Primer Design

Aim

To design primers used for PCR amplification of Intrinsic Factor (IF) inserts, colony PCR for clone screening as well as sequencing verification.

Primer Design for PCR Amplification of IF Inserts

Forward and reverse primers were designed for PCR amplification of IF containing inserts. The primers were designed to be suitable for all inserts utilizing the short adapter sequences used in the gene synthesis of the inserts. The inserts were ordered from Twist Bioscience, and the adapter sequences, that were added to the insert sequences were the following:

5' Adapter: CAATCCGCCCTCACTACAACCG

3' Adapter: CTACTCTGGCGTCGATGAGGGA

These sequences were directly used to create the forward and reverse PCR primers. The primers were then analyzed using the IDT OligoAnalyzer™: Primer analysis tool, and all the information of the primers is gathered in Table 1.

The primers were ordered from IDT as custom oligos with standard desalting as a lyophilized powder.

Primer Design for Colony PCR

For colony PCR, orientation-specific primers were designed using the PrimerQuest™: PCR & qPCR primer design tool from IDT. Forward primers were designed for each IF insert and as the reverse primer, the same 3' AOX1 sequencing primer, from the pGAPZα A expression vector manual, was used for all the inserts.

The Tm and GC% of the primers was checked using the OligoAnalyzer™: Primer analysis tool, and all the info for the primers is collected in Table 2.

The primers were ordered from IDT as custom oligos with standard desalting as a lyophilized powder.

Primer Design for Sequencing Verification

For the sequencing of the recombinant clones, the sequencing primers from the pGAPZα A expression vector manual were used. The sequences for the primers are presented in Table 3.

The primers were ordered from IDT as custom oligos with standard desalting as a lyophilized powder.

Preparation of Primer and Insert Stock Solutions

Aim

To prepare stock solutions of IF inserts and stock solutions as well as working solutions of primers for downstream applications.

Materials & Equipment

1. Chemicals and Reagents

• Lyophilized PCR amplification primers
• Lyophilized Colony PCR primers
• Lyophilized Sequencing Primers
• Lyophilized IF inserts
• Nuclease-free water

2. Consumables

• 1.5 mL microcentrifuge tubes
• Disposable pipette tips

3. Equipment

• Micropipettes (P200, P1000)
• Centrifuge
• Vortex mixer

Protocol

1. Primer Stock and Working Solutions

Stock solutions: 100 μM and working solutions: 5/10 μM

Amounts of the received primers:

• Forward PCR primer: 24.4 nmol
• Reverse PCR primer: 32.5 nmol
• Colony PCR - rat IF (forward): 23.9 nmol
• Colony PCR - human IF (forward): 35 nmol
• Colony PCR - porcine IF (forward): 34.7 nmol
• Colony PCR - bovine IF (forward): 22.5 nmol
• Colony PCR - platypus IF (forward): 32 nmol
• 3' AOX1: 19.6 nmol
• pGAP Forward: 30 nmol

1. Briefly centrifuge the tubes to ensure all the lyophilized primers are at the bottom, to prevent the loss of material when opening the tubes and ensure complete resuspension.
2. Resuspend the lyophilized primers to nuclease-free water to prepare 100 μM stock solutions. Add nuclease-free water based on the amounts of the received primers as follows:
   • Forward PCR primer: 244 μL
   • Reverse PCR primer: 325 μL
   • Colony PCR - rat IF (forward): 239 μL
   • Colony PCR - human IF (forward): 350 μL
   • Colony PCR - porcine IF (forward): 347 μL
   • Colony PCR - bovine IF (forward): 225 μL
   • Colony PCR - platypus IF (forward): 320 μL
   • 3' AOX1: 196 μL
   • pGAP Forward: 300 μL
3. Vortex the tubes gently to ensure the primers are fully dissolved.
4. Centrifuge the tubes briefly after mixing to help collect any residual liquid from the tube walls.
5. Prepare 5 μM working solutions by diluting 5 μL of each primer solution with 95 μL nuclease-free water or 10 μM working solutions by diluting 5 μL of each primer solution with 45 μL nuclease-free water.
6. Store the stock and working solutions in a freezer at -20°C or short term in a fridge at 4°C.

2. IF Insert Stock Solutions - 10 ng/μL

Amounts of the received inserts:

• Human IF insert: 2094 ng
• Rat IF insert: 2286 ng
• Porcine IF insert: 1997 ng
• Platypus IF insert: 2530 ng
• Bovine IF insert: 2148 ng

1. Briefly centrifuge the tubes to ensure all the lyophilized DNA is at the bottom, to prevent the loss of material when opening the tubes and ensure complete resuspension.
2. Resuspend the lyophilized inserts to nuclease-free water to prepare 10 ng/μL stock solutions. Add nuclease-free water based on the amounts of the received inserts as follows:
   • Human IF insert: 209 μL
   • Rat IF insert: 228 μL
   • Porcine IF insert: 200 μL
   • Platypus IF insert: 253 μL
   • Bovine IF insert: 215 μL
3. Vortex the tubes gently to ensure the primers are fully dissolved.
4. Centrifuge the tubes briefly after mixing to help collect any residual liquid from the tube walls.
5. Store the stock and working solutions in a freezer at -20°C or short term in a fridge at 4°C.

PCR Reaction

Gel Electrophoresis

Results

Under these optimized conditions, amplification of the target inserts was successful. The PCR reaction was performed with duplicates, and particularly the amplification of the second duplicate produced strong bands of the correct size (around 1300 bp) in the gel electrophoresis results (figure 1). The amplified PCR products from the second duplicate were subsequently used for purification and other downstream steps.

Figure 1. Gel electrophoresis results for the PCR products. Both of the duplicates produced bands of the correct insert size of around 1300 basepairs, but only the second duplicate produced strong results and thus were chosen for further purification and restriction cloning.

Troubleshooting

PCR amplification was initially performed using the DreamTaq green PCR Master Mix (2X) (Thermo Scientific™), however no visible bands were observed, when the results were checked using gel electrophoresis. Therefore it was decided redo the PCR reaction using Q5Ⓡ High-Fidelity 2X Master Mix (New England Biolabs) optimizing the PCR program for the Q5® High-Fidelity DNA Polymerase. This reaction produced a positive result only for the platypus IF containing insert, so it was decided to try again, using a higher annealing temperature calculated based on NEB Tm calculator results. But again, the reaction worked only for the platypus IF insert.

Since the forward and reverse primers were designed to work for all five IF inserts, and only platypus IF insert was getting amplified, it was decided to simulate the PCR reaction using SnapGene (v.8.1.0), to ensure there hasn't been a mistake in the primer design. As no obvious mistakes were observed, and the simulated PCR reactions worked as intended, it was decided to try the reaction again – this time using the Phusion DNA polymerase (Thermo Scientific™). The annealing temperature for the reaction was calculated using the NEB Tm calculator. The PCR reaction using Phusion DNA polymerase was a success, and the protocol was used for amplifying the inserts for downstream cloning and restriction digestion. You can read more on the troubleshooting process in our wet lab logbook.

Aim

To remove primers, nucleotides, enzymes, and buffer components from the PCR reactions and to concentrate the amplified DNA, yielding products of adequate purity and concentration for restriction digestion and cloning.

Materials & Equipment

1. Chemicals and Reagents

• Nucleospin® Gel and PCR Clean-up Kit (Macherey-Nagel)
• PCR products

2. Consumables

• 1.5 mL microcentrifuge tubes
• Disposable pipette tips

3. Equipment

• Micropipettes (P10, P100, P200, P1000)
• Centrifuge
• DeNovix DS-11 spectrophotometer (or another spectrophotometer suitable for measuring DNA concentration)

Protocol

1. PCR product purification

The PCR products are purified using the Nucleospin® Gel and PCR Clean-up Kit according to the manufacturer's protocol. In short:

1. Adjust DNA binding condition: Mix 45 µL of the PCR product with 90 µL of binding Buffer NTI.
2. Bind DNA: Place a NucleoSpin® Gel and PCR Clean-up Column into a Collection Tube (2 mL) and load up to 700 μL sample. Centrifuge for 30 s at 11,000 x g. Discard flow-through and place the column back into the collection tube. Load remaining sample if necessary and repeat the centrifugation step.
3. Wash silica membrane: Add 700 μL Buffer NT3 to the NucleoSpin® Gel and PCR Clean-up Column. Centrifuge for 30 s at 11,000 x g. Discard flow-through and place the column back into the collection tube.
4. Dry silica membrane: Centrifuge for 1 min at 11,000 x g to remove Buffer NT3 completely. Make sure the spin column does not come in contact with the flow-through while removing it from the centrifuge and the collection tube.
5. Elute DNA: Place the NucleoSpin® Gel and PCR Clean-up Column into a new 1.5 mL microcentrifuge tube. Add 30 μL Buffer NE and incubate at 70 °C for 5 min. Centrifuge for 1 min at 11,000 x g.

2. Measuring DNA concentration and quality using the DeNovix DS-11 spectrophotometer

1. Wipe the Pedestals: Open the arm and carefully wipe both the upper and lower pedestals using a lint-free lab wipe. Wipe the pedestals in between every measurement and after the last measurement.
2. Blank the Instrument using 2 μL of the elution buffer (NE buffer).
3. Measure the DNA concentration for the purified PCR products using 2 μL samples.

Results

The DNA concentrations and quality measured using the DeNovix DS-11 spectrophotometer show that all IF insert samples have good concentrations (121–167 ng/µL), with 260/280 ratios near 1.8, indicating acceptable protein purity. However, low 260/230 ratios (all below the ideal ~2.0) suggest potential contamination with organic compounds or salts. The purity was nevertheless considered sufficient for restriction digestion, as digestion can also be performed with unpurified PCR products.

Troubleshooting

The purification of the PCR products was first carried out using the Monarch® Spin PCR & DNA Cleanup kit (New England Biolabs), but this yielded low DNA concentrations and poor purity. Therefore, the PCR reaction was repeated, until stronger bands were produced in gel electrophoresis. For the second purification attempt, Nucleospin® Gel and PCR Clean-up Kit (Macherey-Nagel) was used, which provided good concentrations and adequate purity.

Aim

To clone IF PCR products into the pGAPZ expression vector by restriction digestion with NotI and XhoI, ligation, and transformation into E. coli for further screening and expression studies.

Materials & Equipment

1. Chemicals and Reagents

• PCR-purified IF gene inserts (Rat, Human, Porcine, Bovine, Platypus)
• pGAPZαA plasmid (NovoPro)
• Restriction enzymes:
  • FastDigest NotI (Thermo Scientific™)
  • FastDigest XhoI (Thermo Scientific™)
• FastDigest buffer (10X) (Thermo Scientific™)
• FastAP alkaline phosphatase (Thermo Scientific™, for vector dephosphorylation)
• LB agar plates supplemented with Zeocin (25 µg/mL)
• 1% agarose gels
• Ethidium bromide solution (0.5 µg/mL)
• Monarch® DNA Gel Extraction Kit (New England Biolabs)

2. Consumables

• Microcentrifuge tubes (implied use with kit and reactions)
• Pipette tips (implied for handling reagents)
• LB agar plates (as solid media base, even though supplemented with Zeocin already listed above)

3. Equipment

• Microcentrifuge
• Incubators (37 °C)
• Water bath
• Heating block
• Gel electrophoresis system (implied with agarose gels + EtBr)
• UV transilluminator / gel documentation system (implied for EtBr visualization)
• DeNovix DS-11 spectrophotometer

Protocol

Restriction Digestion

1. IF PCR product digestion

1. Reaction volume: 30 µL per insert.

2. Setup per sample:

• Insert DNA: 6–8 µL (species-specific volume)
• FastDigest buffer: 3 µL
• NotI: 1 µL
• XhoI: 1 µL
• Nuclease-free water to 30 µL

3. Incubate the mixtures at 37 °C for 7.5 min.
4. Store at −20 °C overnight.

2. Vector digestion + dephosphorylation

1. Dilute the pGAPZ alpha A in nuclease free water.
2. Centrifuge at 5,000 rcf for 5 min.
3. Carefully open the tube and add 20 μl of nuclease-free water to dissolve the DNA.
4. Close the tube and incubate for 10 minutes at room temperature.
5. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
6. Store the plasmid at −20°C.

