We decide to use proteins from mussel byssus which are strongly adhesive on multiple materials. Mfp3 and Mfp5 are our final options of the project because they mostly appear at the surface of byssus. Our purpose is to identify which protein has stronger stickiness. We use pET-21a plasmid that has T7 promotor, lac operator and 6xHis tag. We use engineered E. coli to produce the target proteins. The gene fragments and primers were designed and optimized using SnapGene software, and the codon optimization and synthesis were carried out by Tsingke Biotechnology.

Fig. 2 Construct design of pET21a-Mfp3 and pET21a-Mfp5 in Snapgene

We linearize target protein DNAs and vectors, amplify the quantity of target Mfp3 and Mfp5 gene fragments and combine them together to construct the plasmids. Then we transplant the plasmids to BL21 (DE3) competent cell. We successfully constructed and obtained positive clone strains of BL21-pET21a-Mfp3 and BL21-pET21a-Mfp5 (Fig. 3).

Fig. 3 DNA electrophoresis identification, separation and purification of Mfp3, Mfp5, and the pET21a plasmid backbone fragments.

First, we performed colony PCR on the constructed engineered strains to verify the correctness of the plasmid construction.

Fig. 4 Colony PCR verification of Mfp3 and Mfp5.

At the same time, we further confirmed the correctness of the plasmid construction through Sanger sequencing and expanded the positive clone bacteria culture to obtain the seed solution of the engineered strain.

For the positive colony, we make a scale culture of the seed bacterial. In the process we induce protein generation by adding IPTG molecules to the bacteria. After break the bacteria walls and extract proteins, we purify the proteins using His-Tag. During the purification process, we used a gradient concentration of imidazole solution to wash away the impurities and elute the target protein. Next we perform SDS- PAGE electrophoretic analysis to identify the protein bands of Mfp3 and Mfp5.

Fig. 5 SDS-PAGE of the purified Mfp3 and Mfp5 protein by His-Tag purification

Then, for the obtained target proteins Mfp3 and Mfp5, we conducted three tests to verify their functionality. The first aimed to enhance the adhesion capacity of the proteins; we performed a hydroxylation reaction on the target protein solution using mushroom-derived tyrosinase, while the effects of the hydroxylation reaction were identified using the NBT staining method and an amino acid analyzer. The second test involved detecting the adhesion effects of different protein groups on NC membranes using Coomassie Brilliant Blue staining. The third test further validated the macroscopic adhesion effects of the target proteins through adhesion tests with laboratory pipette tips and centrifuge tube lids. Detailed experimental results can be found in the Results section.

Through the above plasmid construction work, we successfully obtained engineered Escherichia coli capable of expressing and producing Mfp3 and Mfp5 proteins. During the construction, it was necessary to design primers to amplify the core region of the pET21a plasmid. Due to the presence of repeated sequences in the His tag (caccaccaccaccaccac), we found that there would be instances of incomplete matching at the beginning of primer design. Therefore, we shifted the selection area of the homologous recombination sequence (tgagatccggctgctaacaa) to avoid the repeated His tag sequences, which increased the specificity of the primers and ensured successful amplification of the target fragment. Additionally, during protein purification, based on our results, we found that low concentrations of imidazole wash buffer (10mM, 20mM) also had some effect on washing away nonspecific proteins. Thus, in the future, we can first use low concentrations for multiple washes and then increase the imidazole concentration. We can also appropriately extend the incubation time of the His tag chelator with the target protein solution to further enhance the purification efficiency.

By conducting hydroxylation reaction effect detection and adhesion analysis, we found that the Mfp5 protein exhibited superior adhesion properties. Therefore, we chose Mfp5 as the adhesion module for subsequent fusion proteins to construct the final coating protein.

In order to achieve the antibacterial and antimicrobial functions of the coating protein, our main objective in this round is to screen suitable antimicrobial peptides through antimicrobial experiments. Therefore, we identified three antimicrobial peptides, D51, Tet213, and Melittin, based on the literature. To ensure the stability of the antibacterial activity testing, we chose to obtain these three antimicrobial peptides directly through synthetic methods and conducted antibacterial tests on commonly used model organisms, Escherichia coli and Bacillus subtilis.

Fig. 6 Different antimicrobial peptides and their amino acid sequences.

