates that the best results for recombinant antivenoms have been achieved in Pichia species. Within the available Pichia platforms, we chose OpenPichia specifically due to its open-source nature, which minimizes recurring production costs and aligns with our goal of developing accessible therapeutic solutions. Additionally, OpenPichia generously provided the K. phaffii pep4 yps1 strain as a sponsorship donation. This strain lacks major vacuolar proteases, which reduces protein degradation and improves yield and quality of secreted recombinant proteins (Zahrl et al., 2019). The K. phaffii system offers technical advantages over alternative hosts: compared to S. cerevisiae, it exhibits lower hyperglycosylation, and compared to Escherichia coli, it provides secretion capability and post-translational modification capacity. We employed the pPICZα vector under control of the methanol-inducible AOX1 promoter, which supports high-level extracellular secretion via the α-factor signal sequence. This expression strategy has been shown to significantly increase scFv yields compared to bacterial systems while maintaining proper protein folding and functional activity (Gómez-Ramírez et al., 2023).
This design integrates stakeholder-informed problem framing, targeted antibody engineering, and optimized eukaryotic expression, establishing a foundation for subsequent build and test phases.
BUILD
In the build phase, we constructed a genetic circuit for the expression of ScFv-LR in Komagataella phaffii. The design incorporated the pPICZα vector with the Saccharomyces cerevisiae α-factor secretion signal to enable extracellular secretion of the antibody fragment, simplifying downstream purification. For expression control, we designed the circuit to incorporate both the conventional AOX1 promoter and the HpFMD promoter, allowing dual functionality to sustain methanol-free expression. To optimize expression, the coding sequence of ScFv-LR was codon-adapted for K. phaffii and cloned downstream of the secretion signal, flanked by the AOX1 terminator for stability. The circuit was assembled following the Open Yeast Collection (OYC) standards and integrated into the AOX1 locus through homologous recombination, ensuring stable chromosomal integration. This construction provided a robust platform to experimentally test the expression efficiency of ScFv-LR under different promoter conditions.
TEST
At the molecular level, we conducted in silico assays to characterize the mechanisms of scorpion venom toxicity and the neutralizing effect of antivenoms on venom components. At the population level, we developed and tested predictive models to estimate the incidence of scorpion stings at the state level. These preliminary results led us to establish collaboration with the DGE, where we gained access to more comprehensive epidemiological data and began co-designing evidence-based strategies to reduce scorpion sting cases in high-risk regions. This partnership aims to transform our modeling work from an academic exercise into a practical tool for public health decision-making.
Although we did not complete functional wet-lab assays for ScFv-LR expression, we carried out extensive pre-experimental validation and laboratory preparations. We performed in-silico cloning and codon optimization for K. phaffii, designed modular constructs with secretion and affinity tags, and defined integration and selection strategies for AOX1 locus insertion. In the lab, the team prepared media, antibiotics, and culture plates, seeded E. coli DH5α carrying the pPICZα backbone, and logged all preparatory steps and encountered issues to inform protocol adjustments.
LEARN
The learning phase yielded insights that fundamentally transformed our understanding of the scorpionism challenge. From stakeholder engagement, we learned that technological innovation alone is insufficient to solve complex public health problems. Key insights included: Mexican scorpion antivenoms are already world-class, challenging our assumption that recombinant alternatives would be superior; the primary barrier is patient access rather than antivenom quality, particularly in marginalized communities; microbial alternatives face polyvalence limitations due to the complex mixture of toxins in scorpion venom; and industry focuses on microbial systems for venom production rather than antibody manufacturing. These insights revealed that effective intervention requires simultaneous action across prevention, infrastructure development, and therapeutic advancement rather than molecular engineering alone.
From our molecular characterization work, we learned important details about the mechanisms by which scorpion venom exerts its toxic effects and why polyvalence is such a critical feature of effective antivenoms. Our epidemiological modeling work taught us valuable lessons about data availability and the importance of partnerships with governmental health agencies. We learned that effective public health interventions require not just good models but also the institutional relationships necessary to translate analytical insights into policy decisions. From our laboratory preparation work, we learned important practical lessons about experimental design and protocol optimization, including the value of thorough in-silico validation and meticulous documentation.
References:
- Adame M, Vázquez H, Juárez-López D, Corzo G, Amezcua M, López D, González Z, Schcolnik-Cabrera A, Morales-Martínez A, Villegas E. (2024). Expression and characterization of scFv-6009FV in Pichia pastoris with improved ability to neutralize the neurotoxin Cn2 from Centruroides noxius. Int J Biol Macromol. Aug;275(Pt 1):133461. doi: 10.1016/j.ijbiomac.2024.133461.