The amounts used for the digestion of plasmid DNA were calculated and optimized using both the protocols for NotI and XhoI:

• pGAPZ DNA (8 µL, ~2 µg total).
• FastDigest 10X buffer: 2.5 µL
• XhoI: 1 µL, incubated 50 min at 37 °C
• NotI: 1 µL, added after 50 min, incubated 10 min at 37 °C

After the hour-long incubation, FastAP 2 µL added directly; incubated 30 min at 37 °C for the dephosphorylation. The samples were stored overnight at −20 °C.

3. Gel extraction

Gel extraction was done to isolate the desired DNA fragments.

1. Two gels (60g x 2 + 2.5 µl ethidium bromide each) were prepared.
2. Fragments were loaded into every other well
3. The gels were run for a bit over one hour
4. The desired bands were cut using a clean razor blade under UV light.

4. Band purification

• The bands were then purified using the Monarch® DNA Gel Extraction Kit (New England Biolabs), according to the manufacturer's protocol.
• After the purification, the DNA concentration and quality was checked using the DeNovix DS-11 spectrophotometer:

Aim

Ligate IF inserts into dephosphorylated pGAPZ, transform NEB Stable E. coli, and select Zeocin-resistant colonies for downstream screening.

Materials & Equipment

1. Chemicals and Reagents

• Digested, gel-purified IF inserts: rat, human, porcine, bovine, platypus
• pGAPZαA vector (NotI/XhoI-digested and FastAP-dephosphorylated)
• 10X buffer for T4 DNA Ligase with 10 mM ATP (New England Biolabs)
• T4 DNA ligase (StickTogether™ DNA Ligase Buffer (New England Biolabs))
• NEB® Stable Competent E. coli cells (High Efficiency) (New England Biolabs)
• SOC medium
• LB agar + Zeocin (25 µg/mL)

2. Consumables

• Ice
• 1.5 mL microcentrifuge tubes
• Sterile pipette tips
• Sterile spreaders / glass beads

3. Equipment

• 42 °C heat block or water bath (for transformation heat shock)
• 37 °C incubator
• Shaker / orbital shaker (for liquid culture growth)

Protocol

1. Ligation (T4 DNA ligase)

1. Thaw vector, inserts, and ligase buffer on ice.
2. For each insert, assemble a 20 µL ligation:
   • Vector: 50–100 ng (linear pGAPZ)
   • Insert: ~3:1 molar excess vs vector
   • 10X ligase buffer: 2 µL
   • T4 DNA ligase: 1 µL
   • Nuclease-free water to 20 µL

3. Mix gently with the T4 DNA ligase added at the end, quick-spin, and incubate for 1 hour.
4. Set a vector-only control.

2. Transformation into E. coli (NEB Stable)

1. Add 5 µL of each ligation to 50 µL of competent E. coli cells (NEB) in the cold room.
2. Incubate in the cold room on ice for 30 minutes.
3. After incubation, place tubes in a water bath (42°C) for 45 seconds.
4. Immediately place on ice for 2 minutes.
5. Add 450 µL of SOC medium to each tube.
6. Incubate in the 37°C incubator for 1 hour.
7. Plate samples in duplicates - one plate with 50 µL, the other with 250 µL of the sample.
8. Incubate overnight at 37°C.

3. Colony handling (next day)

1. Record colony counts per construct and control.
2. Pick colonies to fresh LB+Zeocin plates or for screening (e.g., colony PCR/miniprep).

Results

• Transformants were obtained for all five IF species on LB + Zeocin plates; negative controls showed fewer colonies.
• Colony PCR identified positives: Rat (3), Human (1), Porcine (3), Bovine (4), Platypus (3), confirming successful ligation-plus-transformation workflow.

Figure 1. E.coli transformation results for rat CBLIF

Figure 2. E.coli transformation results for platypus CBLIF

Figure 3. E.coli transformation results for bovine CBLIF

Figure 4. E.coli transformation results for porcine (pig) CBLIF

Figure 5. E.coli transformation results for human CBLIF

Figure 6. The negative control plates. Less colonies were seen on the 50 μl negative control compared to 250 μl

Aim

To verify which E. coli transformants carried the recombinant pGAPZ plasmid with the intrinsic factor gene insert by performing colony PCR, using primers targeting the insert and vector junctions to confirm proper incorporation of the gene into the plasmid backbone and to identify positive clones for subsequent validation and transformation of Komagataella phaffii (pichia pastoris).

Materials & Equipment

1. Chemicals and Reagents

• colony PCR - rat IF (forward): 23.9 nmol
• colony PCR - human IF (forward): 35 nmol
• colony PCR - porcine IF (forward): 34.7 nmol
• colony PCR - bovine IF (forward): 22.5 nmol
• colony PCR - platypus IF (forward): 32 nmol
• 3´ AOX1 (Reverse Primer): 19.6 nmol
• Sterile nuclease-free water
• Phusion GC buffer (5×)
• dNTP mix (10 mM)
• Phusion DNA polymerase (check the manufacturer brand)
• UltraPure™ Agarose
• GeneRuler 1 kb DNA Ladder
• Gel loading dye
• Electrophoresis running buffer
• Ethidium bromide for staining gels

2. Consumables

• Eppendorf tubes
• 0.2 mL PCR tubes
• Sterile pipette tips (filtered, various sizes)
• Petri dishes with bacterial colonies (transformed E. coli)

3. Equipment

• VWR® PCR Doppio Gradient Thermal Cycler (for PCR)
• Microcentrifuge
• Owl Gel Separation System
• Gel imaging system (UV/blue light transilluminator)
• Micropipettes (P10, P20, P200)
• Vortex mixer
• Freezer (–20 °C, for reagents and suspensions)

Protocol

1. Sample preparation

1. Pick 5 colonies in total from the two transformation plates (50 µL and 250 µL) for each species' CBLIF gene, and resuspend each colony in 20 µL sterile nuclease-free water
2. Label samples according to species and colony number (e.g. rat 1–5, human 1–5, porcine 1–5, bovine 1–5, platypus 1–5)
3. Transfer 10 µL of each suspension to a new tube and store the remainder at –20 °C
4. Centrifuge briefly to pellet debris
5. Use 2 µL of the supernatant as template DNA for colony PCR

2. PCR reaction setup (25 µL total volume)

• 5 µL 5× Phusion GC Buffer
• 0.5 µL 10 mM dNTP mix
• 1.25 µL Adapter primer forward (10 µM working solution)
• 1.25 µL Adapter primer reverse (10 µM working solution)
• 2 µL template DNA
• 0.25 µL Phusion DNA Polymerase
• 14.75 µL nuclease-free water
• Include a negative control with nuclease-free water instead of template DNA

3. PCR cycling conditions

• Initial denaturation: 98 °C for 30 s
• 20 cycles of:

• Final extension: 72 °C for 5 min
• Hold at 4 °C

4. Gel Electrophoresis

1. Prepare an agarose gel with ethidium bromide, as done in previous experiments
2. Mix each PCR product with loading dye, following the same procedure used for gene amplification
3. Load the samples and DNA ladder onto the gel and perform electrophoresis

Results

Figure 1. Gel image after Colony PCR

Figure 2. Gel image after Colony PCR

Colony PCR confirmed that multiple colonies contained the pGAPZ–intrinsic factor construct. We identified 3 positive rat IF containing colonies, 1 positive human IF colony, 3 positive porcine (pig) IF colonies, 4 positive bovine IF colonies, and 3 positive platypus IF colonies. These results indicate that the restriction cloning strategy was successful.

However, only one positive human colony was obtained, which suggests that further optimisation was needed, such as screening more colonies. This limited success may be due to lower transformation efficiency. Due to this reason, 5 more colonies were picked for human IF for colony PCR, but no new IF containing inserts were identified.

Plasmid Miniprep

Aim

To isolate and purify plasmid DNA from the positive PCR colonies to sequencing verification and Komagataella phaffii (pichia pastoris) transformation.

Materials & Equipment

1. Chemicals and Reagents

• positive colonies from colony PCR (see experiment 6 for more info)
• Zeocin™ Selection Reagent 100 mg/mL (Invitrogen)
• low salt LB broth
• PureLink™ Quick Plasmid Miniprep Kit (Invitrogen)
• pGAPZαA plasmid (NovoPro)

2. Consumables

• 15 mL Falcon tubes
• sterile inoculation loops
• 1.5 mL microcentrifuge tubes
• Disposable pipette tips
• 5 mL serological pipette

3. Equipment

• Micropipettes (P10, P20, P200, P1000)
• pipette controller
• shaking incubator at 37°C
• centrifuge
• DeNovix DS-11 spectrophotometer (or another spectrophotometer suitable for measuring DNA concentration)
• Gel electrophoresis equipment

Protocol

1. Prepare overnight cultures for plasmid miniprep

1. Add 25 µL of Zeocin™ (100 mg/mL) to 100 mL low salt LB broth to prepare LB medium with 25 µg/mL Zeocin™.
2. Add 5 mL of the Zeocin™ LB medium to 15 mL Falcon tubes.
3. Inoculate the tubes with the following positive colonies chosen for downstream processes.

2. Plasmid miniprep

The plasmid isolation and purification is done using the PureLink™ Quick Plasmid Miniprep Kit (Invitrogen) according to the manufacturer's protocol, with a few modifications. In short:

1. Optional: Preheat an aliquot of the elution buffer (TE or nuclease-free water) to 65–70°C for eluting DNA.
2. Harvest: Centrifuge 5 mL of the overnight LB-culture at 18,000 × g for 5 min. Remove all medium.
3. Resuspend: Add 250 μL Resuspension Buffer (R3) with RNase A to the cell pellet and resuspend the pellet until it is homogeneous.
4. Lyse: Add 250 μL Lysis Buffer (L7). Mix gently by inverting the capped tube until the mixture is homogeneous. Do not vortex. Incubate the tube at room temperature for 5 minutes.
5. Precipitate: Add 350 μL Precipitation Buffer (N4). Mix immediately by inverting the tube, or for large pellets, vigorously shaking the tube, until the mixture is homogeneous. Do not vortex. Centrifuge the lysate at >12,000 × g for 10 minutes.
6. Bind: Load the supernatant from step 4 onto a spin column in a 2 mL wash tube. Centrifuge the column at 12,000 × g for 1 minute. Discard the flow-through and place the column back into the wash tube.
7. Wash: Add 500 μL Wash Buffer (W10) with ethanol to the column. Incubate the column for 1 minute at room temperature. Centrifuge the column at 12,000 × g for 1 minute. Discard the flowthrough and place the column back into the wash tube.
8. Wash and remove ethanol: Add 700 μL Wash Buffer (W9) with ethanol to the column. Centrifuge the column at 12,000 × g for 1 minute. Discard the flowthrough and place the column into the wash tube. Centrifuge the column at 12,000 × g for 1 minute. Discard the wash tube with the flow-through.
9. Elute: Place the Spin Column in a clean 1.5 mL recovery tube. Add preheated elution buffer (TE buffer or nuclease-free water) to the center of the column. Incubate the column for 1-5 minutes at room temperature or at 70°C (more info on the step below).
10. Recover: Centrifuge the column at 12,000 × g for 2 minutes. The recovery tube contains the purified plasmid DNA. Discard the column.
11. Store plasmid DNA at 4°C (short-term) or store the DNA in aliquots at −20°C (long-term).

3. Analyze the extra human IF colonies using gel electrophoresis

(see experiment 2 for instructions for gel electrophoresis)

1. Load the extra colonies on the gel as well as the empty pGAPZαA vector as a reference.
2. Run the gel and visualize the results under UV-light.

4. Measure DNA concentration and quality using the DeNovix DS-11 spectrophotometer

1. Wipe the Pedestals: Open the arm and carefully wipe both the upper and lower pedestals using a lint-free lab wipe. Wipe the pedestals in between every measurement and after the last measurement.
2. Blank the Instrument using 2 μL of the elution buffer (NE buffer).
3. Measure the DNA concentration for the purified PCR products using 2 μL samples.

Results

After the plasmid minipreps, the additional colonies that possibly contained human IF, were analyzed using gel electrophoresis. This was done by comparing the size of the picked and purified plasmids to an empty vector backbone. Using this approach, one more positive human IF containing colony was identified (named as human 5) that could be used for downstream applications.