To ensure the activity and quality of the antimicrobial peptides, we chose to synthesize the target peptides directly from GeneScript and prepare them at the same concentration. We mix antimicrobial peptides with E. coli and B. subtilis culture solutions and measure the OD600 values of three groups at four different concentrations (0ug/mL, 25ug/mL, 50ug/mL, 100ug/mL, 400ug/mL). We collected the OD600 absorbance values of the cultures every hour.

Fig. 7 Antibacterial testing of different antimicrobial peptides (growth curve method for Escherichia coli and Bacillus subtilis).

We assessed the effects of different concentrations of antimicrobial peptides on the growth of Escherichia coli and Bacillus subtilis. As shown in Figure 7, the D51 antimicrobial peptide can completely inhibit the growth of E. coli at a concentration of 50 µg/mL, while it exhibits an even better inhibitory effect on the growth of B. subtilis at the same concentration. At a concentration of 400 µg/mL, it can fully inhibit the growth of B. subtilis.

Through antimicrobial testing of different antimicrobial peptides, we successfully screened the desired antimicrobial peptide D51, which will further advance the project's progress. The next step is to combine the antimicrobial peptide with Mfp5 and the dual-ion peptide to construct a fusion protein, and we will carry out construction and testing work in line with the project objectives.

Based on the previous Engineering Cycles 1 and 2, we selected Mfp5 and D51 antimicrobial peptides as components of the fusion protein, while also incorporating the Poly KE (15) dual-ion peptide for the final product engineering construction. First, the fusion gene and the backbone fragment of the pET21a plasmid vector were obtained, followed by homologous recombination for linkage, and then transformed into competent Escherichia coli cells, followed by solid plate screening and cultivation. Subsequently, positive clone bacteria were expanded, induced for expression, and related functional tests were conducted, including hydroxylation reaction tests, adhesion tests, antimicrobial tests, and anti-fouling tests.

We designed the gene sequence and primers for the fusion protein zwi-Mfp5-D51 using Snapgene software. We selected pET21a as our plasmid vector. Considering that the T7 tag located at the N-terminus of the protein could potentially affect its function, we removed the T7 tag sequence during the design and retained the Met amino acid as the starting point of the ORF. The entire composite part includes a T7 promoter, lac operator, RBS, zwitterionic peptide Poly KE(15), Mfp5, and D51-P11K peptide. Additionally, we included some flexible linkers as connectors between zwitterionic peptide Poly KE(15), Mfp5, and D51-P11K peptide.

Fig. 9 Construct design of pET21a-zwi-Mfp5-D51 fusion gene in Snapgene

According to the designed sequences and primers, we first obtained the linearized vector pET21a through PCR technology, then connected it with the fragment of the fusion gene through homologous recombination, and transformed it into competent cells to screen for positive clones.

Fig. 10 DNA electrophoresis of PCR product of fusion gene fragment and pET21a linear fragment

Fig. 11 Colony verification of zwi-Mfp5-D51

After the construction was completed, we first performed PCR analysis on the plate colonies, identifying positive clone colonies. Then, we carried out liquid culture and scale-up cultivation to obtain seed bacterial solution for subsequent protein production experiments and verification experiments.

The engineered bacteria induced for expression were subjected to ultra-sonication and lysozyme lysis, resulting in a crude protein solution. The protein samples from different collection tubes during the purification process were analyzed using SDS-PAGE gel electrophoresis.

Fig. 12 SDS-PAGE analysis of zwi-Mfp5-D51 fusion protein

For the purified protein solution obtained, we conducted a series of tests for functional verification, which primarily included hydroxylation reactions and NBT staining, Coomassie Brilliant Blue staining to verify adhesiveness, pipette tip adhesion testing, antimicrobial testing of the coated protein, and fouling resistance testing of the coated protein. Specific detailed experimental data can be referenced in the Results section.

Through this round of engineering cycle design, construction, and testing, we successfully completed the verification of the project objectives. By utilizing the good adhesiveness of Mfp proteins and building upon that adhesion, we further enriched the functional characteristics of the fusion proteins by introducing antimicrobial peptides and dual ionic peptides, laying a solid foundation for the development of applications in real-world scenarios. In future work, we can further explore and optimize aspects such as the stability of the coating proteins, adaptation to more types of medical device materials, and coating preparation processes.