- Chang, C. H., Hsiung, H. A., Hong, K. L., & Huang, C. T. (2018). Enhancing the efficiency of the Pichia pastoris AOX1 promoter via the synthetic positive feedback circuit of transcription factor Mxr1. BMC biotechnology, 18(1), 81. https://doi.org/10.1186/s12896-018-0492-4
- Invitrogen. (2010). pPICZα A, B, and C: Pichia expression vectors for selection on Zeocin™ and purification of secreted recombinant proteins (Cat. no. V195-20, Manual part no. 25-0150, Rev. Date: July 7, 2010). Invitrogen.
- Vallet-Courbin, Amelie & Lariviere, Melusine & Hocquellet, Agnès & Hemadou, Audrey & Parimala, Sarjapura-Nagaraja & Laroche-Traineau, Jeanny & Santarelli, Xavier & Clofent-Sanchez, Gisele & Jacobin, Marie-josee & Noubhani, Abdelmajid. (2017). A Recombinant Human Anti-Platelet scFv Antibody Produced in Pichia pastoris for Atheroma Targeting. PLOS ONE. 12. e0170305. 10.1371/journal.pone.0170305.
- Vogl, T., Fischer, J. E., Hyden, P., Wasmayer, R., Sturmberger, L., & Glieder, A. (2020). Orthologous promoters from related methylotrophic yeasts surpass expression of endogenous promoters of Pichia pastoris. AMB Express, 10(1), 38. https://doi.org/10.1186/s13568-020-00972-1
- iGEM. (2025). An Introduction to Engineering in Synthetic Biology. Retrieved September 29, 2025, from https://technology.igem.org/engineering
- Riaño-Umbarila, L., Contreras-Ferrat, G., Olamendi-Portugal, T., Morelos-Juárez, C., Corzo, G., Possani, L. D., & Becerril, B. (2011). Exploiting cross-reactivity to neutralize two different scorpion venoms with one single chain antibody fragment. Journal of Biological Chemistry, 286(8), 6143–6151.
- Riaño-Umbarila, L., Juárez-González, V. R., Olamendi-Portugal, T., Ortiz-León, M., Possani, L. D., & Becerril, B. (2005). A strategy for the generation of specific human antibodies by directed evolution and phage display. FEBS Journal, 272(10), 2591–2601.
- Ewert, S., Huber, T., Honegger, A., & Plückthun, A. (2003). Biophysical properties of human antibody variable domains. Journal of Molecular Biology, 325(3), 531–553.
- Zahrl, R. J., Prielhofer, R., Burgard, J., Mattanovich, D., & Gasser, B. (2019). Optimized secretion of recombinant proteins in Pichia pastoris pep4 strains. Journal of Biotechndology, 306, 81–89.
- Gómez-Ramírez, I. V., Corrales-García, L. L., Possani, L. D., Riaño-Umbarila, L., & Becerril, B. (2023). Expression in Pichia pastoris of human antibody fragments that neutralize venoms of Mexican scorpions. Toxicon, 223, 107012.
- Riaño-Umbarila, L., Contreras-Ferrat, G., Olamendi-Portugal, T., Morelos-Juárez, C., Corzo, G., Possani, L. D., & Becerril, B. (2011). Exploiting cross-reactivity to neutralize two different scorpion venoms with one single chain antibody fragment. Journal of Biological Chemistry, 286(8), 6143–6151.
- Riaño-Umbarila, L., Juárez-González, V. R., Olamendi-Portugal, T., Ortiz-León, M., Possani, L. D., & Becerril, B. (2005). A strategy for the generation of specific human antibodies by directed evolution and phage display. FEBS Journal, 272(10), 2591–2601.
- Ewert, S., Huber, T., Honegger, A., & Plückthun, A. (2003). Biophysical properties of human antibody variable domains. Journal of Molecular Biology, 325(3), 531–553.
- Zahrl, R. J., Prielhofer, R., Burgard, J., Mattanovich, D., & Gasser, B. (2019). Optimized secretion of recombinant proteins in Pichia pastoris pep4 strains. Journal of Biotechndology, 306, 81–89.
- Gómez-Ramírez, I. V., Corrales-García, L. L., Possani, L. D., Riaño-Umbarila, L., & Becerril, B. (2023). Expression in Pichia pastoris of human antibody fragments that neutralize venoms of Mexican scorpions. Toxicon, 223, 107012.
- Yeast | iGEM Technology. Available from: https://technology.igem.org/chassis/yeast
- Lee, M. E., DeLoache, W. C., Cervantes, B., & Dueber, J. E. (2015). A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly. ACS Synthetic Biology, 4(9), 975-986. https://doi.org/10.1021/sb500366v