Additionally, the DNA concentrations and quality of the samples in the four different plasmid minipreps were measured using the DeNovix DS-11 spectrophotometer. In the first plasmid miniprep (table 1), the quality of the samples was considered good, indicated by the 260/280 values of around 2. The concentrations (36–58 ng/µL) were however quite low and not sufficient for downstream applications, such as plasmid linearization.

In the second elution (table 2), the quality of the samples was good for most of the samples, except for the porcine 2-colony miniprep, which had both a low 260/230 value and 260/280 value. The concentrations (48–202 ng/µL) were higher than in the first plasmid miniprep, but still not sufficient for downstream applications.

In the third plasmid miniprep (table 3), the concentrations of the samples were again quite low (43–76 ng/µL), but the quality was deemed adequate, with the 260/280 values being around 1.8.

After concentrating the samples from the fourth miniprep, the quality of the samples (table 4) was deemed adequate. The concentrations of the samples (53-578 ng/µL) were also quite high, but still not enough for plasmid linearization on its own. Therefore it was decided to combine the samples from all the minipreps and continue to plasmid miniprep, using a higher reaction volume.

Troubleshooting

After the first miniprep, it was realized that the elution was done using TE buffer, which is not optimal for Sanger sequencing. Additionally, the obtained concentrations were quite low, so it was decided to redo the plasmid miniprep. In order to find additional positive colonies for human, 5 extra colonies were picked for the first plasmid miniprep. Although the first batch contained positive human IF containing colonies, the original colonies were all completely used for the plasmid miniprep, so new extra colonies were picked for the second plasmid miniprep.

In the second miniprep the elution was done using nuclease-free water. Even though the concentrations were higher, they were still not sufficient for downstream applications. The extra human IF colonies that were picked were all negative according to the gel electrophoresis results. Additionally, it was realized that human 4-colony was forgotten from the miniprep, so the miniprep was performed for the third time using human 4-colonies as well as picking new extra colonies that possibly contained the human IF insert.

After the third plasmid miniprep another positive human IF colony was discovered that could be used for downstream purposes. However, there still wasn't enough plasmid DNA for downstream applications, so a fourth miniprep was conducted. Since each plasmid miniprep only provided a little amount of plasmid DNA, it was decided to combine the elutions from each miniprep and move forward to plasmid linearization with those. This provided enough DNA for downstream applications, but the low concentration of the elutions was not ideal for plasmid linearization. Due to this reason, it was decided to try to concentrate the samples, starting with the samples from the fourth miniprep. Although this worked, up to 74% of plasmid DNA was lost in the process, so it was decided to continue to linearisation and just use a larger volume in the linearization reaction.

In future, larger DNA input volumes could be used to get higher yields from plasmid miniprep. The yields also varied between colonies, which could reflect plasmid copy number differences or growth variation. Rat and Porcine consistently produced higher yields than Bovine and Platypus. To read more on the troubleshooting process, visit our lab logbook.

Sequencing verification

Aim

To confirm proper insertion of the IF containing inserts to the pGAPZα A vector.

Materials & Equipments

1. Chemicals and Reagents

• plasmid DNA eluted in nuclease-free water (30–100 ng/µL)
• 5 μM working solutions of the sequencing primers:
• pGAP Forward
• 3´ AOX1

2. Consumables

• 1.5 mL microcentrifuge tubes
• Disposable pipette tips
• sequencing barcodes from Genewiz®
• shipping envelopes from Genewiz®
• shipping labels from Genewiz®

3. Equipments

• Micropipette (P10)

Protocol

Samples from the plasmid miniprep elutions done in nuclease-free water were sent from all the colonies confirmed to contain the IF insert. The samples were sent to sequencing using the Sanger sequencing service with pre-mixed tubes from Genewiz® (Azenta Life Sciences), and prepared according to the manufacturer's instructions. In short:

1. Combine 5 μL of purified plasmids with 5 μL of sequencing primer in a 1.5 mL microcentrifuge tube.
2. Add sequencing barcodes to the tubes.
3. Send the samples and analyse the results.

Results

The sequencing results were analyzed using SnapGene (v.8.1.0) by assessing alignments of the sequenced samples against the designed expression constructs (figures 1-10). The results indicate that restriction cloning was successful for most of the samples, since the sequences between the samples and the construct design matched. However, with the rat 5 colony a deletion had occurred (figure 2) and with porcine 4 a substitution point mutation had occurred (figure 6).

Figure 1. SnapGene alignment of the sequenced rat 4 colony against the designed expression construct. The results indicate successful restriction cloning.

Figure 2. A) SnapGene alignment of the sequenced rat 5 colony against the designed expression construct. B) The sequencing results indicate, that a deletion occurred, that led to one codon being missing.

Figure 3. SnapGene alignment of the sequenced human 4 colony against the designed expression construct. The results indicate successful restriction cloning.

Figure 4. SnapGene alignment of the sequenced human 5 colony against the designed expression construct. The results indicate successful restriction cloning.

Figure 5. SnapGene alignment of the sequenced porcine 2 colony against the designed expression construct. The results indicate successful restriction cloning.

Figure 6. A) SnapGene alignment of the sequenced porcine 4 colony against the designed expression construct. B) The results indicate, that a substitution point mutation had occurred, where one nucleotide changed from C to A causing the amino acid to change from glutamine to lysine.

Figure 7. SnapGene alignment of the sequenced bovine 2 colony against the designed expression construct. The results indicate successful restriction cloning.

Figure 8. SnapGene alignment of the sequenced bovine 3 colony against the designed expression construct. The results indicate successful restriction cloning.

Figure 9. SnapGene alignment of the sequenced platypus 4 colony against the designed expression construct. The results indicate successful restriction cloning.

Figure 10. SnapGene alignment of the sequenced platypus 5 colony against the designed expression construct. The results indicate successful restriction cloning.

Troubleshooting

For human colony 4 with the 3’AOX1 primer and human colony 5 with pGAP forward primer, there seemed to be no primer in the first samples, indicated by low quality scores (QS) of 12 and 1 respectively and contiguous read lengths (CRL) of 1. Therefore new samples were sent for those. For human colony 4 with 3’AOX1, the second sequencing was successful, but for human colony 5 with pGAP forward, the QS and CRL were 18 and 205 respectively, indicating poor quality. Two more samples were sent for human colony 5 with pGAP forward and this time the sequencing was successful and the results confirmed that the plasmid sequence was the same as in the designed construct. Read more on the sequencing of the samples in the lab logbook.

Aim

To linearize and purify the isolated plasmid DNA for Komagataella phaffii Transformation.

Materials & Equipments

1. Chemicals and Reagents

• plasmid DNA
• XmJI (AvrII) restriction enzyme kit (Thermo Scientific™)
• MilliQ water
• NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel)

2. Consumables

• 1.5 mL microcentrifuge tubes
• disposable pipette tips

3. Equipments

• Micropipettes (P10, P20, P200)
• centrifuge
• DeNovix DS-11 spectrophotometer (or another spectrophotometer suitable for measuring DNA concentration)
• Gel electrophoresis equipment

Protocol

1. Plasmid Linearization

Plasmid linearization is done using the XmJI (AvrII) restriction enzyme based on the manufacturer's protocol with a few modifications (reaction volume is increased to 200 µL and the amount of AvrIL is reduced due to limited supply). In short:

1. Combine plasmid DNA from all plasmid minipreps in 1.5 mL microcentrifuge tubes.
2. Add nuclease-free water so that the total reaction volume is 200 µL.
3. Add 20 µL 10x Buffer Tango.
4. Add 1 µL of AvrII for every 10 µg of plasmid DNA to be linearized.
5. Mix the samples gently by pipetting up-and-down and spin down for a few seconds.
6. Incubate the samples at 37°C for 3 hours.
7. Inactivate the enzyme by incubation at 80°C for 20 min.

The reaction mixtures are as follows:

2. Analyzing of the linearization products by gel electrophoresis

(see experiment 2 for more info on how to conduct gel electrophoresis)

1. Load samples from both linear and circular plasmids on gels.
2. Run the gels and visualize the results under UV-light.

3. Purification of linearized plasmids

The linearized plasmids are purified using the Nucleospin® Gel and PCR Clean-up Kit according to the manufacturer's protocol section 5.1. In short:

1. Adjust DNA binding condition: Mix 1 volume of sample with 2 volumes of Buffer NTI.
2. Bind DNA: Place a NucleoSpin® Gel and PCR Clean-up Column into a Collection Tube (2 mL) and load up to 700 μL sample. Centrifuge for 30 s at 11,000 x g. Discard flow-through and place the column back into the collection tube. Load remaining sample if necessary and repeat the centrifugation step.
3. Wash silica membrane: Add 700 μL Buffer NT3 to the NucleoSpin® Gel and PCR Clean-up Column. Centrifuge for 30 s at 11,000 x g. Discard flow-through and place the column back into the collection tube.
4. Dry silica membrane: Centrifuge for 1 min at 11,000 x g to remove Buffer NT3 completely. Make sure the spin column does not come in contact with the flow-through while removing it from the centrifuge and the collection tube.
5. Elute DNA: Place the NucleoSpin® Gel and PCR Clean-up Column into a new 1.5 mL microcentrifuge tube. Add 30 μL Buffer NE and incubate at 70 °C for 5 min. Centrifuge for 1 min at 11,000 x g. Repeat the elution to obtain more product.

4. Measuring DNA concentration and quality using the DeNovix DS-11 spectrophotometer

1. Wipe the Pedestals: Open the arm and carefully wipe both the upper and lower pedestals using a lint-free lab wipe. Wipe the pedestals in between every measurement and after the last measurement.
2. Blank the Instrument using 2 μL of the elution buffer (NE buffer).
3. Measure the DNA concentration for the purified PCR products using 2 μL samples.
4. Store purified linearized plasmids at −20 °C until further use.

Results

The gel electrophoresis analysis of the linearized plasmids indicate that the linearization was successful, since a clear difference was seen between the linear and uncut plasmids, with linear plasmid bands occurring at the correct size of approximately 4 400 pb (figures 1 and 2).

Figure 1. Gel electrophoresis comparison of linear and circular plasmid for rat 4, rat 5, human 4, human 5, porcine 2 and porcine 4 samples. The results show a clear difference between the linear and circular plasmids and that the size of the linear plasmids is correct – around 4 400 bp.

Figure 2. Gel electrophoresis comparison of linear and circular plasmid for bovine 2, bovine 3, platypus 4 and platypus 5 samples. The results show a clear difference between the linear and circular plasmids and that the size of the linear plasmids is correct – around 4 400 bp.

The DNA concentration and quality of the samples was measured using the DeNovix DS-11 spectrophotometer, and all samples yielded >1 µg plasmid DNA, which is sufficient for Komagataella phaffii transformation (table 1). The 260/230 ratios of the plasmids were quite low, but this was not considered to be an issue for the transformation.

Troubleshooting

Low 260/230 ratios indicated possible salt or buffer carryover after cleanup. However, literature suggests this does not significantly impact transformation, and some labs even omit purification.

The plasmid dephosphorylation was missed after linearization, and this could increase plasmid self-ligation risk. Since plasmids were used only for yeast transformation and not ligation, this was not considered critical.

Aim

To transform K. phaffii on YPDS plates and prepare sample cultures that would successfully express the IF protein.

Materials & Equipment

1. Chemicals and Reagents

• Yeast extract
• Peptone
• Dextrose
• Zeocin
• Sorbitol
• MilliQ water
• Linearized and purified plasmid DNA

2. Consumables

• Disposable pipette tips
• Plastic inoculation loops
• YPDS plates
• 15 mL falcon tubes
• 0.2 cm cuvettes
• AirOtopTM Enhanced Seals

3. Equipment

• Micropipettes with different volumes
• Shaking incubator
• Multiskan Go spectrophotometer
• Centrifuge
• Centrifuge bottle
• BTX™ Gemini X2 electroporator
• Erlenmeyer flasks (250 mL, 1 L)

Protocol

1. YPD Medium Preparation

1. Dissolve 10 g yeast extract and 20 g peptone in ~800 mL milliQ water
2. Add 20 g glucose and mix until fully dissolved
3. Adjust final volume to 1 L with distilled water
4. Autoclave at 121 °C for 15–20 min

2. Culture Preparation

1. Select colonies from the prepared K. phaffii starter culture plates (X1 and X2)
2. Grow strains in 5 mL of YPD in a 50 mL falcon tube overnight at 30°C
3. Inoculate four 250 mL of fresh medium into 1 L flasks with 0.3 mL of the overnight culture
4. Incubate at 30°C, 100 rpm overnight
5. Switch shaking speed to 200 rpm the following day and grow until OD600 ≈ 1.3
   • OD600 measurements are performed using a Multiskan Go spectrophotometer (Thermo Scientific)
   • Measured OD600 values:
     • X1A: 1.2517
     • X1B: 1.0683
     • X2A: 1.2215
     • X2B: 1.2225
6. Select the culture that reaches the target OD first for competent cell preparation
   • X1A was chosen in this case

3. Preparation of Competent Cells

1. Transfer the culture to a centrifuge bottle
2. Centrifuge at 1500 × g for 5 min at 4 °C
3. Resuspend the pellet in 250 mL ice-cold sterile water (0 °C)
4. Centrifuge again and resuspend pellet in 125 mL ice-cold sterile water (0 °C)
5. Centrifuge and resuspend pellet in 10 mL ice-cold 1 M sorbitol (0 °C)
6. Centrifuge and resuspend final pellet in 1 mL ice-cold 1 M sorbitol (0 °C) to obtain a final volume of ~1.5 mL

4. DNA Preparation for Electroporation

For each transformation, mix 80 µl of competent cells with 1 μg (1.6 μg for Bovine 3) of linearized DNA. Volumes calculated by sample:

5. Electroporation

1. Incubate competent cells mixed with DNA on ice for 5 min
2. Perform electroporation using a BTX™ Gemini X2 electroporator following the manufacturer's protocol for K. phaffii
   1. Used protocols:
      1. https://www.ibiotech.cz/media/files/datasheets/BTX-Gemini-X2-Datasheet.pdf
      2. https://www.btxonline.com/media/wysiwyg/protocol_db/pdfs/PR0250.pdf
3. Immediately after electroporation, add 1 mL ice-cold 1 M sorbitol to each cuvette
4. Transfer contents into sterile 15 mL tubes
5. Incubate at 30°C without shaking for 1 h

6. Plating and Selection

1. After recovery, plate 10 µl, 25 µl, and 100 µl of each culture on YPDS plates containing 100 µg/mL Zeocin
2. Incubate plates at 30°C for 3 days

7. Inoculation into YPD

1. Pipette 10 mL YPD medium and 10 µl 100 mg/mL Zeocin into 15 sterile 15 mL Falcon tubes (3 tubes per selected colony group)
2. After incubation, inspect plates for colony growth
3. Inoculate each tube with 3 different colonies for each species

   Colonies were picked from the selection plates to start the IF expression as follows: 10 mL of YPD medium was pipetted into 18 15 mL falcon tubes (3 tubes each species - 3×4=12, and 3 for both human4 and human5 - 3×2=6) for the inoculation. For human, 3 colonies were picked from both human4 (H4) and human5 (H5), since there wasn't yet confirmation from the sequencing.

   Colonies selected for inoculation are listed in Table 1.

The first tubes (H5 10A, H5 25B, H5 25D, and H4 100A) might have been contaminated, because the plastic inoculation loops that were already used previously and washed in some way. Therefore, four new tubes were prepared using these four colonies (H5 25A, H5 25C, H5 100A and H4 100D).

4. Pipette 50 ml of YPD media into 250 mL erlenmeyer flasks
5. Inoculate 0.1 mL of the cultures shown in Table 1 to the flasks containing the YPD media
6. Cover fasks with AirOtopTM Enhanced Seals
7. Transfer cultures into sterile 250 mL erlenmeyer flasks
8. Place flasks in a shaking incubator at 28°C, 250 rpm
9. Incubate overnight
10. Store transformation selection plates at 4°C after colony picking

Results

After incubation, the plates were inspected for colony growth. These are showcased in the figures below.

Figure 1. Rat 4 is showing multiple colonies on all plates.

Figure 2. Rat 5 showed no colonies.

Figure 3. Platypus 4 is showing strong growth (possible contamination), but individual colonies are available.

Figure 4. Platypus 5 has many suitable individual colonies.

Figure 5. Porcine (pig) 2 has colonies on all plates.

Figure 6. Human 4 shows colonies only on the 100 µl plate.

Figure 7. Human 5: individual colonies on all plates.

Figure 8. Bovine 2 is showing suitable colonies.

Figure 9. Bovine 3 is showing suitable colonies.

Troubleshooting

In some cases, starter cultures showed contamination, indicated by a sour smell. This may have resulted from contaminated colonies or insufficiently sterile inoculation tools.

Some plates, such as Platypus 4, showed unusually strong growth across the surface, raising concerns of contamination. However, individual colonies were still present and could be used for inoculation. In the future, streaking for single colonies before colony picking can help ensure clean starting material.

Additionally, a few of the first inoculated YPD cultures (e.g., H5 10A, H5 25B, H5 25D, and H4 100A) appeared contaminated. This was traced to the reuse of plastic inoculation loops that had only been washed. Replacement cultures were successfully established by inoculating new tubes with freshly picked colonies using unused inoculation loops.

Aim

To monitor the IF expression of K. phaffii cultures by running SDS-PAGE gels for all 15 samples to find the sample cultures with the best IF expression from each species going forward. The goal was to see bands at 50 kDa, which would indicate the expression of the intrinsic factor protein.

Materials & Equipment

1. Chemicals and Reagents

• 30% acrylamide
• 1.5M Tris (pH- 8.8)
• 0.5M Tris (pH-6.8)
• 10% SDS
• APS 10%
• TEMED
• NuPAGE™ LDS Sample Buffer (4X)
• PageRuler™ Prestained Protein Ladder, 10 to 180 kDa
• NuPAGE™ MOPS SDS Running Buffer (20X)
• Tris base
• Glycine
• SDS
• Coomassie Blue R250
• Methanol
• Ethanol
• Acetic acid
• MilliQ water

2. Consumables

• 1.5 mL microcentrifuge tube
• Disposable pipette tips
• NuPAGE™ Bis-Tris Mini Protein Gels, 4–12%, 1.0–1.5 mm

3. Equipment

• Micropipettes with different volumes
• Centrifuge
• Bio-Rad Mini-PROTEAN® Tetra Cell SDS-PAGE set
• Small plastic containers with lids

Protocol

Gel casting

The gels cast for SDS-PAGE runs were made using this protocol for 4 gels:

Separating (15%)

• MilliQ - 7.4 ml
• 30% acrylamide - 16 ml
• 1.5M Tris (pH- 8.8) - 8 ml
• 10% SDS - 320 µl

Mix these and check if the cast is okay by pouring in water. Remove water and add these in the hood:

• APS 10% - 320µl
• TEMED- 32µl

Pour this quickly in the cast and add approximately 1ml of 70% ethanol
Wait 15 to 20 minutes to fully solidify

Stacking (4%)

• MilliQ - 12ml
• 30% acrylamide- 2.46 ml
• 0.5M Tris (pH-6.8) - 5ml
• 10% SDS - 200 µl

Prepare these first, and add the APS and TEMED right before pouring on the gel

• APS 10% - 200 µl
• TEMED - 20 µl

Store gels wrapped in wet paper and plastic wrap and put in 4 °C.

Preparing the SDS buffer and staining/destaining solutions

1. SDS buffer

1. Prepare 800 mL of distilled water in a suitable container
2. Add to the solution:
   • 30.3 g of Tris base
   • 144.4 g of Glycine
   • 10 g of SDS
3. Add MilliQ water until the volume reaches 1 L

2. Coomassie R250 staining solution

1. Dissolve 1g of Coomassie R250 to 300 ml of methanol
2. Add 650 mL of MQ water and 50 mL of acetic acid
3. Stir the solution on a magnetic stirrer for 2 h
4. The solution can be filtered through a Whatman No. 1 paper to remove insoluble dye
5. Store the solution at 20 oC (the solution can be stored for several months)

3. Destaining solution:

1. Mix together:
   • 500 mL MilliQ water
   • 100 mL acetic acid
   • 400 mL methanol
2. Store the solution at 20 oC (the solution can be stored for several months)

Running the gels

1. Take a 100 μL sample from each culture to 1.5 mL eppendorf tubes
2. Centrifuge the tubes at maximum speed (20800 rcf) for 3 min
3. Collect 30 μL of supernatant to separate eppendorf tubes
4. Add 6 μL of loading dye to each tube
5. Heat the samples at 98 oC for 10 min
6. Assemble the SDS-PAGE equipment and install the gels in their place
7. Load the samples to the gel with 6 μL of protein ladder
8. Fill the tank with an SDS buffer (700 mL for 2 gels, 1000 mL for 4 gels)
9. Run the gel at 150 V for 1 hour or until the samples have advanced to the end of the gel
10. Transfer the gels to suitable containers and pour in Coomassie staining solution so that the gel is completely covered
11. Let stain on a slow shaker for 1 h
12. Change the staining solution for the destaining solution
13. Let destain for 1 h
14. Change the destaining solution for MilliQ water and let destain overnight
15. Image the gels once the bands look clear

Collection of the supernatants

1. The expression cultures were kept in 28 oC for 8 days overall
2. After recognizing sufficient expression collect the culture supernatants for purification
3. Centrifuge the samples at 10000g for 35 min at 4°C
4. Store the supernatants in 50 mL falcon tubes at 4°C
5. Store the pellets in -80 °C

Results

The sample cultures were kept in shaking incubators with 250 rpm and with the temperature 28oC. The intrinsic factor expression was monitored for a week by running SDS-PAGE 3 times.

The first sample cultures were named after the inoculated colonies:

• Human 4 100B (H4 100B)
• Human 4 100C (H4 100C)
• Human 4 100D (H4 100D)
• Porcine 2 10A (Pig2 10A)
• Porcine 2 10B (Pig2 10B)
• Porcine 2 10C (Pig2 10C)
• Bovine 2 25A (B2 25A)
• Bovine 2 25C (B2 25C)
• Bovine 3 25A (B3 25A)
• Rat 4 10A (R4 10A)
• Rat 4 10B (R4 10B)
• Rat 4 10C (R4 10C)
• Platypus 4 25C (Plt4 25C)
• Platypus 5 25B (Plt5 25B)
• Platypus 5 25C (Plt5 25C)

Figure 1. IF expression in K. phaffii samples 2 days after the inoculation. A) Order of samples on gel A: ladder, R4 10A, R4 10B, R4 10C, H4 100B, H4 100C, H4 100D, Porcine (Pig)2 10A, Porcine (Pig)2, 10B, Porcine (Pig)2 10C. B) Order of samples on gel B: ladder, B2 25A, B2 25C, B3 25A, Plt4 25C, Plt 5 25B, Plt5 25C

Figure 2. IF expression in K. phaffii samples 4 days after the inoculation. A) Order of samples on gel A:Plt4 25C, Plt5 25B, Plt5 25C, B2 25A, B2 25C, B3 25A, Porcine (Pig)2 10A, Porcine (Pig)2 10B, Porcine (Pig)2 10C, ladder. Order of samples on gel B: ladder, H4100D, H4 100C, H4 100B, R4 10C, R410B, R4 10A

The initial cultures exhibited pronounced signs of contamination (Figure 3), necessitating the inoculation of fresh cultures, which were subsequently monitored for protein expression over the following week. During this period, visible aggregate formation was observed in the cultures.

Figure 3. A) Contamination in the first IF expression cultures, B) Aggregates floating in the second culture

To address this contamination issue, a third batch of cultures was established using newly prepared YPD medium supplemented with Zeocin.

The third batch of sample cultures were named:

• Human 5 25E (H5 25E)
• Human 5 25F (H5 25F)
• Human 5 100G (H5 100G)
• Porcine 2 10G (Pig2 10G)
• Porcine 2 10H (Pig2 10H)
• Porcine 2 10I (Pig2 10I)
• Bovine 2 25A (B2 25A)
• Bovine 3 25B (B3 25B)
• Bovine 3 100A (B3 100A)
• Rat 4 10 G (R4 10G)
• Rat 4 10H (R4 10H)
• Rat 4 10I (R4 10I)
• Platypus 4 25E (Plt4 25E)
• Plt4 25F (Platypus 4 25F)
• Plt5 25G (Platypus 5 25G)

Figure 4. IF expression in K. phaffii samples 1 day after the inoculation of third cultures. A) Order of samples on gel A: ladder, H5 25E, H5 25F, H5 100G, Porcine (Pig)2 10G, Porcine (Pig)2 10H, Porcine (Pig)2 10I, Plt4 25E, Plt4 25F, Plt5 25G. B) Order of samples on gel B: ladder, TEV, B2 25A, B3 25B, B3 100A, R4 10G, R4 10H, R4 10I

Figure 5. IF expression in K. phaffii samples 2 days after the inoculation of third cultures. A) Order of samples on gel A: ladder, H5 25 E, H5 25 F, H5 100 G, Porcine (Pig)2 10 H, Porcine (Pig)2 10 G, Porcine (Pig)2 10 I, B3 25 B, B2 25 A, B3 100 A. B) Order of samples on gel B: ladder, R4 10 G, R4 10 H, R4 10 I, Plt4 25 E, Plt4 25 F, Plt5 25 G

Figure 6. IF expression in K. phaffii samples 3 days after the inoculation of third cultures. A) Order of samples on gel A: ladder, H5 25E, H5 25F, H5 25G, Rat 4 10G, Rat 4 10H, Rat 4 10I, Porcine (Pig) 2 10G, Porcine (Pig) 2 10H, Porcine (Pig) 2 10I. B) Order of samples on gel B: Ladder, Bovine 2 25A, Bovine 3 100A, Bovine 3 25B, Platypus 4 25E, Platypus 4 25F, Platypus 5 25G

Figure 7. IF expression in K. phaffii samples 4 days after the inoculation of third cultures. A) Order of samples on gel A: ladder, H5 25E, H5 25F, H5 25G, Porcine (Pig) 2 10G, Porcine (Pig) 2 10H, Porcine (Pig) 2 10I, Bovine 2 25A, Bovine 3 25B, Bovine 3 100A. B) Order of samples on gel B: ladder, Rat 4 10G, Rat 4 10H, Rat 4 10I, Platypus 4 25E, Platypus 4 25F, Platypus 5 25G

Figure 8. IF expression in K. phaffi samples 5 days after the inoculation of third cultures. A) Order of samples on gel A: ladder, H5 25E, H5 25F, H5 100G, Porcine (Pig) 2 10G, Porcine (Pig) 2 10H, Porcine (Pig) 2 10I, Bovine 2 25A, Bovine 3 25B, Bovine 3 100A. B) Order of samples on gel B: Ladder, Rat 4 10G, Rat 4 10H, Rat 4 10I, Platypus 4 25E, Platypus 4 25F, Platypus 5 25G

After seeing the results from the SDS-PAGE gels, we decided to go forward with the 5 samples with the best expression. All 5 species showed strong bands on one of the samples at about 50 kDa, which is the size of the IF protein.

These were:

• Human 5 25E
• Porcine (Pig) 2 10H
• Bovine 2 25A
• Rat 4 10G
• Platypus 5 25G

Troubleshooting

We noticed several issues during our SDS-PAGE screening. Starter cultures developed a sour smell and a dark color, suggesting contamination despite the use of fresh media and sterile glassware. This could have come from the incubation room, contaminated colonies, or the use of rich media that supports contaminant growth. Cultures also grew more slowly than expected, which may be linked to these contamination issues or to poor incubation conditions. In addition, aggregates appeared in the second culture media, possibly caused by similar factors.

Protein gels stained with Coomassie showed poor results, likely due to an over-diluted or degraded staining solution, which required long staining times.

To troubleshoot, Zeocin was added to our third culture media. Fresh SDS buffer and Coomassie staining solution were also prepared to promote efficiency.

Aim

The goal of this experiment was to express a designed variant of Tobacco Etch Virus (TEV) protease in E. coli and prepare the lysate for subsequent purification steps. The TEV variant used in this work is based on the hyperTEV60 design described by Sumida et al. (2024) [1]. This design was generated using the ProteinMPNN deep learning sequence design framework to improve protein stability, soluble expression, and catalytic efficiency over the parent TEV protease sequence.

HyperTEV60 demonstrated significantly increased yield, thermostability, and catalytic performance compared to traditional TEV designs, making it a suitable choice for efficient His-tag removal in recombinant protein purification, in this case, for our intrinsic factor (IF) proteins.

Materials & Equipment

1. Bacterial strain & plasmids

• E. coli BL21 Star (DE3) co-transformed with pRARE2 plasmid and a pT7-based expression vector encoding HyperTEV60 TEV protease.

Figure 1. Plate provided by our advisor Nicholas Farrell Wijaya

2. Media & reagents

• LB broth
• LB agar plates with kanamycin (25 μg/mL final concentration)
• Kanamycin stock solutions:
  • 20 mg/mL stock solution
  • 10 mg/mL stock solution
• IPTG (Isopropyl β-D-1-thiogalactopyranoside)
• Lysis buffer: 50 mM Na phosphate, 0.5 M NaCl, 0 mM imidazole, pH 8.0
• Ice slurry
• 20% ethanol (for Emulsiflex cleaning)
• Milli-Q water

3. Equipment

• Shaking incubator (capable of 15°C and 37°C)
• Spectrophotometer with OD600 capability and clean cuvettes
• 2 L Erlenmeyer flasks and centrifuge bottles (220 mL)
• Refrigerated centrifuge
• Emulsiflex-C3 cell homogenizer (Avestin)
• Ice bucket and ice
• Micropipettes and sterile tips
• Autoclaved culture tubes and flasks

Protocol

Starter Culture Preparation

1. Pick a single colony of E. coli BL21 Star harboring the TEV expression plasmid from a fresh LB-kanamycin agar plate
2. Inoculate 50 mL LB medium supplemented with kanamycin (25 μg/mL) in an Erlenmeyer flask
3. Grow overnight (~16-20 h) at 37°C with shaking at 200 rpm

Induction Culture

1. Prepare 500 mL LB medium in a 2 L Erlenmeyer flask
2. Add kanamycin to a final concentration of 25 μg/mL (e.g., 625 μL of 20 mg/mL stock or 1250 μL of 10 mg/mL stock)
3. Inoculate with 1-2 mL of overnight starter culture
4. Incubate at 37°C, 200 rpm until OD600 reaches between 0.1 and 0.6
5. Once the desired OD is reached, cool culture on slurry ice for 10 minutes
6. Add IPTG to a final concentration of 0.1 mM
7. Reduce incubation temperature to 15°C and continue shaking at 200 rpm overnight (or for 2 days in some cases, depending on schedule and equipment availability).

Harvesting Cells

1. Transfer culture into centrifuge bottles (max ~220 mL each)
2. Centrifuge at 4000 × g for 15 min at 4°C to pellet cells
3. Discard supernatant and store cell pellets at –20°C until lysis

Analytical expression check

1. Resuspend a small portion of frozen pellet in 45 mM Tris‑HCl pH 8 (~350 µL)
2. Sonicate 6 cycles (10 s on at 30% amplitude, 20 s rest)
3. Spin at max speed (~20,800 rcf) for 3 min, mix 24 µL supernatant with 8 µL loading dye, heat 98°C for 10 min, load for SDS‑PAGE alongside IF lanes

Results

In the first TEV expression attempt, cell growth was slower than expected, with OD₆₀₀ readings of 0.0078 at 1.5 h, 0.0236 at 3 h, and 0.0151 at 4 h after inoculation. Subsequent measurements, taken after switching to clean cuvettes, showed values of 0.0013 at 4 h, 0.0067 at 5.5 h, and 0.0111 at 6 h. The culture was refrigerated overnight and re‑incubated the next day until OD₆₀₀ reached 0.1488, at which point IPTG was added.

Due to a failure of the 15°C shaking incubator immediately after induction, the cultures were shaken at room temperature for approximately 3 h before transfer to a functioning 15.5°C incubator for 2 days.

In the second expression attempt, OD₆₀₀ measurements increased more consistently, reaching 0.0080 at 1.5 h, 0.0099 at 3 h, 0.0126 at 4 h, and 0.0226 at 5.5 h, followed by induction at the target OD range.

Figure 2. SDS-PAGE gel image that expression of TEV was checked

An SDS‑PAGE lane marked "TEV" was loaded after the ladder on the same gel used for IF samples. The sample was a crude supernatant from brief sonication of a pellet aliquot. This lane exhibited a prominent band at the expected TEV protease size (~25 kDa for mature TEV protease), alongside additional bands corresponding to E. coli proteins and potential partially processed TEV species, consistent with successful expression prior to purification.

Discussion & Troubleshooting

The limited growth in the first expression was likely caused by using an overgrown (~20 h) starter culture, which can reduce cell viability and slow exponential growth, compounded by inaccurate OD₆₀₀ readings due to dirty cuvettes. This delayed induction and extended the experiment beyond the available working time. The issue was addressed in the second run by preparing a fresh (~16 h) overnight culture and ensuring all cuvettes were clean before OD measurement. Additionally, the first attempt was affected by a 15°C shaker malfunction immediately after induction, which forced several hours of incubation at room temperature and may have impacted expression efficiency. This was mitigated in later experiments by confirming incubator operation prior to induction. Implementing these changes resulted in normal growth rates, timely induction, and production of lysate suitable for TEV protease purification.

Aim

To purify intrinsic factor proteins expressed in Komagataella pastoris using affinity chromatography, taking advantage of the engineered His-tag to selectively bind the proteins. Following purification, the His-tag was cleaved to obtain the proteins in their native form, ensuring proper folding and functionality for downstream characterisation.

In His-tag affinity chromatography, the histidine residues on the engineered tag have a strong affinity for metal ions such as nickel or cobalt immobilised on the resin. When the protein mixture passes through the column, the tagged intrinsic factor binds to the resin while other proteins are washed away. The bound protein is then eluted using imidazole, which competes with histidine for metal binding sites.

Materials and Equipment

Chemicals and Reagents

• Ni-NTA Superflow resin (Qiagen)
• Binding buffer: 20 mM Tris-HCl, 0.5 M NaCl
• Wash Buffer (1 L, pH 7.5)
• Elution Buffer (200 mL, pH 7.5)
• Binding and Wash Buffer (500 mL, pH 8.0)
• TEV Elution Buffer (100 mL, pH 8.0)
• MilliQ Water
• HEPES powder
• Tris base powder
• Sodium chloride (NaCl) powder
• Imidazole powder
• Glycerol liquid
• NuPAGE™ LDS Sample Buffer (4X)
• PageRuler™ Prestained Protein Ladder, 10 to 180 kDa
• BSA 1% as standard

Consumables

• Amicon Ultra-15 centrifugal filter units, 10 kDa cutoff (MilliporeSigma)
• 15 mL collection tubes (compatible with centrifugal filters)
• Pipette tips (filtered, sterile)

Equipment

• Thermo Scientific Multifuge X3R Centrifuge
• Gravity flow column
• Fraction collection tubes and beakers
• Column stand and clamps
• Micropipettes (P1000, P200, P20)

Recipes for Buffer Preparation

Wash Buffer (1 L, pH 7.5)

• HEPES: 11.92 g
• NaCl: 14.61 g
• Imidazole: 1.36 g
• MilliQ water: up to 1000 mL

Elution Buffer (200 mL, pH 7.5)

• HEPES: 2.38 g
• NaCl: 2.92 g
• Imidazole: 3.40 g
• Glycerol: 20 mL
• MilliQ water: up to 200 mL

Binding and Wash Buffer (500 mL, pH 8.0)

• Tris base: 1.51 g
• NaCl: 8.77 g
• Imidazole: 0.85 g
• MilliQ water: up to 500 mL

TEV Elution Buffer (100 mL, pH 8.0)

• Tris base: 0.303 g
• NaCl: 1.75 g
• Imidazole: 1.705 g
• Glycerol: 10 mL
• MilliQ water: up to 100 mL

Protocol

1. Changing YPD to Binding Buffer for Intrinsic Factor Proteins

1. Add 20 mL of intrinsic factor protein in YPD media to the Amicon Ultra-15 centrifugal filter
2. Centrifuge at 4,000 × g for 30 minutes
3. Discard the flow-through
4. Add the remaining sample to the same filter device and centrifuge again at 4,000 × g for 40 minutes
5. Discard the flow-through
6. Wash the retentate by adding a binding buffer, centrifuge at 4,000 × g for 20 minutes, and repeat if needed
7. Collect the retentate, which now contains the protein in binding buffer

2. Affinity Chromatography Purification for Intrinsic Factor Proteins

1. After replacing the YPD medium with binding buffer, dilute each sample with 12 mL of binding buffer and transfer the protein solution into 15 mL Falcon tubes
2. Add 1 mL of Ni-NTA Superflow resin to each tube and incubate overnight at 4 °C with gentle rotation to allow batch binding of the protein to the resin
3. On the day of purification, check if resin is well suspended and pour the protein sample into gravity column and let the resin sit at the bottom or cork of gravity column and collect flowthrough
4. Wash the falcon tubes with 25ml of wash buffer and pour inside and gravity column while collecting the wash
5. Plug the bottom of the column and add 1.5ml of elution buffer, shake for 10 min, collect elution and put the 1.5 ml tube to the cold room immediately. Repeat 5 times to have five elutions
6. Repeat this for all intrinsic factor samples
7. Check the presence of protein in the purified fractions or elutions by performing SDS-PAGE
8. Prepare the gels following the previously established protocol

3. SDS-PAGE Sample Preparation for Intrinsic Factor Proteins

Prepare samples for SDS-PAGE as follows:

• Lanes 1–5: 20 µL of elution  + 3 µL of loading dye
• Lane 6: 20 µL of flow-through  + 3 µL of loading dye
• Lane 7: 20 µL of wash fraction  + 3 µL of loading dye
• Lane 8: 1 µL of BSA  + 15 µL of nuclease-free water (NFW)  + 3 µL of loading dye
• Lane 9: 2.5 µL of BSA  + 15 µL of NFW  + 3 µL of loading dye

Flow-through and wash fractions were included in the SDS page to check whether there is protein loss during binding and washing steps, and to check whether majority of the target protein was retained by the resin.

1. Mix all samples thoroughly
2. Heat the samples at 98 °C for 10 minutes. A PCR machine was used for heating due to malfunction of the heat block
3. Load the prepared samples onto SDS-PAGE gels, along with 4 µL of protein ladder
4. Run SDS-PAGE according to the previously established gel protocol

Results

Figure 1. SDS-PAGE analysis of purified porcine intrinsic factor after His-tag affinity chromatography. Lane 1: Protein ladder. Lane 2: Flow-through. Lane 3: Wash fraction. Lanes 4–8: Elution fractions 1–5. Lanes 9–10: BSA controls.

Figure 2. SDS-PAGE analysis of purified bovine intrinsic factor after affinity chromatography. Lane 1: Protein ladder. Lane 2: Flow-through. Lane 3: Wash fraction. Lanes 4–8: Elution fractions 1–5. Lanes 9–10: BSA controls.

Figure 3. SDS-PAGE analysis of purified rat intrinsic factor after affinity chromatography. Lane 1: Protein ladder. Lane 2: Flow-through. Lane 3: Wash fraction. Lanes 4–8: Elution fractions 1–5. Lanes 9–10: BSA controls.

Figure 4. SDS-PAGE analysis of purified human intrinsic factor after affinity chromatography. Lane 1: Protein ladder. Lane 2: Flow-through. Lane 3: Wash fraction. Lanes 4–8: Elution fractions 1–5. Lanes 9–10: BSA controls

Figure 5. SDS-PAGE analysis of purified platypus intrinsic factor after affinity chromatography. Lane 1: Protein ladder. Lane 2: Flow-through. Lane 3: Wash fraction. Lanes 4–8: Elution fractions 1–5. Lanes 9–10: BSA controls

Discussion

SDS-PAGE analysis of purified intrinsic factor proteins after affinity chromatography revealed bands of different intensities across the elution fractions. The elution lanes for rat and bovine intrinsic factor showed clearer bands compared to the other species. For porcine, human, and platypus samples, the bands in the elution fractions were faint, which may reflect lower concentrations of protein in these samples.

Troubleshooting

During purification of the intrinsic factor proteins, there were some challenges that had to be addressed first.

1. YPD Medium Interference with Ni-NTA Resin

We observed that components of the YPD medium interfered with the Ni-NTA Superflow resin. Peptides and amino acids present in yeast extract and peptone likely chelated nickel ions and stripped Ni²⁺ from the resin, leading reduced binding efficiency of the His-tagged proteins and loss of the resin's characteristic blue colour after imidazole elution [2].

2. Bio-Rad NGC UV Detector Failure

During purification experiments, the Bio-Rad NGC single-wavelength UV detector failed despite being lightly used and expected to last for decades. This problem mirrored earlier failures with our PI's Bio-Rad NGC Multiwavelength Monitor, where costly lamp replacements failed after only two years. In contrast, the Xenon flash lamps in the Äkta Explorer system have functioned reliably for decades with minimal replacements. Warranty claims were complicated because the Bio-Rad software resets lamp usage data after failure, leaving no record of premature breakdown. Negotiations with Bio-Rad are ongoing, but due to these technical issues and uncertainty about repair, the NGC system could not be used. This caused about a one-week delay in the project before alternative strategies were adopted.

Materials and Equipment

Equipment

• Emulsiflex C-3 high-pressure homogenizer (with cooling loop and all tubing) (Paavilainen Lab in University of Helsinki)
• Recirculating chiller or ice bath (to maintain ~4°C at the heat exchanger)
• House air supply (~7 bar)
• Milli-Q water and 20% ethanol (for cleaning and storage)
• Detergent (e.g., Deconex) for post-use cleaning
• E. coli cell pellet expressing TEV protease (from 50 mL cell suspension, as per your experiment)
• Lysis buffer
• 50 mL conical tubes (for lysate collection)
• Refrigerated centrifuge (≥20,000 × g, 45 min)
• Gravity flow column
• Fraction collection tubes and beakers
• Column stand and clamps
• Micropipettes (P1000, P200, P20)

Emulsiflex C-3 Lysis Protocol for TEV Protease

1. Instrument Preparation

1. Start the cooling system and allow the Emulsiflex heat exchanger to reach ~4°C
2. Power on the Emulsiflex and open the house air valve (~7 bar)
3. Evacuate 20% ethanol from the system by flushing with Milli-Q water twice
4. Optionally, flush once with lysis buffer to minimize sample dilution

2. Sample Loading

1. Resuspend the E. coli cell pellet thoroughly in a lysis buffer (use ~1 mL buffer per 0.1 g wet cell pellet, or as needed for a homogenous suspension)
2. Load the cell suspension (~50 mL) into the sample cylinder
3. Ensure the sample intake tube is submerged and free of bubbles

3. Cell Disruption

1. Release the STOP button and press START to begin pumping
2. Gradually increase the air pressure to engage flow, then raise to the desired lysis pressure (typically 15,000–20,000 psi for E. coli)
3. Pass the sample through the Emulsiflex at least two times to ensure efficient cell disruption. For small volumes, you may cycle the output back into the input to achieve multiple passes
4. Monitor the temperature and keep the system cold throughout

4. Lysate Collection

1. After the final pass, reduce the pressure slowly to 0 psi
2. Collect the lysate into pre-chilled 50 mL tubes
3. To recover residual lysate, add 5-10 mL lysis buffer to the sample cylinder and pump through the system

5. Clarification

1. Centrifuge the lysate at ≥20,000 × g for 45 minutes at 4°C to remove cell debris
2. Carefully transfer the clarified supernatant to a clean tube for downstream applications

Figure 6. TEV Protease lysis with Emulsiflex C-3. A) Instrument preparation, B) Cell disruption, C) After the centrifugation of lysate

6. Cleaning and Storage

1. Flush the Emulsiflex with 250 mL Milli-Q water, then with 20% ethanol for storage
2. If needed, clean with detergent and rinse thoroughly before the final ethanol flush

Purification of TEV Protease

1. After transferring clarified lysate to a clean tube, pipette 100 µL of the clarified lysate (from the ~100 mL supernatant) for SDS-PAGE analysis to test for TEV protease expression (to be done later)
2. Add 5 mL of Ni-NTA resin to the 100 mL TEV lysate supernatant
3. Incubate the mixture for 30 minutes at 4 °C with gentle rotation to allow binding of TEV protease to the resin
4. Transfer the resin–lysate mixture into a gravity column and allow the resin to settle at the bottom. Collect the flow-through
5. Wash the column with 100 mL of wash buffer and collect the wash fraction
6. Elute the bound TEV protease using TEV elution buffer
7. Plug the bottom of the column and add 5 mL of elution buffer
8. Gently shake the resin for 10 minutes
9. Collect the eluted fraction in a 5 mL tube and place it in the cold room immediately
10. Repeat this step five times to obtain five elution fractions of TEV Protease

SDS-PAGE Analysis After TEV Protease Purification

Sample Preparation

1. Wash and flow-through: 10 µL sample + 3 µL loading dye
2. Cell lysate: 5 µL sample + 3 µL loading dye
3. Elutions 1–5: 5 µL sample + 3 µL loading dye
4. BSA (1 µL standard): 1 µL BSA + 5 µL nuclease-free water (NFW) + 3 µL loading dye
5. BSA (3 µL standard): 3 µL BSA + 5 µL NFW + 3 µL loading dye
6. Mix each sample thoroughly
7. Heat all samples at 98 °C for 10 minutes
8. After heating, load the samples onto the SDS-PAGE gel
9. Run electrophoresis under standard conditions as previously established for protein separation

Results

Figure 7. SDS-PAGE analysis of TEV protease following affinity chromatography. Lane 1: Protein ladder. Lane 2: Cell lysate. Lane 3: Flow-through. Lane 4: Wash fraction. Lane 5: Empty. Lane 6: Elution 1. Lane 7: Empty. Lane 8: Elution 2. Lane 9: Empty. Lane 10: Elution 3. Lane 11: Elution 4. Lane 12: Elution 5. Lanes 13–14: BSA standards.

The gel shows a clear band at the expected size for TEV protease in the elution fractions. The strongest bands are seen in Elution 2 and Elution 3, while weaker bands are present in Elutions 1, 4, and 5. The wash and flow-through lanes contain only faint signal, which suggests that most of the protease was retained on the column and came off mainly during the elution steps. The cell lysate lane contains many background proteins, as expected before purification. Overall, these results indicate that TEV protease was expressed and recovered in good amounts, and the purification worked well to enrich it in the elution fractions.

Aim

The aim of the His-tag cleavage step is to remove the polyhistidine tag from the recombinant protein after purification, thereby yielding the native form of the protein without additional residues that could interfere with its structure or function. This is achieved by using a site-specific protease, such as TEV protease, which recognises a defined amino acid sequence engineered between the His-tag and the target protein and cleaves precisely at that site. The cleavage allows recovery of the untagged protein in a form suitable for downstream applications, including structural studies, functional assays, or therapeutic use [3].

Materials and Equipment

Chemicals and Reagents

• Intrinsic Factor elutions from purification
• Purified TEV protease
• BSA 1%

Consumables

• Amicon Ultra-15 centrifugal filter units, 10 kb cutoff (MilliporeSigma, Cat. No. UFC9010)
• 15 mL collection tubes (compatible with centrifugal filters)
• Pipette tips (filtered, sterile)

Equipment

• Thermo Scientific Multifuge X3R Centrifuge
• Rotary Shaker
• Micropipettes (P1000, P200, P20)

Protocol

1. Pool all five elution fractions obtained from the previous affinity chromatography step to obtain a total volume of approximately 7.5 mL for each intrinsic factor protein sample
2. Transfer the combined elution sample into a centrifugal filter unit with a molecular weight cut-off (MWCO) of 10 kDa
3. Centrifuge the filter units at 4,000 × g for 1.5 hours at 4 °C
4. Monitor the retentate volume periodically and continue centrifugation until the final volume is reduced to ~500 µL
5. Mix the concentrated sample gently by pipetting to ensure homogeneity
6. Collect the final concentrated intrinsic factor protein from the retentate chamber
7. Store the concentrated protein at 4 °C for short-term use or at –80 °C for long-term storage
8. After concentrating the intrinsic factor protein, SDS-PAGE was performed again to confirm the presence and purity of the protein. The concentrated samples were mixed with loading dye in the same proportions as used previously, and a protein ladder was included for molecular weight reference. BSA was also run as a standard, prepared with the same volumes and conditions as in the earlier SDS-PAGE following purification
9. Following SDS-PAGE confirmation of protein presence and purity, each intrinsic factor sample was incubated overnight at 4 °C with 10 µL of the first TEV elution, using a rotary shaker to facilitate cleavage

His-Tag Cleavage Results

Figure 8. SDS-PAGE analysis of concentrated intrinsic factor protein eluates from different species after His-tag affinity purification. Lane 1: Protein ladder. Lanes 2–6: Concentrated eluates of intrinsic factor from human, rat, platypus, bovine, and porcine (pig), respectively. Lanes 7–8: BSA standards.

Following concentration of the eluted fractions of intrinsic factor, protein bands were observed with different intensities across the different species. Rat and bovine samples showed more distinct bands near the expected molecular weight, whereas the human, platypus, and porcine samples displayed much fainter signals. The BSA controls ran as expected and served as a reference for protein detection and intensity.

Materials (Emulsiflex Lysis for TEV Protease)

• Emulsiflex C-3 high-pressure homogenizer (with cooling loop and all tubing)
• Recirculating chiller or ice bath (to maintain ~4°C at the heat exchanger)
• House air supply (~7 bar)
• Milli-Q water and 20% ethanol (for cleaning and storage)
• Detergent (e.g., Deconex) for post-use cleaning
• E. coli cell pellet expressing TEV protease (from 50 mL cell suspension, as per your experiment)
• Lysis buffer (50 mM Na phosphate, 0,5 M NaCl, 0 mM imidazole, pH 8.0)
• 50 mL conical tubes (for lysate collection)
• Refrigerated centrifuge (≥20,000 × g, 45 min)

Emulsiflex C-3 Lysis Protocol for TEV Protease

1. Instrument Preparation

• Start the cooling system and allow the Emulsiflex heat exchanger to reach ~4°C.
• Power on the Emulsiflex and open the house air valve (~7 bar).
• Evacuate 20% ethanol from the system by flushing with Milli-Q water twice. Optionally, flush once with lysis buffer to minimize sample dilution.

2. Sample Loading

• Resuspend the E. coli cell pellet thoroughly in lysis buffer (use ~1 mL buffer per 0.1 g wet cell pellet, or as needed for a homogenous suspension).
• Load the cell suspension (~50 mL) into the sample cylinder.
• Ensure the sample intake tube is submerged and free of bubbles.

3. Cell Disruption

• Release the STOP button and press START to begin pumping.
• Gradually increase the air pressure to engage flow, then raise to the desired lysis pressure (typically 15,000–20,000 psi for E. coli).
• Pass the sample through the Emulsiflex at least two times to ensure efficient cell disruption. For small volumes, you may cycle the output back into the input to achieve multiple passes.
• Monitor the temperature and keep the system cold throughout.

4. Lysate Collection

• After the final pass, reduce the pressure slowly to 0 psi.
• Collect the lysate into pre-chilled 50 mL tubes.
• To recover residual lysate, add 5–10 mL lysis buffer to the sample cylinder and pump through the system.

5. Clarification

• Centrifuge the lysate at ≥20,000 × g for 45 minutes at 4°C to remove cell debris.
• Carefully transfer the clarified supernatant to a clean tube for downstream applications.

6. Cleaning and Storage

• Flush the Emulsiflex with 250 mL Milli-Q water, then with 20% ethanol for storage.
• If needed, clean with detergent and rinse thoroughly before the final ethanol flush.

Aim

The aim of this experiment was to produce the cubilin receptor protein (domains 5-8) in E. coli for downstream binding assays with intrinsic factor (IF)-vitamin B12 complexes from different species.

The construct design was based on the crystal structure analysis of the IF-Cbl-cubilin complex reported by Andersen et al. (2010) [4] which identified CUB domains 5-8 as the main IF-vitamin B12 binding region.

We designed a codon-optimized insert for E. coli, presented in figure 1, which contains:

• 6xHis- and 8xHis-tags for protein purification
• Cubilin domains 5–8
• eGFP for visual monitoring of expression and detection of IF-cubilin binding
• TEV site for future removal of the tags if desired

Figure 1. The designed insert for expressing CUB domains 5-8. In addition to the domains, the insert contains 6xHis- and 8xHis-tags for protein purification, eGFP for visual monitoring of expression and IF-cubilin binding and a TEV site for future removal of the tags if desired.

The insert was ordered from IDT cloned in their pET-IDT expression vector stored in an E.coli glycerol stock.

The goal was to express soluble cubilin domains 5-8 fused to eGFP in E. coli expression strains, verify protein production via SDS-PAGE and fluorescence, and prepare cell pellets for later binding experiments. The binding experiments were however not completed due to time constraints.

Materials & Equipment

1. Plasmid & Strains

• Codon-optimized cubilin domains 5–8 construct in expression vector
• E. coli strains: BL21 Star, BL21 Star pRARE2 (both competent)

2. Media & Reagents

• LB broth and LB agar + kanamycin (25 μg/mL final conc.)
• SOC medium (for recovery after transformation)
• IPTG (100 mM stock)
• PureLink™ Quick Plasmid Miniprep Kit (Invitrogen)
• TE buffer
• Tris-HCl (45 mM, pH 8.0)
• Coomassie Blue stain and destaining solution
• MilliQ water

3. Equipment

• Shaking incubator (capable of 170-200 rpm)
• Centrifuge (capable of 15,000 × g)
• Heat block
• Spectrophotometer (DeNovix DS-11)
• Agarose gel electrophoresis system
• SDS-PAGE system
• UV transilluminator
• Fisherbrand™ Model 120 Sonic Dismembrator
• Pipettes with sterile tips
• 1.5 mL Eppendorf tubes & 50 mL Falcon tubes
• Parafilm

Protocol

As a prior note, we describe here the successful second transformation procedure; the first transformation attempt is reported in Results as part of troubleshooting.

Plasmid Isolation

1. Take 5 mL overnight bacterial culture (from glycerol stock inoculation) into 15 mL Falcon tubes
2. Centrifuge 4,000 × g, 15 min, RT; discard supernatant
3. Resuspend pellet in 250 μL Resuspension Buffer (R3)
4. Transfer to 1.5 mL sterile Eppendorf tube
5. Add 250 μL Lysis Buffer (L7); gently invert 5-7 times
6. Add 350 μL Precipitation Buffer (N4); invert until homogeneous white precipitate forms
7. Centrifuge 15,000 × g, 10 min, RT
8. Transfer clear supernatant to spin column
9. Centrifuge 12,000 × g, 1 min; discard flowthrough
10. Wash with 500 μL W10 buffer (with ethanol); centrifuge 12,000 × g, 1 min
11. Wash with 700 μL W9 buffer; centrifuge 12,000 × g, 1 min
12. Spin empty column 1 min at 12,000 × g; open lid in fume hood for 2 min to evaporate ethanol (modification from first attempt)
13. Elute twice with 20 μL TE buffer at 70°C, incubating 5 min each time; centrifuge 12,000 × g, 2 min

Transformation into BL21 Star and BL21 Star pRARE2

1. Thaw competent cells on ice
2. Add 5 μL plasmid DNA to 50-100 μL competent cells (depending on tube volume)
3. Flick gently; incubate on ice 30 min
4. Heat shock at 42°C for 45 sec
5. Place on ice for 2 min
6. Add 1 mL SOC medium; incubate 37°C, 200 rpm, 1 h
7. Plate 250 μL onto LB + kanamycin agar; incubate overnight at 37°C

Expression Induction

1. Pick colonies:
   • BL21 Star pRARE2 Cubilin 1
   • BL21 Star Cubilin 2A
2. Inoculate into 50 mL LB + kanamycin in 250 mL flasks
3. Incubate overnight at 37°C, 170 rpm
4. Monitor OD₆₀₀ until 0.4–0.6
5. Cool cultures on ice for 10 min
6. Induce with 0.1 mM IPTG
7. Shift temperature to 15–16°C, 200 rpm, for 2 days

Cubilin Expression Monitoring

1. Sample 1 mL at 24 h and 48 h
2. Pellet cells, resuspend in 200 μL 45 mM Tris-HCl
3. Sonicate (6 cycles: 10 sec at 20% amplitude, 20 sec rest)
4. Observe fluorescence under UV (eGFP tag)
5. Prepare SDS-PAGE samples from supernatant

Final SDS-PAGE of Cubilin

1. Harvest cultures by centrifuging at 4,000 × g, 15 min, 4°C
2. Store pellets at -20°C
3. Thaw, resuspend in Tris-HCl
4. Sonicate, centrifuge, prepare SDS-PAGE sample
5. Run gel, stain with Coomassie, destain overnight

Results

1. Transformation Attempts

The initial transformation attempt using BL21 Star and BL21 Star pRARE2 strains yielded no colonies on LB + kanamycin plates. Spectrophotometer measurements showed plasmid DNA concentrations and poor 260/230 ratios as shown in Table 1, indicating contamination and low purity. These poor yields were likely due to incomplete ethanol removal during the wash steps and possibly inefficient elution. The lack of colonies was therefore attributed to insufficient plasmid quantity and quality.

For the second attempt, modifications to the miniprep protocol were implemented: an ethanol evaporation step in a fume hood, hot elution at 70°C, and double elution. These changes produced a dramatic improvement in plasmid concentration and purity, with Cubilin plasmid 1 at 29,357 ng/μL (260/280 = 1.82) and Cubilin plasmid 2 at 97,053 ng/μL (260/280 = 1.89). The high yields and near‑ideal purity ratios indicated that the DNA was suitable for transformation.

2. Bacterial Growth and OD₆₀₀ Monitoring

Following successful transformation, single colonies from BL21 Star pRARE2 (Cubilin 1) and BL21 Star (Cubilin 2A) were grown in LB + kanamycin.

Figure 2. Transformation plates of A) Cubilin 1 - BL21 Star pRARE2, B) Cubilin 2A - BL21 Star

OD₆₀₀ monitoring revealed that BL21 Star Cub2A reached the induction range (0.4-0.6) earlier than pRARE2 Cub1, which grew more slowly, as it is shown in Figure 3. This difference may reflect the metabolic burden of rare codon tRNA supplementation in pRARE2 or differences in expression dynamics.

Figure 3. OD600 time-course growth of BL21 star strains expressing Cubilin variants. OD600 measurements were recorded between 2-7.5 hours post-inoculation and plotted as mean trajectories for each sample label to visualize lag and early exponential growth phases. In this dataset, OD rises modestly early and then accelerates after ~5 h, consistent with cells exiting lag and entering exponential growth; the Cub2A series increases more steeply than pRARE2 Cub1 across matching timepoints, suggesting faster growth under the recorded conditions.

3. Fluorescence Observation

Cell lysates collected at 24 h and 48 h post‑induction showed strong green fluorescence under UV light for both Cubilin 1 and Cubilin 2A, in contrast to water controls. This confirmed successful expression of the eGFP‑tagged cubilin fusion proteins without the need for immediate SDS‑PAGE analysis.

Figure 4. Florence observation of cubilin lysates

4. SDS‑PAGE Expression Analysis

SDS‑PAGE gels run on samples from both time points revealed protein bands close to the predicted molecular weight of the fusion protein (~81.8 kDa). Bands were observed for both Cubilin 1 and Cubilin 2A at 24 h and 48 h, indicating continued expression. The presence of bands in the soluble fraction suggested that at least part of the expressed protein was soluble.

5. Final SDS‑PAGE of Harvested Cells

After harvesting and lysing the induced cultures, SDS‑PAGE analysis again showed clear bands at the expected size in both Cubilin 1 and Cubilin 2A samples. While no purity assessment was carried out, the visibility of the target band in crude lysates confirmed that substantial amounts of the protein were produced.

Figure 5. SDS-PAGE gel images of cubilin. A) 5. SDS-PAGE expression analysis, B) Final SDS-PAGE of harvested cells

And unfortunately, the planned IF-B12-cubilin complex binding assay was not performed within the timeframe of this experiment, so no functional activity data are available.

Discussion & Troubleshooting

This experiment our our team aimed to express the vitamin B₁₂ receptor fragment of cubilin, specifically CUB domains 5-8, in E. coli. These domains were chosen based on structural data from Andersen et al. [4] which identified them as the minimal unit necessary for IF-vitamin B12 binding. The construct incorporated an N‑terminal eGFP for direct fluorescence monitoring and a TEV cleavage site for optional removal of the tag, and was codon‑optimized for E. coli to improve expression efficiency.

A key hurdle encountered was the failed first transformation, which was traced back to low plasmid yield and contamination. This highlights how critical plasmid prep quality is for transformation efficiency. The implemented modifications such as ethanol evaporation and heated double elution are straightforward yet highly effective changes that increased plasmid yield by several orders of magnitude and improved purity to near‑ideal spectrophotometric ratios.

The successful second transformation underscores the importance of DNA quality control prior to downstream steps. Both BL21 Star and BL21 Star pRARE2 produced detectable protein, but the growth rate differences point to strain‑specific trade‑offs: pRARE2 may better handle rare codons but at the expense of slower culture growth. This may impact yield over large‑scale cultivation.

Fluorescence imaging provided a rapid, non‑invasive readout of expression success, validating the inclusion of eGFP in the design. SDS‑PAGE confirmed that the expressed protein matched the predicted size and was at least partially soluble, which is encouraging for future purification and functional assays.

However, several questions remain. Protein functionality was not tested, so it is unknown whether the recombinant cubilin retains native folding and binding activity. Given the complex Ca²⁺‑dependent binding mechanism described in the structural study, expression in E. coli may yield protein that requires refolding or co‑factor supplementation for full activity. Furthermore, multiple disulfide bonds of cubilin and glycosylation in its native context are not replicated in E. coli, which may impact stability and affinity. To address all these, we suggest that the future work should include:

• Small‑scale purification trials to assess yield, solubility, and purity
• Binding assays with IF-B12 complexes from human and other species to determine cross‑species compatibility
• Testing expression in alternative systems (like eukaryotic hosts for glycosylation)
• Structural verification by circular dichroism or limited proteolysis to evaluate folding
• Optimization of induction parameters to balance yield and solubility

Overall, the experiment achieved its short‑term goal of producing visible, SDS‑PAGE‑verifiable cubilin CUB 5-8 protein in E. coli, laying the groundwork for functional binding studies and comparative ligand specificity analysis in future experiments.

Aim

The aim of this experiment was to perform size exclusion chromatography (SEC) to further purify recombinant intrinsic factor (IF) proteins from different species (Human, Platypus, Bovine, Rat, Pig) after affinity chromatography. SEC was used to separate proteins based on molecular size, remove residual contaminants, and obtain pure protein fractions suitable for downstream binding assays and structural analysis.

Materials & Equipment

1. Materials

• Affinity-purified recombinant intrinsic factor proteins (Human, Platypus, Bovine, Rat, Porcine (Pig))
• Protein buffer (prepared by our advisor Nicholas; matched to IF elution buffer)
• Milli-Q water (sterilized and degassed via autoclave)
• 20% ethanol (EtOH) for storage and cleaning
• Nuclease-free collection tubes (sterile)
• 1 mL plastic syringes
• SDS-PAGE reagents and ladder (same materials explained in prior experiments)
• Binding buffer for downstream assays

2. Equipment

• ÄKTA Purifier system (GE/Cytiva), fitted with fraction collector
• Superdex 200 Increase 10/300 GL column (Cytiva)
• Autoclave for degassing water
• UV detector (280 nm) and conductivity monitor on ÄKTA
• Refrigerated centrifuge
• Nanodrop spectrophotometer
• Laboratory freezer and ice bucket

Protocol

Device Preparation

1. Booking & Preparation

1. Reserved time on ÄKTA calendar
2. Filtered all buffers through 0.2 μm membrane and degassed
3. Filtered protein samples through 0.5 μm syringe filters to remove particulates

2. Column Washing & Equilibration

1. Connected Superdex 200 Increase 10/300 GL column using the "dripping technique" to avoid introducing air bubbles
2. Switched A1 inlet to Milli-Q water
3. Pumped Milli-Q water through Pump A at 0.25 mL/min, column position 2
4. Washed column with 75 mL volume
5. Changed wash buffer to protein buffer for equilibration

3. Mock Run for Calibration

1. Loaded 500 μL eGFP protein (mock sample) via injection port; avoided air bubbles
2. Ran "iGEM SEC Program" manually, monitored UV280 and conductivity until baseline stabilized
3. Determined delay between UV peak and fraction collection (~750 μL delay)

4. Fraction Collector Calibration

1. Adjusted delay UV-to-frac on Frac-920 collector to 750 μL
2. Collected the most intense green fractions (from eGFP run) for the second mock run

Figure 1. A) Program run from eGFP mock run, B) The UV peak from 2nd mock run, C) ÄKTA Purifier system (GE/Cytiva)

SEC Run for IF Samples

1. Incubated IF and TEV protease overnight at 4°C with rotation (for His-tag cleavage)
2. Loaded 500 μL IF sample into injection port, avoiding bubbles
3. Ran SEC program with:
   • Flow rate: 0.75 mL/min (column recommended rate)
   • UV monitoring at 280 nm
   • Fraction volume: matched to delay calibration
4. Collected elution fractions starting at peak onset
5. Run SDS-PAGE for each set of fractions to confirm protein presence

Fraction Selection Based on SEC Graphs and SDS-PAGE

From UV peaks and SDS-PAGE results:

• Human IF → Fractions 52–56
• Platypus IF → Fractions 51–55
• Bovine IF → Fractions 55–63
• Rat IF → Fractions 55–63
• Pig IF → No significant peak or SDS-PAGE band detected → excluded from further analysis

Results

The size exclusion chromatography (SEC) runs using the Superdex 200 Increase 10/300 GL column produced distinct elution profiles for the five intrinsic factor (IF) protein samples. In the UV chromatograms, Bovine IF displayed a pronounced peak between fractions ~62–76, corresponding to the expected elution volume for a ~55-60 kDa protein, and this peak was mirrored by clear, strong bands in the SDS‑PAGE gel (Figure 2B), confirming successful separation.

Figure 2. A) SEC peak results from bovine IF, B) SDS-PAGE of selected fractions from bovine SEC run

Similarly, rat IF produced a high, well‑defined peak in the same elution range, with SDS‑PAGE showing bands at the target molecular weight (Figure 3B), indicating good purity and recovery.

Figure 3. A) SEC peak results from rat IF, B) SDS-PAGE of selected fractions from rat SEC run

Platypus IF showed a small UV peak, just above baseline, and weak SDS‑PAGE staining (Figure 4), consistent with low recovery from SEC.

Figure 4. A) SEC peak results from platypus IF, B) SDS-PAGE of selected fractions from platypus SEC run

Human IF gave only a modest peak in the chromatogram and faint gel bands (Figure 5), suggesting lower yield or partial degradation during processing.

Figure 5. A) SEC peak results from human IF, B) SDS-PAGE of selected fractions from human SEC run

In contrast, porcine (pig) IF produced no discernible peak in the UV trace and showed no visible bands in SDS‑PAGE, indicating either poor upstream expression, misfolding, or degradation prior to purification; this sample was therefore omitted from subsequent concentration and binding assays.

Figure 6. A) SEC peak results from porcine (pig) IF, B) SDS-PAGE of selected fractions from porcine (pig) SEC run

Across all species, peak positions in the chromatograms matched the theoretical size separation range of the column for globular proteins (~10,000–600,000 Da) as noted in the Superdex 200 Increase 10/300 GL column's manufacturer's specifications. Fraction numbers for collection were chosen based on both the UV peak apex and SDS‑PAGE confirmation, ensuring that only fractions containing target protein were retained. The calibrated 750 μL UV‑to‑fraction delay determined from the mock eGFP runs allowed precise synchronization between chromatogram peaks and collected eluates. Overall, SEC successfully purified IF proteins from Bovine, Rat, Human, and Platypus samples, with highest yields for Bovine and Rat, while Porcine (pig) IF failed to recover, highlighting the importance of upstream verification before SEC loading.

Part 2: Concentrating Purified IF samples before analysis

Aim

To concentrate SEC-purified intrinsic factor proteins to ~1 mg/mL (or highest achievable) using centrifugal ultrafiltration (10 kDa MWCO), ensuring sufficient protein concentration for downstream binding assays.

Materials & Equipment

Materials

• SEC-purified IF fractions (Human, Platypus, Bovine, Rat)
• Nucleas-free water

Equipment

• 10 kDa MWCO centrifugal filters (15 mL or 2 mL capacity)
• Refrigerated centrifuge (4°C)
• Spectrophotometer (Protein A280 mode)
• Sterile collection tubes

Protocol

1. Label one 10 kDa MWCO centrifugal filter per IF sample
2. Pre-rinse filter:
   • Add 2 mL of nucleas-free water to the filter unit
   • Spin at 4,000 × g for 5 min at 4°C; discard flow-through
   • This step helps reduce non-specific protein binding to the membrane
3. Load IF sample into filter. If the sample volume is larger than the filter capacity, proces in multiple rounds.
4. Spin at 4,000 × g, 4°C for 15 min
5. Check the retentat volume
6. Add remaining sample (if applicable)
7. Second spin: continue centrifugation in 5-15 min intervals at 4,000 × g, 4°C
8. Check volume in retentat; if >50 µL, continue spinning in 5‑min intervals until ~50 µL remains. Avoid spinning to complete dryness- leaving ~50 µL above the membrane is safer to prevent protein loss.
9. Recover retentat by inverting filter into a clean collection tube; spin at 1,000 × g for 2 min
10. Keep samples on ice until measurement
11. Measure protein concentration on spectrophotometer at 280 nm (use 1.5 µL sample)

Results

Table 1. Recombinant IF concentrations after concentrating purified IF samples

Following SEC, concentrated protein yields highlighted further differences in recovery. Bovine IF reached the highest stock concentration (0.0607 mg·mL⁻¹; ~1.335 µM), with the largest total volume recovered, reflecting its higher SEC peak height. Rat IF yielded the second‑highest total amount (0.0217 mg·mL⁻¹; ~0.471 µM), consistent with its robust chromatogram và gel bands, though the absolute concentration was lower than Bovine. Human IF achieved a stock concentration comparable to Bovine (0.0617 mg·mL⁻¹; ~1.358 µM) but in very limited volume, restricting downstream use. This scarcity necessitates prioritizing Human IF for critical binding assays (planned Ab binding và B12 binding experiments; Experiments 15 & 16\) rather than for broader screening. Platypus IF, with a concentration of 0.0397 mg·mL⁻¹ (~0.862 µM), remains usable but will likely require careful handling to avoid depletion. Pig IF was discarded, as no SEC peak or gel band indicated recoverable target protein.

Discussion & Troubleshooting

We observed that yield differences across species most likely stem from upstream expression rather than SEC performance, since the Superdex 200 Increase column worked well within the appropriate molecular weight range. Low-yield species like Human và Platypus may require improved upstream expression strategies or stabilization during lysis to enhance recovery. For Pig IF, confirming expression at a small scale before SEC would prevent unnecessary column use. Additional yield loss likely occurred during the concentration step due to nonspecific binding, over-drying, adsorption to plastic surfaces, or buffer-related aggregation, which disproportionately affected samples with already low starting concentrations. Refining concentration practices could help prevent these losses in future preparations.

Overall, the SEC process was good for species with sufficient upstream protein yield, và the combined chromatogram/gel verification ensured high‑confidence fraction selection. The concentration data now guide prioritization for downstream assays: Bovine và Rat IF for broader binding studies; Human IF reserved for targeted experiments due to volume limitations; Platypus IF available with caution; Porcine (pig) IF excluded entirely.

1. Sumida, K. H., Núñez-Franco, R., Kalvet, I., Pellock, S. J., Wicky, B. I., Milles, L. F., Dauparas, J., Wang, J., Kipnis, Y., Jameson, N., Kang, A., De La Cruz, J., Sankaran, B., Bera, A. K., Jiménez-Osés, G., & Baker, D. (2024). Improving protein expression, stability, and function with proteinmpnn. Journal of the American Chemical Society, 146(3), 2054–2061.
2. Kowalik-Jankowska, T., Kozłowski, H., Farkas, E., & Sóvágó, I. (2007, March). Nickel ion complexes of amino acids and peptides. In Nickel and Its Surprising Impact in Nature, Volume 2 (pp. 63–107). Wiley.
3. Raran-Kurussi S, Cherry S, Zhang D, Waugh DS. Removal of Affinity Tags with TEV Protease. Methods Mol Biol. 2017;1586:221-230.
4. Andersen, C. B., Madsen, M., Storm, T., Moestrup, S. K., & Andersen, G. R. (2010). Structural basis for receptor recognition of vitamin-B12–intrinsic factor complexes. Nature, 464(7287), 445–448.